ID: 1078566367

View in Genome Browser
Species Human (GRCh38)
Location 11:12417985-12418007
Sequence CACCTAAGGCTGGCTTGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 183}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078566357_1078566367 17 Left 1078566357 11:12417945-12417967 CCCCAGCAGTGCCAGATGCTGAT 0: 1
1: 0
2: 1
3: 27
4: 317
Right 1078566367 11:12417985-12418007 CACCTAAGGCTGGCTTGGAGTGG 0: 1
1: 0
2: 0
3: 15
4: 183
1078566358_1078566367 16 Left 1078566358 11:12417946-12417968 CCCAGCAGTGCCAGATGCTGATG 0: 1
1: 0
2: 2
3: 17
4: 280
Right 1078566367 11:12417985-12418007 CACCTAAGGCTGGCTTGGAGTGG 0: 1
1: 0
2: 0
3: 15
4: 183
1078566360_1078566367 6 Left 1078566360 11:12417956-12417978 CCAGATGCTGATGCAGAGTGCCT 0: 1
1: 0
2: 0
3: 8
4: 134
Right 1078566367 11:12417985-12418007 CACCTAAGGCTGGCTTGGAGTGG 0: 1
1: 0
2: 0
3: 15
4: 183
1078566356_1078566367 29 Left 1078566356 11:12417933-12417955 CCAGATTAGAGACCCCAGCAGTG 0: 1
1: 0
2: 1
3: 7
4: 86
Right 1078566367 11:12417985-12418007 CACCTAAGGCTGGCTTGGAGTGG 0: 1
1: 0
2: 0
3: 15
4: 183
1078566359_1078566367 15 Left 1078566359 11:12417947-12417969 CCAGCAGTGCCAGATGCTGATGC 0: 1
1: 0
2: 3
3: 19
4: 277
Right 1078566367 11:12417985-12418007 CACCTAAGGCTGGCTTGGAGTGG 0: 1
1: 0
2: 0
3: 15
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078566367 Original CRISPR CACCTAAGGCTGGCTTGGAG TGG Intronic
902338057 1:15765135-15765157 CACCCGAGGCTGGCTTGGCGGGG + Exonic
903687776 1:25145002-25145024 CACCCAAGGCTGGAGTGCAGTGG + Intergenic
904437365 1:30507472-30507494 CCTCCAAGCCTGGCTTGGAGGGG + Intergenic
904649918 1:31997743-31997765 CACCCAAGGCTGGTGTGCAGTGG + Intergenic
904754626 1:32761286-32761308 CACCTGTGGCTCGCTTGGGGAGG - Intronic
907589587 1:55653564-55653586 CACCCAAGGCTGGAGTGCAGTGG + Intergenic
907765220 1:57403209-57403231 GGCCTAAGGCTGGCTTTCAGTGG - Intronic
912382487 1:109254954-109254976 CACCAAAGGCAGGCTGGGTGTGG - Intronic
918340962 1:183567665-183567687 CACCCAAGGCTGGGCTGGGGTGG + Intronic
924831927 1:247605546-247605568 CACCTAAGGCAGGAATGGAATGG - Intergenic
1063271551 10:4514932-4514954 CACCTGAGGCTGGCTTGCGTGGG - Intergenic
1063781682 10:9332151-9332173 GACCTAGGGCTGGGATGGAGGGG - Intergenic
1064364136 10:14691852-14691874 TAGCTCAGGCTGGCTTGCAGTGG - Intronic
1065153051 10:22841925-22841947 CAACTAAGTCTGGCTGGGAAGGG + Intergenic
1066387436 10:34953163-34953185 CAGCTAAGGCTGGAGTGCAGTGG + Intergenic
1066679671 10:37924987-37925009 CACCTCAGGCTGGAGTGCAGTGG - Intergenic
1069965459 10:72111444-72111466 CACCCAAGGCTGGAGTGTAGTGG - Intronic
1072539024 10:96384450-96384472 CAGGTATGGCTGCCTTGGAGGGG - Intronic
1073192660 10:101662798-101662820 CCCCCATGGGTGGCTTGGAGGGG + Intronic
1074590600 10:114809383-114809405 CACCAAGGCATGGCTTGGAGTGG - Intergenic
1075866445 10:125725097-125725119 CTCCTAAGCCAGGCTGGGAGAGG - Intronic
1077381800 11:2246817-2246839 TACCTAAGGCTGGGGAGGAGGGG + Intergenic
1077636642 11:3846290-3846312 CTCCTGAGGCTGGCTGAGAGAGG - Intergenic
1078566367 11:12417985-12418007 CACCTAAGGCTGGCTTGGAGTGG + Intronic
1079729668 11:23924110-23924132 CACTCAAGGTTGGCTTGGGGTGG - Intergenic
1080639699 11:34151650-34151672 GAGCTAAGTCTGGCATGGAGGGG - Exonic
1082821626 11:57547911-57547933 CACCTATGGCTGGCTTTGGTAGG + Intronic
1084653014 11:70500067-70500089 CACCCAGGGCTGGTGTGGAGTGG - Intronic
1084915821 11:72428317-72428339 CAGTTAAGGCTGACTTGCAGAGG - Intronic
1088321050 11:108554882-108554904 CACCCAAGGCTGGAGTGCAGTGG - Intronic
1088547907 11:110980148-110980170 CATCTAGGTCAGGCTTGGAGTGG - Intergenic
1089113194 11:116073011-116073033 TACCTGAGGCTGGCTAGCAGGGG + Intergenic
1090065563 11:123500279-123500301 CACCTAAGGCTGGACTGCAGTGG - Intergenic
1090450043 11:126798173-126798195 CCCCCAAGGGTGGCCTGGAGAGG + Intronic
1090754242 11:129774757-129774779 CACCCAAGGCTGGAGTGGAGTGG + Intergenic
1095970820 12:47901058-47901080 ACCCCAAGGCTGGCTGGGAGAGG - Intronic
1096240393 12:49956693-49956715 CACCTATGGCTGGCTGGGCAAGG + Exonic
1097799052 12:63892723-63892745 CTCATAATGCTGGCTTAGAGTGG - Intronic
1097997542 12:65906249-65906271 CACATAACAATGGCTTGGAGGGG + Intronic
1098848420 12:75566159-75566181 GACCTAAAGCAGTCTTGGAGGGG + Intergenic
1100997084 12:100313087-100313109 CACCCCAGGCTGGCATGCAGTGG - Intronic
1102000249 12:109553198-109553220 CACTTGGGGCTGGCTGGGAGAGG - Intergenic
1102478783 12:113206303-113206325 GACCTAATGCTTGCTTGGACCGG - Intronic
1103569150 12:121832813-121832835 CACCTCAGGCTGGAGTGCAGTGG + Intergenic
1104068264 12:125323556-125323578 CACCCAAGGCTGGAGTGCAGTGG + Intronic
1104390111 12:128384759-128384781 CACTAAAGGCTGGCTTAGTGAGG + Intronic
1105000576 12:132687611-132687633 CACCTCAGGCTGGCCGGGCGCGG - Exonic
1107880793 13:44830373-44830395 GATGTAAGGCAGGCTTGGAGGGG - Intergenic
1108359519 13:49656547-49656569 CACCTCAGGCTGGAGTGCAGTGG - Intergenic
1110207244 13:72929897-72929919 CACCCCAGGCTGGATTGCAGTGG + Intronic
1113361422 13:109634993-109635015 CACCTTGGGTTGGGTTGGAGGGG - Intergenic
1114180804 14:20366237-20366259 CAGCTAAGGCTGGAGTGAAGGGG - Exonic
1114227509 14:20752578-20752600 CAGCTCAGGCTTGCTTGCAGGGG + Intergenic
1115596877 14:34917820-34917842 CACCCAAGGCTGGAGTGCAGTGG - Intergenic
1115624298 14:35174569-35174591 TACCTATGGCTGTTTTGGAGAGG - Intronic
1124201911 15:27686050-27686072 CACCTAAGACTGGCACGCAGTGG + Intergenic
1130907821 15:88252582-88252604 TACCTGGGGCTGGGTTGGAGTGG - Intronic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1132669073 16:1095338-1095360 CCCCCAAGGCTGGCCTGGGGTGG + Intronic
1135671514 16:24379672-24379694 TTCCTAAGGTAGGCTTGGAGTGG - Intergenic
1138567949 16:57847142-57847164 CACCTCAGGCTGGAATGCAGTGG - Intronic
1139022396 16:62766124-62766146 CCTCTAAGCCTGGGTTGGAGAGG + Intergenic
1139221859 16:65191175-65191197 CACCTCAGGCTGGAGTGCAGTGG - Intergenic
1141866403 16:86752911-86752933 CACCTGAGTGAGGCTTGGAGAGG + Intergenic
1141867562 16:86761179-86761201 CACCGAAAGCAGGCTTGGTGTGG - Intergenic
1142423424 16:89987449-89987471 AACCTGTGGCTGGCTTGGTGGGG - Intergenic
1144037790 17:11382975-11382997 CACCTAAGGCTGGAGTGCAGTGG + Intronic
1144149740 17:12431825-12431847 CAACTAAAACAGGCTTGGAGAGG - Intergenic
1145096600 17:20034135-20034157 CACCCAAGGCTGGAGTGCAGTGG + Intronic
1147231971 17:39026203-39026225 CACCCAAGGCTGGAGTGCAGTGG - Intergenic
1147822516 17:43250066-43250088 CACCCAAGGCTGGAGTGCAGTGG + Intergenic
1152765048 17:82132076-82132098 CACCCAAGGCTGGAGTGCAGTGG - Intronic
1154004592 18:10516249-10516271 CAGCCAAGGCCAGCTTGGAGGGG - Intergenic
1157869002 18:51212159-51212181 CACCCAAGGCTGGAGTGCAGTGG - Intronic
1160288025 18:77564685-77564707 CACAGAGGGCTGGCCTGGAGAGG - Intergenic
1160567659 18:79797342-79797364 CCCCAAAGGCTGCTTTGGAGTGG + Intergenic
1160731929 19:645107-645129 CATCTTTGGCTGGCATGGAGTGG + Intergenic
1162499388 19:11042933-11042955 CACCCAAGGCTGGAGTGCAGTGG - Intronic
1164922945 19:32103201-32103223 CACTTATGGCTGGTTTGGAATGG + Intergenic
1165340601 19:35209104-35209126 CAGCAATGACTGGCTTGGAGGGG - Intergenic
1166039458 19:40192752-40192774 CACCTAGGCCTGGCCTTGAGAGG - Intronic
1166496787 19:43308712-43308734 GACCTAATGCTTGCTTGGACTGG + Intergenic
1167335459 19:48882773-48882795 GACCTAATGCTTGCTTGGACCGG + Intronic
927823836 2:26293362-26293384 CACCCAAGGCTGGAGTGCAGTGG + Intergenic
928636277 2:33250473-33250495 CACCTAAGGCAGGGAAGGAGAGG + Intronic
932225524 2:70036995-70037017 CACCTTTGACAGGCTTGGAGGGG - Intergenic
933966989 2:87438083-87438105 GAACTAAGGCTGGCATGGAGGGG - Intergenic
935736966 2:106113967-106113989 CACCTTAGGCTGGCATGGGTTGG + Intronic
935954763 2:108364820-108364842 GACCTAATGCTTGCTTGGACCGG - Intergenic
936326808 2:111512414-111512436 GAACTAAGGCTGGCATGGAGGGG + Intergenic
937720208 2:125086266-125086288 CAGCAAAGGCTGGATTGGAGTGG - Intergenic
940087439 2:149876737-149876759 GACCTGAGTCTGGCTTGGGGAGG + Intergenic
945085047 2:206122587-206122609 CACCCAAGGCTGGAATGCAGTGG - Intronic
948836266 2:240627504-240627526 CTCCTAAGGCTGGAGTGCAGTGG + Intronic
949075363 2:242054338-242054360 CACCTCAGGCAGGGGTGGAGGGG + Intergenic
1169730958 20:8785153-8785175 TACCTAAGGCTGGCTTAGAAAGG + Intronic
1171034815 20:21706264-21706286 CGCCTGGGTCTGGCTTGGAGTGG - Intronic
1172307440 20:33891093-33891115 CACCTAAGGCTGGAGTGCAGTGG + Intergenic
1173950772 20:46991677-46991699 GACTGAAGGCTGGCTGGGAGCGG + Intronic
1174091524 20:48052404-48052426 CACCTCAGGCCAGGTTGGAGAGG + Intergenic
1174218130 20:48932805-48932827 CTCACCAGGCTGGCTTGGAGTGG + Intronic
1177031928 21:15991085-15991107 CACCTCAGGCTGGATTAGAGAGG + Intergenic
1178363492 21:31969266-31969288 CATCTAAGGGTGGTTTGGAAAGG - Intronic
1178601787 21:34000722-34000744 CACCCAAGGCCACCTTGGAGGGG - Intergenic
1178947848 21:36962751-36962773 CACCCAAGGCTGGAGTGCAGTGG - Intronic
1179631853 21:42683754-42683776 CTCCTTGGGCTGGCTTGAAGGGG - Intronic
1179838876 21:44057337-44057359 CACCAAGGGCTGGCGTGCAGTGG + Intronic
1180713430 22:17855566-17855588 AACCTCAGGCTGGATTCGAGAGG + Intronic
1182751021 22:32642247-32642269 CACCCAAGGCTGGAGTGCAGTGG - Intronic
1183660084 22:39214594-39214616 GACCTCAGGCTGCATTGGAGAGG + Intergenic
1183827588 22:40400601-40400623 CACCTCAGGCTGGAGTGCAGTGG - Intronic
1183836527 22:40458785-40458807 CACCTCAGGCTGGCCGGGCGTGG + Intronic
1184206813 22:43009907-43009929 CACCCAAGGCTGGAGTGCAGTGG + Intronic
1184693167 22:46126502-46126524 CATGGAAGGCTGGGTTGGAGGGG + Intergenic
1184763836 22:46561503-46561525 CTCCTAGGGCAGGCTTAGAGGGG + Intergenic
950812019 3:15658126-15658148 CACCTCAGGCTGGAGTGCAGTGG - Intergenic
951341262 3:21490203-21490225 CCACTAAGGCTGGATTGCAGTGG + Intronic
951983253 3:28588828-28588850 CAGCTGAGGCAGGCTAGGAGAGG - Intergenic
952777634 3:37061443-37061465 CACCCAAGGCTGGAGTGCAGTGG + Intronic
952902263 3:38118087-38118109 CACCTGAGGGTGGCGTGCAGGGG - Intronic
954077931 3:48194860-48194882 CACCTGAGGCTGGAGTGCAGTGG + Intergenic
954279317 3:49564770-49564792 CAGCTACGGTTGGATTGGAGAGG + Intronic
959722421 3:109507633-109507655 CACCCAAGGCTGGAGTGCAGTGG + Intergenic
959840031 3:110964830-110964852 GACCTAATGCTTGCTTGGACTGG + Intergenic
959840641 3:110970070-110970092 GACCTAATGCTTGCTTGGATTGG + Intergenic
960292177 3:115898907-115898929 CACTTAAGTCTGGGTTGCAGTGG + Intronic
961481358 3:127183051-127183073 CGCCTAAGGCAGCCCTGGAGAGG + Intergenic
964058158 3:152487473-152487495 CACCCAAGGCTGGAGTGCAGTGG + Intergenic
964417138 3:156459239-156459261 CCCCTAAGGCTGGGTTGCAGAGG - Intronic
965515731 3:169619352-169619374 CAAATAAGGCTGGGCTGGAGAGG + Intronic
968864117 4:3196836-3196858 CATTTAAGGCTGGCTTAGTGTGG - Intronic
972345654 4:38190303-38190325 AATCTAAGGCGGGCTTTGAGGGG - Intergenic
972407654 4:38762177-38762199 CTCCTAAGGCCGCCTGGGAGAGG - Intergenic
973330405 4:48906345-48906367 CTTCTTAGGATGGCTTGGAGGGG + Intronic
983996116 4:174184417-174184439 CACATAATGCAGGCTTAGAGAGG - Intergenic
986113704 5:4748495-4748517 CACCAAAGGCTGGAGTGCAGTGG - Intergenic
989275369 5:39582432-39582454 CACCTATGGTTGGTTTGGAGTGG + Intergenic
993921346 5:93807987-93808009 CACATCAGGCTGCCTTGGACAGG + Intronic
995553678 5:113305249-113305271 CAACTGAGGATGGCTGGGAGAGG - Intronic
1000020013 5:157310662-157310684 CAGCTGAAGCTGGCTGGGAGCGG + Intronic
1000379219 5:160614078-160614100 CCCCTCAAGATGGCTTGGAGAGG - Intronic
1001974491 5:175986027-175986049 GACCTAATGCTTGCTTGGACTGG + Intronic
1002242943 5:177857752-177857774 GACCTAATGCTTGCTTGGACTGG - Intergenic
1003081133 6:3022667-3022689 CACCCAAGGCTGGAGTGCAGTGG - Intergenic
1003950520 6:11111496-11111518 CCCCGAAGGATGGCTTGCAGGGG - Intronic
1004565420 6:16791569-16791591 CACATATGGCAGACTTGGAGTGG + Intergenic
1004993900 6:21169594-21169616 CACCCAAGGCTGGGGTGTAGTGG - Intronic
1005267481 6:24126985-24127007 CACCAAAGGCTGGCCTGATGTGG - Intronic
1005949886 6:30624130-30624152 CACCCAAGGCTGGAGTGCAGTGG + Intronic
1008265751 6:49423927-49423949 CACCTAAGGGTTTCTTGGATGGG + Intergenic
1008876978 6:56339998-56340020 CATCTAAGTCAGGATTGGAGAGG + Intronic
1011467876 6:87677035-87677057 CACCCAAGGCTGGAGTGCAGTGG - Intronic
1012614857 6:101264443-101264465 CACATGAGCCTGGCTTAGAGGGG + Intergenic
1013422720 6:109980236-109980258 TACCAAAGGCTGGCTTGTTGGGG - Exonic
1014772487 6:125472884-125472906 CACCCCAGGCTGGATTGCAGTGG - Intergenic
1016795509 6:148113250-148113272 CACCCAAGGCTGGAGTGCAGTGG + Intergenic
1018553231 6:165022879-165022901 CACCCAAGGCTGGAGTGCAGGGG - Intergenic
1019803357 7:3104894-3104916 CACAAGAGGCTGGCATGGAGTGG - Intergenic
1020044759 7:5032549-5032571 TACCTCAGGCTGGAGTGGAGGGG - Intronic
1022623836 7:32013658-32013680 GACCTAATGCTTGCTTGGACTGG + Intronic
1023043579 7:36193437-36193459 CTCCCAAGGCTGGCATGAAGTGG - Intronic
1024747437 7:52424730-52424752 CACCTTAGGCTGGAGTGCAGTGG + Intergenic
1026674784 7:72419459-72419481 CCCCTAAGGCTGGGTTTGGGAGG + Intronic
1026898810 7:74026081-74026103 CAACAAAGGGTGGCTTGGGGGGG + Intergenic
1029821359 7:103150415-103150437 CTCCTCAGGCTAGCTTAGAGTGG + Intergenic
1030640948 7:112005887-112005909 CAGCAAAGGCTGGATTGCAGGGG - Intronic
1034531532 7:151698911-151698933 CATCTCAGGGTGGCTTGGAGTGG - Intronic
1034933193 7:155180314-155180336 CATCAAAGGCTGGCTTGGGAAGG + Intergenic
1035314250 7:157988363-157988385 CTCCTGAGGCTGGTTTGCAGTGG + Intronic
1035564985 8:635425-635447 CAGCTAAGGCTGGCTGTGAGAGG + Intronic
1036941158 8:13054007-13054029 CACCCAAGGCTGGAGTGCAGTGG + Intergenic
1037785274 8:21899266-21899288 CACCCAAGGCTGGAGTGCAGTGG - Intergenic
1037806993 8:22063587-22063609 CAAATATGGCTGGATTGGAGAGG - Intronic
1037893937 8:22639520-22639542 CACCTAAAGTTGGCTGGGTGAGG - Intronic
1037921999 8:22813877-22813899 CCCCAGAGGCTGGCTTGGGGTGG - Intronic
1040604895 8:48921804-48921826 CACCAGAGGCTGGCCTGGTGTGG - Intergenic
1043115950 8:76254550-76254572 CACCTAAGGCAGGGAAGGAGAGG + Intergenic
1048459400 8:134608554-134608576 CACCGAGGGCTGCCATGGAGGGG + Intronic
1048568135 8:135625447-135625469 CTCCTAAGGCTGCCCTGGTGTGG - Intronic
1049146241 8:141002645-141002667 GGCCTGAGGCTGGCATGGAGAGG - Intergenic
1049426704 8:142541038-142541060 CACCCAGGGCTGGCTTGGCGTGG + Intronic
1050809481 9:9725970-9725992 CCCCTAACGCTGGCTTGGTTGGG - Intronic
1052685177 9:31746179-31746201 CCCCAAAGGTTGGCATGGAGGGG - Intergenic
1057222467 9:93264568-93264590 CACCTGAGCCAGGCTAGGAGTGG + Intronic
1058446682 9:105061272-105061294 CCCCTAAGCCAGTCTTGGAGTGG + Intergenic
1061230971 9:129315630-129315652 CACATAAGCCCAGCTTGGAGTGG + Intergenic
1062209080 9:135353514-135353536 CAGCAGAGGCTGGCCTGGAGTGG + Intergenic
1203427445 Un_GL000195v1:54450-54472 CAAGAGAGGCTGGCTTGGAGGGG + Intergenic
1185663101 X:1742634-1742656 CACCCAAGGCTGGAGTGCAGTGG - Intergenic
1185864728 X:3613388-3613410 TACCTACAGGTGGCTTGGAGGGG + Intronic
1188384367 X:29538377-29538399 CACCTCAGGCTGGAGTGAAGTGG + Intronic
1188854716 X:35179279-35179301 CACCTCAGTCTTGTTTGGAGAGG + Intergenic
1195629025 X:107034370-107034392 TACCTGAGGCTGGGATGGAGAGG + Intergenic
1196732574 X:118955849-118955871 CACCAAAGGCTGGGCTGGGGAGG - Intergenic
1198106085 X:133462674-133462696 CACCCAAGGCTGGAGTGCAGTGG + Intergenic
1199794443 X:151180852-151180874 GACCAGAGGCAGGCTTGGAGTGG - Exonic
1199794473 X:151181041-151181063 CACTGAAGGCAGACTTGGAGTGG - Exonic
1200799227 Y:7370678-7370700 TACCTACAGGTGGCTTGGAGGGG - Intergenic
1202580170 Y:26372061-26372083 CACCTAGGGCTGGAGTGTAGTGG - Intergenic