ID: 1078561700

View in Genome Browser
Species Human (GRCh38)
Location 11:12377996-12378018
Sequence CCCGGGCGACCGCGAGCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 125}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078561700_1078561709 -3 Left 1078561700 11:12377996-12378018 CCGCCCGCTCGCGGTCGCCCGGG 0: 1
1: 0
2: 2
3: 7
4: 125
Right 1078561709 11:12378016-12378038 GGGCGCTGCCCTCCTGGGCCGGG 0: 1
1: 0
2: 5
3: 56
4: 435
1078561700_1078561716 20 Left 1078561700 11:12377996-12378018 CCGCCCGCTCGCGGTCGCCCGGG 0: 1
1: 0
2: 2
3: 7
4: 125
Right 1078561716 11:12378039-12378061 GACCAGGCCAACGCCCCCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 88
1078561700_1078561708 -4 Left 1078561700 11:12377996-12378018 CCGCCCGCTCGCGGTCGCCCGGG 0: 1
1: 0
2: 2
3: 7
4: 125
Right 1078561708 11:12378015-12378037 CGGGCGCTGCCCTCCTGGGCCGG 0: 1
1: 0
2: 1
3: 34
4: 299
1078561700_1078561704 -9 Left 1078561700 11:12377996-12378018 CCGCCCGCTCGCGGTCGCCCGGG 0: 1
1: 0
2: 2
3: 7
4: 125
Right 1078561704 11:12378010-12378032 TCGCCCGGGCGCTGCCCTCCTGG 0: 1
1: 0
2: 1
3: 21
4: 203
1078561700_1078561705 -8 Left 1078561700 11:12377996-12378018 CCGCCCGCTCGCGGTCGCCCGGG 0: 1
1: 0
2: 2
3: 7
4: 125
Right 1078561705 11:12378011-12378033 CGCCCGGGCGCTGCCCTCCTGGG 0: 1
1: 0
2: 0
3: 21
4: 196
1078561700_1078561717 21 Left 1078561700 11:12377996-12378018 CCGCCCGCTCGCGGTCGCCCGGG 0: 1
1: 0
2: 2
3: 7
4: 125
Right 1078561717 11:12378040-12378062 ACCAGGCCAACGCCCCCGCCGGG 0: 1
1: 0
2: 2
3: 5
4: 160
1078561700_1078561721 28 Left 1078561700 11:12377996-12378018 CCGCCCGCTCGCGGTCGCCCGGG 0: 1
1: 0
2: 2
3: 7
4: 125
Right 1078561721 11:12378047-12378069 CAACGCCCCCGCCGGGCCGTGGG 0: 1
1: 0
2: 0
3: 7
4: 52
1078561700_1078561710 -2 Left 1078561700 11:12377996-12378018 CCGCCCGCTCGCGGTCGCCCGGG 0: 1
1: 0
2: 2
3: 7
4: 125
Right 1078561710 11:12378017-12378039 GGCGCTGCCCTCCTGGGCCGGGG 0: 1
1: 0
2: 1
3: 45
4: 295
1078561700_1078561720 27 Left 1078561700 11:12377996-12378018 CCGCCCGCTCGCGGTCGCCCGGG 0: 1
1: 0
2: 2
3: 7
4: 125
Right 1078561720 11:12378046-12378068 CCAACGCCCCCGCCGGGCCGTGG 0: 1
1: 0
2: 1
3: 16
4: 161
1078561700_1078561711 4 Left 1078561700 11:12377996-12378018 CCGCCCGCTCGCGGTCGCCCGGG 0: 1
1: 0
2: 2
3: 7
4: 125
Right 1078561711 11:12378023-12378045 GCCCTCCTGGGCCGGGGACCAGG 0: 1
1: 0
2: 1
3: 37
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078561700 Original CRISPR CCCGGGCGACCGCGAGCGGG CGG (reversed) Intronic
900203154 1:1420235-1420257 ACTGGGCGGCCGCGGGCGGGCGG - Exonic
901022196 1:6261088-6261110 GCCGGGCGGCCGGGGGCGGGGGG + Intergenic
901086617 1:6614887-6614909 GTCCGGCGACCGCGGGCGGGTGG + Intronic
901433864 1:9234671-9234693 CCCCGGCGGCCGCCAGCGGAGGG + Intergenic
901740409 1:11338247-11338269 CCCTGGCGACCGTGAAAGGGAGG - Intergenic
904620464 1:31772062-31772084 GCCGCGCGGCCGGGAGCGGGCGG + Intergenic
905018492 1:34793101-34793123 CCCGGCCTCCCGCGAGCAGGTGG - Intronic
905037998 1:34929817-34929839 CCCCGGCGGCCGCCCGCGGGCGG - Intergenic
906287233 1:44595339-44595361 CCCGGGCGTCCTGGAGGGGGTGG - Intronic
914942636 1:152036568-152036590 CCCGGGAGACCGCGGGCGAGGGG + Intronic
922196489 1:223364221-223364243 CCCAGGCGCCCCCGAGCGGGCGG + Intergenic
923055986 1:230426173-230426195 CAGGGGCGACCCAGAGCGGGCGG + Intergenic
1063201047 10:3785533-3785555 CGCGGGCGGCCGCGCGCCGGAGG + Intergenic
1067342947 10:45419234-45419256 GCCGGGCGAGCGCAGGCGGGCGG + Intronic
1070257771 10:74826040-74826062 CGCGGGCGGGCGCGCGCGGGCGG - Intronic
1072089636 10:92115041-92115063 CCCCGGCGGCCGCGGGCGCGGGG + Intronic
1073363566 10:102918867-102918889 CCCGGGGGAGCGCGGGCTGGGGG + Exonic
1075040632 10:119104396-119104418 CACAGGCGGCCGCGGGCGGGCGG - Intronic
1077121367 11:910488-910510 TCGGGGGGACCGCGAGTGGGAGG - Intronic
1077505915 11:2929870-2929892 CCCGGGAGCCCGAGAGCGGCAGG - Intergenic
1078561700 11:12377996-12378018 CCCGGGCGACCGCGAGCGGGCGG - Intronic
1079251616 11:18791539-18791561 TCCGGGCGCCGGCGAGCAGGCGG + Exonic
1083658530 11:64241670-64241692 CCCGGGCGTCCTCGCGGGGGTGG + Intronic
1088597009 11:111448470-111448492 CCCGGGGGACAGGGAGCAGGTGG - Intronic
1088764715 11:112963462-112963484 ACCGGCCGACCGCGGGCCGGGGG + Intronic
1089442803 11:118530927-118530949 CCCGGGCGTCCGCGGGCGAGGGG + Exonic
1090832277 11:130428002-130428024 GCCGGGCGACCGGGGGCGAGCGG - Exonic
1096495459 12:52037165-52037187 CGCGGGCGGCCGCGGGCGCGGGG + Intronic
1097019113 12:56007614-56007636 CCCGGGCGGCCCAGTGCGGGGGG - Intergenic
1097990122 12:65825144-65825166 GCGGGGCGAGCGCGAGCTGGCGG - Exonic
1102475509 12:113185826-113185848 CCCGGGGCACCGCGCGCGGACGG - Exonic
1114483204 14:23047944-23047966 CCCGGCCCACCGCGGGGGGGGGG - Exonic
1114636285 14:24188680-24188702 ACCGGGCCAGGGCGAGCGGGAGG - Intronic
1117178586 14:53169848-53169870 CCCGGGGGACTGGGAGAGGGTGG + Intergenic
1119720207 14:76885062-76885084 CCCGGGAGGCCGGGAGAGGGTGG + Intergenic
1122209442 14:100165574-100165596 ACCGGGCGGCCGCGGACGGGCGG + Intergenic
1122558421 14:102593378-102593400 CCCCGGCGAGCCCGAGGGGGCGG + Intronic
1122773485 14:104107220-104107242 CCCGGGCGGCCGCGTGCAGTGGG - Exonic
1122888994 14:104724082-104724104 CCCGGGCAGCGGCGAGGGGGCGG + Intergenic
1122917368 14:104865323-104865345 CCCGGGCTGCCACGAGCGTGCGG + Exonic
1125603931 15:40929582-40929604 CCCGCGCGTCCGCCAGCCGGCGG - Exonic
1128547532 15:68578495-68578517 CCCGGGCCAGCGCGAGGTGGGGG + Intergenic
1132309951 15:100849973-100849995 CCCGGGGACCCGGGAGCGGGGGG + Intergenic
1132719496 16:1308952-1308974 CGTGGGGGACCGCGAGCGGCGGG - Exonic
1139410053 16:66751665-66751687 CGCGAGGGACGGCGAGCGGGGGG - Exonic
1141682642 16:85553445-85553467 CGCGGGCGGCCCCGAGCGGCCGG + Intergenic
1142426912 16:90006385-90006407 CCTAGGCGACCCCGAGCGGCAGG - Exonic
1147652986 17:42072594-42072616 CCCGGGTGGCCGCGAGCGGCTGG - Intergenic
1148337535 17:46851644-46851666 CCAGGGCCAGCGCGGGCGGGGGG - Exonic
1151490637 17:74430883-74430905 CCTGAGCGCCCGCGAGGGGGAGG - Intronic
1151627946 17:75289243-75289265 CCCGGGCGCTCACGAGAGGGCGG - Intronic
1151660753 17:75516763-75516785 CTTCTGCGACCGCGAGCGGGCGG - Exonic
1154151255 18:11908390-11908412 CCCCGGCGACCTCAGGCGGGCGG + Exonic
1157492814 18:48136204-48136226 CCCGGGCGCCCGCGGGAGTGGGG + Intronic
1158976534 18:62715850-62715872 CCCCGGCGGCCCCGAGCGGCGGG + Exonic
1160053233 18:75455888-75455910 CCCGGGAACCCGCGAGCGCGGGG + Intergenic
1160919497 19:1513127-1513149 CCCGGGCGCCCTCGCGCGGCGGG + Exonic
1161209984 19:3061431-3061453 CCCGGGGGAAGCCGAGCGGGTGG + Intronic
1161241131 19:3224612-3224634 CCGGGGCGGGCGCGGGCGGGAGG + Intergenic
1163443778 19:17334705-17334727 CCCGGGCGACGGGGAGCCGCGGG + Exonic
1165333609 19:35154706-35154728 GCCAGGGGAGCGCGAGCGGGCGG - Intergenic
1168246931 19:55117193-55117215 CCCGGGAGACGCCGGGCGGGGGG + Intronic
1168722762 19:58563260-58563282 CCTGGGGGAGCGCCAGCGGGTGG + Exonic
927214701 2:20661777-20661799 CCCAGGCTACCGGGAGGGGGAGG - Intergenic
928904412 2:36355591-36355613 CCCGGCCGCCCGAGAGGGGGAGG + Intergenic
929604720 2:43226722-43226744 GCCTGACGTCCGCGAGCGGGCGG - Intergenic
931665912 2:64609454-64609476 CTGGGGCGCCCCCGAGCGGGCGG - Intergenic
936038394 2:109129978-109130000 CCCCGCCGCCCGCGAGCGTGGGG - Exonic
938034873 2:128027635-128027657 GCCGGGGGAGCGCGGGCGGGCGG - Intronic
946306458 2:218859528-218859550 TCCAGGCGGCCGCGAGCGGCGGG + Intergenic
947506585 2:230712769-230712791 CTCGGGCGCCCCCGAGCGGCCGG - Intergenic
1168965228 20:1894688-1894710 CCCGGGCGCCGGCGCGGGGGAGG + Intronic
1172944013 20:38674221-38674243 CCCGTGTCCCCGCGAGCGGGAGG + Intergenic
1174287253 20:49482424-49482446 CTCGGGCGGCAGCGAGCTGGTGG + Exonic
1176161833 20:63652450-63652472 GCCGGGCGACCTCGGGCGCGAGG - Intronic
1178453575 21:32727477-32727499 CCCGGGCTACCGCCGGCTGGGGG + Intronic
1180876937 22:19178937-19178959 CCTGGGCGACCGCGAGCGGCGGG + Intergenic
1181273572 22:21674817-21674839 CACGGGTGACCCCGAGCAGGAGG - Intronic
1181457920 22:23070260-23070282 CCAGGCCAACCGCGGGCGGGGGG - Intronic
1181779056 22:25179499-25179521 GCCGCGCGAGCACGAGCGGGAGG - Intronic
1183601512 22:38843165-38843187 GCCGGACGACCGCGGCCGGGCGG + Intronic
950464595 3:13145788-13145810 CCTGGGCGCCCGGGGGCGGGGGG + Intergenic
950549020 3:13655300-13655322 GCCGGGCGGCTGCCAGCGGGAGG - Intergenic
951613993 3:24521931-24521953 CCCGGGGGACCTTGAGCGGGCGG + Intergenic
961858154 3:129893351-129893373 CCCGACAGGCCGCGAGCGGGAGG + Intronic
962722262 3:138187235-138187257 CCCCGCCCACCGCGAGCGGCAGG + Intronic
966808692 3:183825373-183825395 CCCGGGCGCCCGCGGGAGGCTGG + Exonic
968382369 4:107684-107706 CCTCGGCGACCGCGCGGGGGAGG - Intergenic
968518339 4:1024113-1024135 CCCGGGCGCTGGCGGGCGGGGGG + Intronic
969720867 4:8892579-8892601 CCCGGGCGCCTCCGAGAGGGCGG - Intergenic
973820415 4:54657832-54657854 CCCGGGCGGGCGCGAGGGAGGGG + Intergenic
983940223 4:173529394-173529416 CCCGGGCGCCCGGGGGCTGGGGG - Exonic
984973580 4:185210417-185210439 CCCCGGCGCCCGCGCGCGGCGGG + Intronic
1011734119 6:90295882-90295904 CCCGGACCACCGCGACCGGCGGG - Intronic
1017874729 6:158515188-158515210 ACCGGGCCACAGCGAGCTGGTGG + Intergenic
1019400526 7:849965-849987 CCGTGGCGACTGCGAGTGGGCGG - Intronic
1020080346 7:5283162-5283184 CCCGGGCGGGCGGGAGGGGGCGG - Intronic
1020899943 7:13991357-13991379 CCAGGGTAACCGCGAGGGGGCGG + Intronic
1021510535 7:21428143-21428165 TCCGAGCCACCGCGGGCGGGCGG + Exonic
1024993534 7:55254550-55254572 CCCGAGGGCCCGGGAGCGGGAGG - Intronic
1027233005 7:76282836-76282858 CTTGGGCGACGGCGAGCGGCTGG - Exonic
1029238649 7:99143544-99143566 GCCGGGCAACGGCGAGGGGGCGG + Intronic
1031415292 7:121488823-121488845 CCTGGGGGACAGCGAGAGGGTGG + Intergenic
1032068736 7:128791335-128791357 TCCGGGCGGCGGCGAGCGGCGGG + Intronic
1032298828 7:130668471-130668493 CCCGGGCAGCCGCGAGGGGAGGG + Intronic
1034347620 7:150397105-150397127 CCCGGGCGTGCGCGCGCTGGTGG - Exonic
1034501258 7:151452312-151452334 CCTGGGAGACAGGGAGCGGGAGG + Intergenic
1035021506 7:155803610-155803632 CCCCGGGGACCGCGTGCTGGCGG - Exonic
1035212072 7:157336404-157336426 CCCCGGCGAACGGGAGCGCGTGG - Intronic
1038267172 8:26046219-26046241 CCGCGGCGACCGCGCGCGGTGGG - Intergenic
1039936514 8:42051423-42051445 CCCGAGCGCCCGCGAGCGCGGGG + Intronic
1043891235 8:85654488-85654510 TCCGGGGGACCGGGAGTGGGGGG + Intergenic
1043892309 8:85661325-85661347 TCCGGGGGACCGGGAGTGGGGGG + Intergenic
1043893252 8:85716015-85716037 TCCGGGGGACCGGGAGTGGGGGG - Intergenic
1043895935 8:85737464-85737486 TCCGGGGGACCGGGAGTGGGGGG - Intergenic
1043896744 8:85744344-85744366 TCCGGGGGACCGGGAGTGGGGGG + Intergenic
1043899067 8:85762711-85762733 TCCGGGGGACCGGGAGTGGGGGG + Intergenic
1043900678 8:85774905-85774927 TCCGGGGGACCGGGAGTGGGGGG + Intergenic
1043902642 8:85790180-85790202 TCCGGGGGACCGGGAGTGGGGGG + Intergenic
1043904252 8:85802373-85802395 TCCGGGGGACCGGGAGTGGGGGG + Intergenic
1043905864 8:85814567-85814589 TCCGGGGGACCGGGAGTGGGGGG + Intergenic
1043907472 8:85826754-85826776 TCCGGGGGACCGGGAGTGGGGGG + Intergenic
1055945861 9:81690027-81690049 CGCGGGCGCGCGCTAGCGGGAGG + Intergenic
1057716648 9:97501528-97501550 CCCGGGCGCCCCCGAGTGGAGGG + Intronic
1057716696 9:97501644-97501666 CCCGGGCGGCCGCGGGCGGGCGG - Exonic
1060468671 9:123929957-123929979 GCCGGTCGGCCGCGGGCGGGCGG - Exonic
1060979719 9:127785418-127785440 GCCGGCGGACAGCGAGCGGGCGG + Intergenic
1062022601 9:134326529-134326551 CCCGGGCGGCGGGGAGCCGGCGG - Intronic
1187648369 X:21374325-21374347 ACCGCGCGGCAGCGAGCGGGCGG + Intergenic
1187698206 X:21941219-21941241 CCCGGGCTGCCGGGCGCGGGCGG + Intronic
1187888071 X:23907640-23907662 CTCGGGCGGCCGGGAGGGGGCGG + Intronic
1189322897 X:40097169-40097191 CCCGGGAGACCGCGGACGGGTGG - Intronic
1191830257 X:65407750-65407772 CCCGGGCGACTGAGGCCGGGGGG + Intronic
1196031111 X:111096438-111096460 CCCGGGCTACCGCGGGGGAGGGG + Intronic
1197711947 X:129678017-129678039 TCCTGGCCGCCGCGAGCGGGCGG + Intergenic