ID: 1078562715

View in Genome Browser
Species Human (GRCh38)
Location 11:12387328-12387350
Sequence TTTTTTCTGCAGATGCCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 346}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078562712_1078562715 3 Left 1078562712 11:12387302-12387324 CCCTAGGCAGCATCCTTTCTTTT 0: 1
1: 0
2: 3
3: 27
4: 340
Right 1078562715 11:12387328-12387350 TTTTTTCTGCAGATGCCATGAGG 0: 1
1: 0
2: 3
3: 28
4: 346
1078562708_1078562715 19 Left 1078562708 11:12387286-12387308 CCTCCTCCTGCACAGGCCCTAGG 0: 1
1: 0
2: 2
3: 37
4: 354
Right 1078562715 11:12387328-12387350 TTTTTTCTGCAGATGCCATGAGG 0: 1
1: 0
2: 3
3: 28
4: 346
1078562710_1078562715 16 Left 1078562710 11:12387289-12387311 CCTCCTGCACAGGCCCTAGGCAG 0: 1
1: 0
2: 1
3: 31
4: 277
Right 1078562715 11:12387328-12387350 TTTTTTCTGCAGATGCCATGAGG 0: 1
1: 0
2: 3
3: 28
4: 346
1078562713_1078562715 2 Left 1078562713 11:12387303-12387325 CCTAGGCAGCATCCTTTCTTTTC 0: 1
1: 0
2: 1
3: 30
4: 452
Right 1078562715 11:12387328-12387350 TTTTTTCTGCAGATGCCATGAGG 0: 1
1: 0
2: 3
3: 28
4: 346
1078562714_1078562715 -10 Left 1078562714 11:12387315-12387337 CCTTTCTTTTCTGTTTTTTCTGC 0: 1
1: 1
2: 14
3: 272
4: 3263
Right 1078562715 11:12387328-12387350 TTTTTTCTGCAGATGCCATGAGG 0: 1
1: 0
2: 3
3: 28
4: 346
1078562711_1078562715 13 Left 1078562711 11:12387292-12387314 CCTGCACAGGCCCTAGGCAGCAT 0: 1
1: 0
2: 0
3: 16
4: 170
Right 1078562715 11:12387328-12387350 TTTTTTCTGCAGATGCCATGAGG 0: 1
1: 0
2: 3
3: 28
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078562715 Original CRISPR TTTTTTCTGCAGATGCCATG AGG Intronic
901048698 1:6415037-6415059 TTTTTTGTAGAGATGCCCTGAGG - Intronic
901075618 1:6553142-6553164 CTTTCTCTGTAGCTGCCATGGGG - Intronic
902031998 1:13429967-13429989 CTTTTTCTGTAAATGCCAGGTGG - Intergenic
903564150 1:24252170-24252192 TTGTTTCTGCAGAGTTCATGAGG - Intergenic
904446417 1:30576582-30576604 TTTATCCTTGAGATGCCATGTGG + Intergenic
905026800 1:34855972-34855994 GCTTTTCCGCAGATGTCATGTGG - Exonic
906683968 1:47750846-47750868 TTTGTTCTTCAGGTGCCAGGTGG + Intergenic
907349144 1:53811592-53811614 TTTTTGCTGCAGCTGCTGTGGGG - Intronic
908415491 1:63909397-63909419 TGTTATCTTCAGATGCCATTTGG + Intronic
910120604 1:83785174-83785196 TATTTTTTGCAGATTCCATGTGG - Intergenic
910124689 1:83827537-83827559 TAGTTTGAGCAGATGCCATGTGG + Intergenic
910483810 1:87687854-87687876 ATCTATCTGCAGATGCCACGTGG - Intergenic
911281037 1:95929303-95929325 GTTTGTCTGCAGAGGGCATGAGG - Intergenic
912207326 1:107523122-107523144 GCTTTTATGCAGATGGCATGAGG - Intergenic
912965697 1:114235350-114235372 CTTTTTCTCCAGAAGCCCTGAGG + Intergenic
913522519 1:119659154-119659176 TTTTTTCTGAAAGTGCTATGAGG - Intergenic
914703164 1:150151185-150151207 CTTTCTCTGCAGATGAGATGGGG - Intronic
915755785 1:158257923-158257945 TTTTATCTCCAGATGGAATGGGG + Exonic
915917653 1:159950662-159950684 TTACTTATGCAGTTGCCATGGGG - Intergenic
916204080 1:162298367-162298389 TGTTGTCAGCGGATGCCATGTGG + Intronic
916704778 1:167337885-167337907 TGTTTTGTGCAGATGCAATCGGG + Intronic
916830301 1:168484163-168484185 TTATTTCTTAAGATTCCATGAGG + Intergenic
918029716 1:180793961-180793983 TTGTTTGTGAAGATGCCATTTGG - Intronic
918565018 1:185918884-185918906 TCTTATCTACAGAAGCCATGAGG + Intronic
920244001 1:204574555-204574577 TTTTTTCTGAAGCTCCCATTTGG - Intergenic
921742789 1:218705758-218705780 TTGTTTGTCCTGATGCCATGGGG + Intergenic
922057788 1:222057948-222057970 TTTTATGTGCAGATGCCACAGGG + Intergenic
922324930 1:224519029-224519051 GTTGTTCTGCAGATGAAATGAGG + Intronic
922345675 1:224694333-224694355 TTTCTTCTCCTGCTGCCATGAGG - Intronic
922926039 1:229347328-229347350 TTTGTTCTGCAGATGAGATGAGG - Intergenic
923961112 1:239084846-239084868 TTTTTGCTGCAGCTGCTGTGGGG + Intergenic
1062887864 10:1032737-1032759 TTTCTTCTGCATATGCTATTGGG + Intergenic
1064218822 10:13422057-13422079 TTGGTTCTGCAGAAGCCAGGAGG - Intergenic
1064261923 10:13792868-13792890 TTTCCTCTGCAGAGGCCCTGAGG - Intronic
1065082968 10:22145488-22145510 CTTTTTCTGTAAATGCCAGGTGG - Intergenic
1065250166 10:23802963-23802985 TTTATTCTGCACACCCCATGAGG + Intronic
1065653394 10:27918788-27918810 TTTTTTTTGTAGATACCATAGGG - Intronic
1065847364 10:29757203-29757225 TTTCCTCTGCCGATGCCCTGTGG + Intergenic
1066591814 10:37003448-37003470 TTTGTTCTCCAGATGACATCTGG + Intergenic
1067480179 10:46589932-46589954 TTTCTTCTGGAGTTGCCTTGTGG - Intronic
1067614559 10:47751867-47751889 TTTCTTCTGGAGTTGCCTTGTGG + Intergenic
1069123540 10:64600123-64600145 TTTTTTCTGTAGCTGCCTTAGGG + Intergenic
1071432446 10:85617125-85617147 TGTTTTCTGCAAATGGCATCAGG + Intronic
1071629965 10:87211840-87211862 TTTCTTCTGGAGTTGCCTTGTGG + Intergenic
1071887502 10:89966981-89967003 ATTTTTCAGCAGATGCCAACTGG - Intergenic
1073561685 10:104502450-104502472 TTGTCTCAGCTGATGCCATGTGG - Intergenic
1073614508 10:104979701-104979723 TTTCCTCTGCAAATGTCATGTGG - Intronic
1073716593 10:106114903-106114925 TTTTTCCTGCTGGTGCCAGGGGG + Intergenic
1077632374 11:3819466-3819488 GTTTTTGTGCAGTTGGCATGGGG + Intronic
1077807533 11:5604640-5604662 CTTTTTCTGAAGATGTCCTGGGG + Intronic
1078562715 11:12387328-12387350 TTTTTTCTGCAGATGCCATGAGG + Intronic
1079324678 11:19481309-19481331 TTCTTTCTGCAGAGTCCTTGGGG - Intronic
1080892953 11:36425404-36425426 TTTTTCCTGGAGATTCCTTGAGG - Intronic
1081058409 11:38440403-38440425 TTTTTTTTGCATATGCAAAGAGG - Intergenic
1081451573 11:43175671-43175693 TTTTTTCTGGAGATGTAATGGGG - Intergenic
1081877805 11:46422002-46422024 TTTGTTCTGAACATCCCATGGGG - Intronic
1081938377 11:46919952-46919974 ATTTTTATCCAGATGCAATGTGG + Intergenic
1081949789 11:47034435-47034457 TTTTTAATGCAGATGCTAAGGGG - Intronic
1081996982 11:47372066-47372088 CATTTTCTGCAGATGTAATGCGG - Intronic
1082285652 11:50315406-50315428 TTTTTTCAGCTGAAGCCTTGGGG + Intergenic
1086457277 11:86971798-86971820 TTTTTTGTGCAGATGGGGTGGGG + Intergenic
1087006820 11:93479526-93479548 TGTGTTCTGTACATGCCATGAGG + Intronic
1087866537 11:103234664-103234686 CTTTTTCTGCAACTGCCTTGGGG + Intronic
1088132900 11:106516759-106516781 CTCTTTCTGTAGATTCCATGGGG - Intergenic
1088800978 11:113306914-113306936 TTTTTTCTCCTGAGGACATGAGG - Intergenic
1089131845 11:116218549-116218571 TGTGTTCTGCTGATGCCTTGTGG - Intergenic
1090519706 11:127465122-127465144 TTTTATCACCAGATGCCATAGGG - Intergenic
1090678580 11:129028902-129028924 TGTTTTCTGAACATGGCATGTGG - Intronic
1090876949 11:130798707-130798729 TTTTTTCTGAAGAGGCCAAAAGG + Intergenic
1091402055 12:187100-187122 TTTTTGCAGCAGAAGCCCTGAGG - Intergenic
1093119752 12:15254578-15254600 TTATTTCTGTAGATTACATGTGG + Intronic
1094883742 12:34836907-34836929 CTTTTTCTGGAGTTTCCATGTGG + Intergenic
1094890069 12:34939500-34939522 TTTTTTGTGGAGTTTCCATGTGG + Intergenic
1094893336 12:34992498-34992520 TTTTTTGTGGAGTTTCCATGTGG + Intergenic
1094893418 12:34993854-34993876 TTTTTTGTGGAGTTTCCATGTGG + Intergenic
1094896506 12:35043788-35043810 TTTTTTGTGGAGTTTCCATGTGG + Intergenic
1094904904 12:35179657-35179679 TTTTTTGTGGAGTTTCCATGTGG + Intergenic
1094909214 12:35249287-35249309 TTTTTTGTGGAGTTTCCATGTGG + Intergenic
1094914722 12:35338625-35338647 TTTTTTGTGGAGTTTCCATGTGG + Intergenic
1094914803 12:35339981-35340003 TTTTTTGTGGAGTTTCCATGTGG + Intergenic
1094939199 12:35735145-35735167 CTTTTTCTGGAGTTTCCATGTGG + Intergenic
1094939803 12:35744996-35745018 TTTTTTGTGGAGTTTCCATGTGG + Intergenic
1094944139 12:35815321-35815343 TTTTTTGTGGAGTTTCCATGTGG + Intergenic
1094947675 12:35872380-35872402 CTTTTTGTGCAGTTTCCATGTGG + Intergenic
1094948130 12:35879858-35879880 CTTTTTGTGCAGTTTCCATGTGG + Intergenic
1094949518 12:35902621-35902643 TTTTTTGTGGAGTTTCCATGTGG + Intergenic
1094952305 12:35947799-35947821 GTTTTTGTGGAGATTCCATGTGG + Intergenic
1094953835 12:35972261-35972283 TTTTTTGTGGAGTTTCCATGTGG + Intergenic
1094954850 12:35988566-35988588 CTTTTTCTGGAGTTTCCATGTGG + Intergenic
1094964413 12:36143466-36143488 TTTTTTGTGGAGTTTCCATGTGG + Intergenic
1094971433 12:36256588-36256610 CTTTTTCTGGAGTTTCCATGTGG + Intergenic
1094974840 12:36311280-36311302 TTTTTTGTGGAGTTTCCATGTGG + Intergenic
1094977826 12:36359167-36359189 TTTTTTGTGGAGTTTCCATGTGG + Intergenic
1094982544 12:36435960-36435982 CTTTTTCTGGAGTTTCCATGTGG + Intergenic
1094990819 12:36570171-36570193 CTTTTTCTGGAGTTTCCATGTGG + Intergenic
1094999410 12:36708578-36708600 CTTTTTCTGGAGTTTCCATGTGG + Intergenic
1095005172 12:36802250-36802272 TTTTTTGTGGAGTTTCCATGTGG + Intergenic
1095006530 12:36824322-36824344 CTTTTTCTGGAGTTTCCATGTGG + Intergenic
1095008884 12:36862350-36862372 CTTTTTCTGGAGTTTCCATGTGG + Intergenic
1095009131 12:36866431-36866453 TTTTTTGTGGAGTTTCCATGTGG + Intergenic
1095020237 12:37046238-37046260 TTTTTTGTGGAGTTTCCATGTGG + Intergenic
1095025176 12:37126053-37126075 TTTTTTGTGGAGTTTCCATGTGG + Intergenic
1095026270 12:37143720-37143742 TTTTTTGTGGAGTTTCCATGTGG + Intergenic
1095346321 12:41153422-41153444 TTTTTACTACAGATGACTTGTGG - Intergenic
1096452707 12:51757477-51757499 TTTTTTCTGCAAATGCAATGAGG + Intronic
1097932655 12:65206569-65206591 TTTTTTAAACTGATGCCATGTGG + Intronic
1098506238 12:71254086-71254108 TTTTTTCTGTGGTTACCATGAGG - Intronic
1098735544 12:74098208-74098230 TTTTTTCTGATTATGTCATGAGG - Intergenic
1099638902 12:85257895-85257917 TTTTTCTTAAAGATGCCATGTGG - Intronic
1100863093 12:98828196-98828218 TTCTGCCTGCAGATGCCTTGGGG - Intronic
1101521618 12:105487542-105487564 ATTTGTCTGCAGATTCAATGGGG + Intergenic
1101747954 12:107558491-107558513 TTTTGTCTGCAGGTGTCATGGGG + Intronic
1101848670 12:108384887-108384909 TTTTTTCTGTAGATGTGGTGGGG - Intergenic
1103811469 12:123617670-123617692 TTTTAGCTGCAGCAGCCATGTGG + Intronic
1104482052 12:129116020-129116042 ATTTCTCTGCAGATGGCCTGCGG - Intronic
1105531879 13:21228175-21228197 TTCTTTCCGCAGCTGCCATGGGG + Intergenic
1106067986 13:26376778-26376800 TTTTTTCTGCAGATACTATGGGG - Intronic
1106542970 13:30706370-30706392 GCTTTTCTGCAGATCCCAAGGGG - Intergenic
1107017500 13:35719502-35719524 TTCTTTCTGCTGCTCCCATGAGG - Intergenic
1107171842 13:37351940-37351962 TTTTTTTTGCAGAGGCTAAGGGG + Intergenic
1107898246 13:44987536-44987558 GTTTTCCTGCAGATCCTATGGGG - Intronic
1108354824 13:49620614-49620636 TTTATTCAGCAAATGGCATGTGG - Intergenic
1108584586 13:51859162-51859184 TTTTTTTTACAAATGCCCTGAGG - Intergenic
1109767288 13:66919361-66919383 TATTTGCTTCAGATGCCAAGGGG - Intronic
1115078738 14:29423728-29423750 TTTTTTCTCCAGAGGACAGGCGG - Intergenic
1115447877 14:33512524-33512546 TGTTTTCCACAAATGCCATGAGG - Intronic
1116123386 14:40750272-40750294 TTTTTTTTGAAGTTGCCCTGAGG - Intergenic
1116729364 14:48602810-48602832 TTTTTTTTGTAGATGATATGGGG - Intergenic
1116863169 14:50010553-50010575 GTTGTTCAGCAGAGGCCATGGGG + Intergenic
1117544876 14:56784836-56784858 TTTCTTCTGCATCTGCTATGGGG - Intergenic
1118614968 14:67569061-67569083 TTTTTCCTGCACATGCCTGGAGG + Intronic
1120886567 14:89456389-89456411 TCATTGCTGGAGATGCCATGGGG - Intronic
1125307113 15:38330970-38330992 TTTTTTCTGCAGCTGTCATCTGG + Intronic
1127139227 15:55957190-55957212 TTTTTTCTGTAGATTCCTTGGGG + Intronic
1127237905 15:57075731-57075753 TTTTTTCTGGACATGACATGAGG + Intronic
1128730152 15:70015436-70015458 CTTTTAGTGCACATGCCATGAGG + Intergenic
1130248723 15:82280479-82280501 TTTTTTCTTGAGGTACCATGAGG - Intronic
1130297078 15:82655128-82655150 TCTGTTCTCCAGATGCCATAGGG + Intergenic
1131643214 15:94314270-94314292 TTTTCTTTGCAGAAGCTATGTGG + Exonic
1134020149 16:10915836-10915858 TTCTTTCTGCAGGTGCCTTGGGG - Intronic
1134893215 16:17860046-17860068 TATTTACTGAAGATTCCATGGGG + Intergenic
1135907240 16:26524208-26524230 TTTTCTCTGCAGTTGCTAGGTGG - Intergenic
1136111816 16:28068140-28068162 TTTGGTCTGCAGGTGCCATGTGG - Intergenic
1137975949 16:53032340-53032362 TATTTTCTGCAGGTGCCATTGGG - Intergenic
1138896419 16:61210852-61210874 TTTTTGCTGCAGATTCCTGGTGG - Intergenic
1139847298 16:69930022-69930044 TTGTCTCTGCAGAGCCCATGAGG - Intronic
1140422454 16:74831803-74831825 ATTTTTCAGCAGAAGCCATTTGG + Intergenic
1141026803 16:80556476-80556498 TTTTTTCTGCTACTCCCATGTGG - Intergenic
1143362239 17:6381696-6381718 TTTTCTCTGCTGATGCACTGGGG - Intergenic
1143918493 17:10312534-10312556 TTCTTTGTGAAGATGGCATGAGG - Intronic
1145095226 17:20019577-20019599 CTTTATCTGCAAATTCCATGAGG + Intronic
1145925499 17:28644177-28644199 ATTTTTCTGCAGGTGGCTTGTGG - Exonic
1148770499 17:50063409-50063431 TTTTTCCTCCTGAAGCCATGTGG - Intronic
1149818087 17:59746767-59746789 TTTTTTCTGCTGATGGCTTACGG + Intronic
1150612095 17:66741647-66741669 TTTCTTTTGCAGATTCTATGCGG + Exonic
1150839641 17:68595862-68595884 TTCCTTCCACAGATGCCATGGGG + Intronic
1156267709 18:35503530-35503552 TGTTTCCTCCAGATGCCCTGAGG - Intergenic
1157733099 18:50021702-50021724 TTTTTTACGCAGATGGGATGGGG - Intronic
1158061241 18:53346003-53346025 TTTTTTCCTGAGATGACATGTGG + Intronic
1158331517 18:56368032-56368054 TTCTTGCTGCAGCTGCTATGGGG + Intergenic
1158584795 18:58722506-58722528 TGGTTTCTGCAGTAGCCATGTGG - Intronic
1159252932 18:65905393-65905415 GTTTTTCTGCAGAGGCTCTGAGG - Intergenic
1161417143 19:4153713-4153735 TTCTGTCTGCAGATGCCTCGGGG - Exonic
1164087734 19:21919090-21919112 AATTTTCTGCAGATGTCATTGGG + Intergenic
1164827143 19:31292110-31292132 TTTATTCTACAAAAGCCATGAGG + Intronic
1164846329 19:31436244-31436266 TTCTGGCTTCAGATGCCATGGGG - Intergenic
1165292840 19:34903189-34903211 TTTTTTTTGCAGATTCCTTTGGG - Intergenic
929087434 2:38182342-38182364 ATTTTTCTACAGATGCGTTGGGG - Intergenic
929423832 2:41823235-41823257 TTTCTTTTGCAGATTCCTTGGGG - Intergenic
930272446 2:49272594-49272616 TTTGTTCGGCAGATACCATGTGG - Intergenic
931711786 2:64994066-64994088 CTTCTCCTCCAGATGCCATGTGG - Intronic
935002208 2:99029972-99029994 GTTTTCCTGCAGATTCCATGGGG - Intronic
935243916 2:101201929-101201951 TTATTTCTCTAGATGCAATGTGG + Intronic
936759890 2:115764757-115764779 TTTTTTCTTCAGATGCTCTAAGG + Intronic
937838155 2:126495178-126495200 ATTGTTCTGGAAATGCCATGGGG - Intergenic
938013052 2:127844168-127844190 TTTTTTCTGCATCTTCCATAGGG - Intergenic
938162134 2:128995572-128995594 TTTTTTCTGTTGATAGCATGGGG - Intergenic
938578696 2:132627094-132627116 TTTTTCCAGCAGATGTCCTGAGG + Intronic
939124659 2:138163131-138163153 TTTTTTCTGTAGATGCAAAAAGG - Intergenic
939261621 2:139818039-139818061 TTTTTTCTACCGATTCAATGTGG + Intergenic
939404479 2:141738036-141738058 TTTTTCCTGGAGATTGCATGTGG - Intronic
939413816 2:141866232-141866254 TTTTCTCTGCAGATGACTTAAGG - Intronic
939877949 2:147599043-147599065 CTTTTTCTGCAGAAGCCTGGAGG + Intergenic
939911340 2:147987435-147987457 TTTTTTCTACAGCTACCATAAGG + Intronic
941509675 2:166389976-166389998 TTCCTTCTCCAGATCCCATGAGG - Intergenic
943164019 2:184294209-184294231 ATTTTTTTGGAGATGCCACGTGG + Intergenic
943793087 2:191957614-191957636 TTTGTTTTGCAGATGGCATCTGG - Intronic
944378597 2:199078507-199078529 TTTTTTTTGTAGATTCCTTGGGG - Intergenic
944394671 2:199253031-199253053 TTATTTTTGCTGAAGCCATGAGG - Intergenic
944826140 2:203484976-203484998 TGTTTTCTGCACTTACCATGTGG - Intronic
945708892 2:213271377-213271399 CTTCTTCTGCAGATGTCAGGTGG - Intergenic
945997561 2:216450834-216450856 TGTTCTCTGCAGATGCCTTGGGG + Exonic
946081696 2:217125697-217125719 TTTGTACTACACATGCCATGAGG - Intergenic
946112511 2:217432271-217432293 TTTTTCCTGTAGATTTCATGAGG - Intronic
946899516 2:224358811-224358833 TTTTTAATGCAGGTGGCATGGGG - Intergenic
948960348 2:241330250-241330272 TGTTTTCTGCACAAGCCCTGTGG - Intronic
1168862050 20:1052580-1052602 GTTGTTGTGCAGATGCAATGAGG - Intergenic
1169789814 20:9397918-9397940 TTTTGTCAGCAGATGACATCTGG + Intronic
1169797587 20:9481350-9481372 TTTTTTCCCCAGATGGCATCTGG + Intergenic
1169881844 20:10355233-10355255 TTTTGTGGGCAGATTCCATGGGG + Intergenic
1171097952 20:22350351-22350373 TTTTTTCTGTAAACTCCATGAGG + Intergenic
1171133885 20:22679109-22679131 ATTTTTCTGCCAATGACATGAGG - Intergenic
1172160326 20:32863521-32863543 GTTGTCCTGCAGAAGCCATGGGG - Intronic
1172365174 20:34343607-34343629 TTTTTTCTTCAGATGGTATCTGG + Intergenic
1173072055 20:39777704-39777726 ATTTTTCTGCAGATGCTGTGGGG + Intergenic
1173127154 20:40348187-40348209 TTTTATTTGAAGTTGCCATGAGG - Intergenic
1173219412 20:41119684-41119706 TTTATGCTACAGATGCCATCTGG + Intronic
1174122498 20:48276783-48276805 TTTTGTCTGCAGATTCCAGAAGG - Intergenic
1174993591 20:55541132-55541154 TTTCTTCCGCAGATTCGATGTGG - Intergenic
1175647400 20:60686159-60686181 ATTTTTCTGCAGCTGCCTTTAGG - Intergenic
1175665532 20:60855543-60855565 TTTTTGCTGAGGATGCCCTGTGG - Intergenic
1177135923 21:17305266-17305288 CTTTTCCTGCAAATGCCAGGTGG - Intergenic
1177845030 21:26279140-26279162 CTTTTTCTGGAAATGACATGGGG + Intergenic
1178166658 21:29985674-29985696 TTCTTTTTGCACCTGCCATGTGG - Intergenic
1179123695 21:38572538-38572560 TTTTTTCTGCATATGAAATTGGG - Intronic
1181368693 22:22399320-22399342 TTTCCTCTGCAGATGGCAAGGGG + Intergenic
1182109969 22:27716107-27716129 TTGTCTCAGCTGATGCCATGTGG - Intergenic
1182739983 22:32560699-32560721 TTTTTACTGCAAATGGCATGAGG + Intronic
1184554141 22:45223988-45224010 TTTTCTCCCCAGAGGCCATGAGG - Intronic
1185212444 22:49577808-49577830 TTTATCCTGCAGATGCCCTGGGG - Intronic
952043000 3:29282383-29282405 TTTTCTGTGTAGCTGCCATGAGG + Intronic
952125933 3:30300932-30300954 TTTCTCCTGAAAATGCCATGTGG + Intergenic
953025874 3:39144618-39144640 TTTTTTTTTCAAATGCCCTGAGG - Intronic
953260530 3:41334473-41334495 ATTTTTCTGCACAGGCCATGTGG + Intronic
953587008 3:44210894-44210916 TTTTTTATGAAGTTGGCATGAGG + Intergenic
954626824 3:52026392-52026414 TTCTCACTGCAGATTCCATGAGG - Intergenic
954923770 3:54214573-54214595 TTTTTGCTGTAGATTGCATGAGG + Intronic
955267924 3:57465211-57465233 TTTCTTCTTCATATTCCATGAGG - Intronic
955939308 3:64132816-64132838 TATTTTGGGCAGATGCCGTGTGG + Intronic
956658207 3:71573384-71573406 CTTTTGCTGCAGTTGCCATAAGG + Intronic
959877191 3:111397765-111397787 TGTTTTCTGAAGTTGTCATGAGG + Intronic
961222967 3:125214148-125214170 AATTTCCTGCAGATGCCAAGCGG - Intergenic
961246761 3:125460770-125460792 TTTTTTATGCAGAAGCATTGCGG - Exonic
962171603 3:133107064-133107086 TTTTTTATTCTGATGGCATGAGG + Intronic
962755862 3:138465088-138465110 TTTGTTCTGCATGGGCCATGCGG - Intronic
962945655 3:140166859-140166881 TGTTTTCTGCACATCCCATCTGG - Intronic
963253940 3:143125914-143125936 TTATTTTTGCAGAAGTCATGTGG + Intergenic
963253951 3:143126046-143126068 TTTTTTTTGCAGAAGTCATGTGG + Intergenic
966680432 3:182636700-182636722 TTTTTTCAGGAGAGGCCAGGTGG + Intergenic
967847820 3:194058137-194058159 TCTTTTCTGCAGATGTTATGTGG - Intergenic
968182861 3:196610093-196610115 TTCCTTCTCCACATGCCATGCGG - Intergenic
968393963 4:215994-216016 TTTTATGTGCAGATGCTAGGTGG - Intergenic
969069255 4:4520713-4520735 TTTTCTCTGCAGATTCCATTTGG - Intronic
970123826 4:12787313-12787335 TTCTGTTTGCATATGCCATGAGG + Intergenic
970833995 4:20378437-20378459 TTTTATATGTAGATGCCATAAGG + Intronic
970869739 4:20801651-20801673 TTTGTTTTGCAGTTACCATGAGG - Intronic
971211538 4:24622453-24622475 TTTGTTTTGCAGATTCCATCAGG - Intergenic
972087426 4:35236775-35236797 TTTTTTCTTCAGATAGCATCTGG + Intergenic
973561001 4:52135327-52135349 CTATTTTTACAGATGCCATGTGG + Intergenic
975242207 4:72073842-72073864 ATTTTTCTGTAGTTACCATGGGG - Intronic
976260447 4:83140222-83140244 GTTTTTCATGAGATGCCATGAGG - Intergenic
978513572 4:109547997-109548019 ATTTTGCTGCAGATGCCCTTTGG - Intergenic
979395304 4:120180462-120180484 TTTTATTTGCAGTTACCATGAGG - Intergenic
979447385 4:120830403-120830425 TTGTATCTTCAGATGCCATGTGG + Intronic
980762081 4:137247904-137247926 TTTTTGCAGCTGATACCATGGGG + Intergenic
981709713 4:147697085-147697107 TATTTTCAGCAAATGCCCTGTGG - Intergenic
981954177 4:150449345-150449367 TCTTTCCTGTGGATGCCATGAGG + Intronic
982269376 4:153570831-153570853 TGTTCTCAGCAGATGCCCTGAGG + Intronic
984387610 4:179082858-179082880 TTGTTACTGCAGATGCCCTCGGG + Intergenic
984426589 4:179595819-179595841 TCTCTTCTGCAGAGGCCAGGCGG + Intergenic
986878070 5:12134899-12134921 TTTTTGCTGTATATGCCATGTGG - Intergenic
986936736 5:12897738-12897760 TTGTTTCTGCCGAAGGCATGTGG - Intergenic
987080170 5:14418949-14418971 TTTTACCGGCAGAGGCCATGGGG + Intronic
989273623 5:39560883-39560905 TCTATTCAGCAGAAGCCATGTGG + Intergenic
990046107 5:51433905-51433927 TTTATTCTTCAGATACCCTGTGG + Intergenic
991153318 5:63398440-63398462 TTATCTCTGCATATCCCATGGGG - Intergenic
991581482 5:68160026-68160048 TTTTTTCTGCAAGAGCCTTGTGG + Intergenic
993424599 5:87747728-87747750 TTTGTTATGCATATACCATGTGG + Intergenic
993865623 5:93191133-93191155 TGTTTCCTACAGCTGCCATGAGG + Intergenic
994056684 5:95424510-95424532 TTTTTACTGTAGATTCAATGGGG - Intronic
995266381 5:110166483-110166505 TTTTTGATGAAGATGCCAAGGGG - Intergenic
995293089 5:110483277-110483299 TTTTTTAAGCAGCTGCCCTGGGG - Intronic
996942764 5:129028966-129028988 TTTTTTCTGCAAATGCTTTTAGG + Intronic
997593564 5:135091307-135091329 CATTTTCTGAAGATGCCAAGTGG + Intronic
997649116 5:135502439-135502461 ATTTTTCTGCAGAAGCAAGGGGG + Intergenic
997883752 5:137612918-137612940 TTATGTCTCCAAATGCCATGTGG - Intergenic
999117386 5:149175788-149175810 TTTATGCTGTAGCTGCCATGTGG + Intronic
1000177620 5:158773223-158773245 TTTTGTCTGCATATGCTCTGTGG - Intronic
1001025529 5:168221251-168221273 TTTTTTCTGCATAGAACATGAGG + Intronic
1001184996 5:169562040-169562062 CTTTTTCTGCAAATTCCATGGGG - Intergenic
1001668333 5:173452353-173452375 TTTAGTCCCCAGATGCCATGAGG - Intergenic
1003405030 6:5821077-5821099 TATTTTCCACAGATGACATGGGG + Intergenic
1003973235 6:11319098-11319120 GTGGTTGTGCAGATGCCATGTGG + Intronic
1004078152 6:12364185-12364207 CTTTTTCCTCAGATGCCATTAGG - Intergenic
1006415424 6:33900871-33900893 CTGTTGCTGCAGATGCCACGAGG + Intergenic
1007422863 6:41729993-41730015 GTGTTTCTGCAAATTCCATGTGG - Intronic
1008301689 6:49848889-49848911 TTTTTTGTAGAGTTGCCATGAGG - Intronic
1008789701 6:55215777-55215799 TTTTCTTTGTAGTTGCCATGGGG - Intronic
1008893640 6:56525872-56525894 TTTTTTCTGAAGATGACAGAAGG - Intronic
1009344924 6:62601606-62601628 TTGTTTCTACTAATGCCATGGGG - Intergenic
1009403581 6:63285743-63285765 TTTATTTTGCAGATTGCATGAGG - Exonic
1009591364 6:65675076-65675098 TTTTCTTTGCAGTTACCATGGGG - Intronic
1009827114 6:68880719-68880741 TTTTTCCTGGAGATGCTCTGTGG - Intronic
1010374493 6:75150929-75150951 TTTTTTCTGCAGCAGACATTTGG + Intronic
1011094066 6:83638155-83638177 GTTTTACTGCAGCTGGCATGTGG + Intronic
1011285881 6:85722206-85722228 TTTTTTCTTCATAAGACATGAGG - Intergenic
1011681714 6:89789901-89789923 TTCTTTCTGCAGATGCTTTTGGG - Exonic
1012261495 6:97092493-97092515 TTTTTTCTACAAATGTGATGAGG + Intronic
1014944758 6:127484025-127484047 TTTTTTCACCACCTGCCATGTGG - Intronic
1015308321 6:131735387-131735409 TTTTTTCTTCAGATTTCATATGG - Intronic
1017927208 6:158921010-158921032 TTTTTTCTTCAGAAGCCAGTTGG + Intergenic
1018920610 6:168169833-168169855 ATTTTTCTGCAGAATCCCTGGGG + Intergenic
1019698862 7:2462812-2462834 GTTTTGATGCAGATGCCCTGGGG + Intergenic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1022193162 7:28036902-28036924 TTTGTTCTGTAGATGCCAATGGG - Intronic
1023228053 7:37992555-37992577 TGCTTTCTGCTGATGCTATGGGG - Intronic
1023561875 7:41483096-41483118 TTTTTTTTACAGTTGCCAAGAGG - Intergenic
1024083310 7:45873370-45873392 TTTTTTTTCCAGTTGCCTTGTGG - Intergenic
1024312530 7:47981946-47981968 TTTTTCCTGCAGATCATATGGGG - Intergenic
1029191498 7:98775408-98775430 TTTGTTCTACTGATGCCTTGTGG - Intergenic
1029366857 7:100122183-100122205 TTCATTCTGCAGATGACCTGAGG - Intronic
1030507899 7:110447524-110447546 TATTTTCTGGAGATGCACTGGGG - Intergenic
1031850420 7:126856497-126856519 TTTTGTCTGCAGTAGCCTTGGGG + Intronic
1032708327 7:134441403-134441425 TGTGATCAGCAGATGCCATGAGG + Intergenic
1032984843 7:137326444-137326466 TTCTTTCTGGACATGCCGTGAGG - Intronic
1032985883 7:137336692-137336714 TGTTTGTTGCAGATGCCAAGTGG + Intronic
1033884023 7:145922147-145922169 TTTTTTGTGCAGCTGCAACGTGG - Intergenic
1034848596 7:154471682-154471704 TGTTTTCTGAAGATGCTTTGTGG - Intronic
1035894665 8:3386172-3386194 TTTTTTGTGCAGATGAGCTGAGG - Intronic
1036023223 8:4872024-4872046 TATTGTCTGCAGGAGCCATGAGG - Intronic
1037013495 8:13874417-13874439 TTTTTTTTGCAAATGCAATCAGG - Intergenic
1037111350 8:15167562-15167584 TTATTTCTGCAGAGGCCTTTTGG - Intronic
1037182932 8:16028943-16028965 TCTTTTCTGCAGCTGGCTTGTGG + Intergenic
1038193054 8:25341544-25341566 CTTTTCCTGAAGATGCCAGGGGG - Intronic
1038719411 8:30020336-30020358 ATTTTTGTCCAGATGCCAAGGGG + Intergenic
1039092056 8:33841993-33842015 TGTTTTCAGCAGTTTCCATGCGG - Intergenic
1040638162 8:49299996-49300018 TTACTTCTACAAATGCCATGAGG + Intergenic
1040756944 8:50788004-50788026 TTTTTTCTGCAGCAGCCTTAGGG - Intronic
1042500488 8:69503289-69503311 CTTTGTCTGAAGATGGCATGGGG + Intronic
1043191656 8:77230621-77230643 TTTTTTTTGAAGATGAAATGTGG - Intergenic
1044446237 8:92280109-92280131 TTTGTTTTGCACATGCCAGGAGG - Intergenic
1044633269 8:94299311-94299333 TGTCTTCTGCAGATGCCAAATGG + Intergenic
1044757210 8:95476626-95476648 TTTTTTCTTCAGAAGCCAAAGGG - Intergenic
1045227001 8:100258040-100258062 TTTTTTCTTCATATGCAATGTGG - Exonic
1045399492 8:101798255-101798277 TTTGTTTTGCAGATTCCTTGGGG - Intronic
1045685994 8:104712962-104712984 TTTTTTTTGCCAATGGCATGTGG + Intronic
1046565739 8:115898492-115898514 TTTTTTCTTCATTTGGCATGAGG + Intergenic
1046692189 8:117298490-117298512 TTTCTTTTGCTGATCCCATGTGG + Intergenic
1047976021 8:130131590-130131612 TTTTTTTTTCAGTAGCCATGAGG - Intronic
1048361950 8:133705071-133705093 TTTTTTCTGAATAGGCCTTGGGG + Intergenic
1048566616 8:135606412-135606434 TATTTTCTTCAGATACCCTGAGG + Intronic
1049909780 9:254288-254310 TATTATCTGCAGAGTCCATGAGG - Intronic
1050306384 9:4309755-4309777 TTTTTTCTTCACATGACATCAGG + Intronic
1050568249 9:6910152-6910174 TTTTACCTTCAGATGCCATGAGG + Intronic
1051491163 9:17667655-17667677 TTTTTTTTGCATATACCTTGAGG + Intronic
1053392943 9:37749041-37749063 TTTTCTCTACAGTTCCCATGAGG + Intronic
1055931468 9:81563870-81563892 TTTGTTGAGCAAATGCCATGTGG - Intergenic
1056273270 9:84967894-84967916 TTTTTTCTGCAGCTACCATGGGG + Intronic
1056471644 9:86910216-86910238 TGTTTTCAGCAAATGCCCTGGGG - Intergenic
1057026336 9:91736572-91736594 TTTTCTCTCCAGATCCCATAAGG - Intronic
1057237657 9:93377723-93377745 TTCTTTGTGGAGTTGCCATGGGG + Intergenic
1057553063 9:96066255-96066277 ACTGCTCTGCAGATGCCATGAGG + Intergenic
1058688114 9:107495643-107495665 TTTGTCCTGAAGATGCCATAGGG - Intergenic
1058944916 9:109847133-109847155 TTTTTTTTGCAGATGCAATTAGG + Intronic
1058977258 9:110136606-110136628 TTCTTTCTGCCTCTGCCATGGGG - Exonic
1060451837 9:123750093-123750115 TGTCTTCTGCAGTGGCCATGGGG - Intronic
1061899250 9:133664581-133664603 CTTTTGCTGCAGCTGCTATGAGG + Intronic
1203375696 Un_KI270442v1:374753-374775 TTTTCTCAGCAGACTCCATGAGG - Intergenic
1186530900 X:10294536-10294558 TTTTTTCTTCTGATGCCTTATGG + Intergenic
1187295676 X:17998284-17998306 TTTCTTCTGAAAATGCCATCTGG - Intergenic
1187959096 X:24551084-24551106 TGTCTTCTGAAGATGCCGTGTGG - Intergenic
1188642821 X:32527573-32527595 TTTTTAAAGCAAATGCCATGTGG - Intronic
1188750408 X:33898106-33898128 TTTTTTCTGGAGTTGACATGAGG - Intergenic
1188783669 X:34316734-34316756 TTTTTTCTGCCAATACCACGTGG + Intergenic
1190079889 X:47347920-47347942 TTTCTTATTCAGATGCCATAAGG - Intergenic
1192589252 X:72346355-72346377 TTTCTTCTTGAGAAGCCATGAGG - Intronic
1193626116 X:83822101-83822123 GTTTTTCTGCATTTGCCAAGTGG - Intergenic
1195143475 X:101987880-101987902 ATTGTTATGCAGATTCCATGAGG - Intergenic
1195173967 X:102297171-102297193 ATGTTTTTGCAGATGCCAAGGGG - Intergenic
1195184898 X:102389922-102389944 ATGTTTTTGCAGATGCCAAGGGG + Intronic
1195690715 X:107622383-107622405 ATTTTTATCCAGTTGCCATGTGG + Intergenic
1196565764 X:117203197-117203219 GTTTTTGTTCAGCTGCCATGGGG - Intergenic
1198481295 X:137043768-137043790 TTTTTGATGCAGATGTCCTGAGG + Intergenic
1198639042 X:138735915-138735937 TCTTTACTGCATATCCCATGTGG + Intronic
1201772917 Y:17635044-17635066 TTTTTCTTGCAGTTACCATGGGG + Intergenic
1201828638 Y:18270942-18270964 TTTTTCTTGCAGTTACCATGGGG - Intergenic
1201889407 Y:18925455-18925477 TTTTTTATACAGATGCGTTGTGG - Intergenic
1202032030 Y:20586357-20586379 TTTTTTCTACAAAAGCCCTGTGG + Intronic