ID: 1078564592

View in Genome Browser
Species Human (GRCh38)
Location 11:12403458-12403480
Sequence GAGCATTTCCACTGTGTGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 112}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078564587_1078564592 7 Left 1078564587 11:12403428-12403450 CCAGCCTTCTCTGTGCCCAGCCA 0: 1
1: 0
2: 5
3: 58
4: 533
Right 1078564592 11:12403458-12403480 GAGCATTTCCACTGTGTGCGTGG 0: 1
1: 0
2: 0
3: 2
4: 112
1078564590_1078564592 -9 Left 1078564590 11:12403444-12403466 CCAGCCAGTGCTCTGAGCATTTC 0: 1
1: 0
2: 3
3: 45
4: 272
Right 1078564592 11:12403458-12403480 GAGCATTTCCACTGTGTGCGTGG 0: 1
1: 0
2: 0
3: 2
4: 112
1078564586_1078564592 8 Left 1078564586 11:12403427-12403449 CCCAGCCTTCTCTGTGCCCAGCC 0: 1
1: 0
2: 3
3: 66
4: 466
Right 1078564592 11:12403458-12403480 GAGCATTTCCACTGTGTGCGTGG 0: 1
1: 0
2: 0
3: 2
4: 112
1078564588_1078564592 3 Left 1078564588 11:12403432-12403454 CCTTCTCTGTGCCCAGCCAGTGC 0: 1
1: 0
2: 5
3: 46
4: 431
Right 1078564592 11:12403458-12403480 GAGCATTTCCACTGTGTGCGTGG 0: 1
1: 0
2: 0
3: 2
4: 112
1078564584_1078564592 10 Left 1078564584 11:12403425-12403447 CCCCCAGCCTTCTCTGTGCCCAG 0: 1
1: 0
2: 8
3: 56
4: 596
Right 1078564592 11:12403458-12403480 GAGCATTTCCACTGTGTGCGTGG 0: 1
1: 0
2: 0
3: 2
4: 112
1078564589_1078564592 -8 Left 1078564589 11:12403443-12403465 CCCAGCCAGTGCTCTGAGCATTT 0: 1
1: 0
2: 2
3: 24
4: 226
Right 1078564592 11:12403458-12403480 GAGCATTTCCACTGTGTGCGTGG 0: 1
1: 0
2: 0
3: 2
4: 112
1078564585_1078564592 9 Left 1078564585 11:12403426-12403448 CCCCAGCCTTCTCTGTGCCCAGC 0: 1
1: 3
2: 9
3: 78
4: 652
Right 1078564592 11:12403458-12403480 GAGCATTTCCACTGTGTGCGTGG 0: 1
1: 0
2: 0
3: 2
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078564592 Original CRISPR GAGCATTTCCACTGTGTGCG TGG Intronic