ID: 1078567880

View in Genome Browser
Species Human (GRCh38)
Location 11:12432622-12432644
Sequence CCAGATAAGCAGTTATTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 227}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078567880 Original CRISPR CCAGATAAGCAGTTATTTTT TGG (reversed) Intronic
903033745 1:20481289-20481311 CCATGCAAGCAGTTATTATTGGG - Intergenic
904508472 1:30979795-30979817 CCAGATACTCATTTATATTTTGG - Intronic
905861017 1:41351475-41351497 CCAGATGAGATGTTATTTCTGGG + Intergenic
906183410 1:43840811-43840833 CCAGATAAGAATTTAGATTTGGG - Intronic
906358348 1:45128982-45129004 CCAGACAATGAGATATTTTTTGG - Intronic
907765599 1:57407594-57407616 CCCTATAAGAACTTATTTTTCGG + Intronic
909410032 1:75339563-75339585 ACAGGTAAGCAATTATTTTTTGG - Exonic
910161481 1:84276918-84276940 TCACATAAGCAGGTATTCTTGGG - Intergenic
913122700 1:115756298-115756320 CCAGATAAGCTGTTTCTGTTTGG - Intronic
914223796 1:145703817-145703839 CAAGATAAGCTTTTTTTTTTTGG + Intronic
915270982 1:154753353-154753375 CTAGAAAAACAGTGATTTTTAGG - Intronic
915403181 1:155639161-155639183 CCAGAAAAGCATGTAGTTTTTGG + Intergenic
916866752 1:168868167-168868189 TCAGATAAGCAGTTAATTTGTGG + Intergenic
918385446 1:184002619-184002641 AGAGATAAGCAGTAATATTTTGG + Intronic
919640667 1:200041314-200041336 CCAGAGAAGTAGTTTTTCTTTGG + Intronic
921649907 1:217664878-217664900 CCTTATAAGCATTTATTTATAGG - Intronic
923308355 1:232709389-232709411 CTGGAGAAGCACTTATTTTTAGG + Intergenic
924023308 1:239807588-239807610 CCAGATAAATAGTTTTTCTTTGG + Intronic
924496065 1:244590262-244590284 GCAGGTAAGGAGTTATTTTAAGG - Intronic
924717957 1:246595682-246595704 CCAGAAATGCAGTTTTTTGTAGG + Intronic
1063641991 10:7839156-7839178 CCAGGTACATAGTTATTTTTGGG - Intronic
1064420098 10:15183541-15183563 CCAGATAAGCAATGTTTATTTGG + Intergenic
1065616566 10:27532158-27532180 CCAATTAAGCAGAAATTTTTTGG + Intronic
1068701672 10:60026440-60026462 TCAGATATGAAGTTAGTTTTTGG + Exonic
1078567880 11:12432622-12432644 CCAGATAAGCAGTTATTTTTTGG - Intronic
1079392967 11:20038278-20038300 CAAGATCAGAAGTTATTTTAAGG + Intronic
1079892739 11:26078049-26078071 ACAAATAAGCAGCTATTTATAGG + Intergenic
1080022841 11:27581451-27581473 CCAGATAATCAGTAATGATTAGG - Intergenic
1081583996 11:44371712-44371734 TCAGATAATCAATAATTTTTCGG + Intergenic
1082032068 11:47612111-47612133 CCTGAAAAGAAGCTATTTTTTGG + Intergenic
1082173929 11:49040117-49040139 CTAGGTAAGCAGTAATTATTGGG + Intergenic
1083451772 11:62751074-62751096 CCAGATAAGCAGGACTTTATGGG - Exonic
1083901049 11:65643705-65643727 CCGGATAAGCAGGTGTTTTCTGG + Intronic
1084380450 11:68808667-68808689 CCAGAAATGCAGCTATTTTGTGG + Intronic
1086691835 11:89795964-89795986 CTAGGTAAGCAGTAATTATTGGG - Intergenic
1086713966 11:90043692-90043714 CTAGGTAAGCAGTAATTATTGGG + Intergenic
1090980904 11:131720988-131721010 CTAGATAAGAAGGTATTTCTAGG - Intronic
1093441915 12:19208583-19208605 CCAGCTAAGCTCTCATTTTTTGG + Intronic
1094658713 12:32445647-32445669 TCATATAAGCAGTCATTTTGTGG + Intronic
1095086699 12:38064196-38064218 CCAGAGAAGCAGCTATATTCAGG - Intergenic
1095266084 12:40159705-40159727 CCAAATATCCAGTTATATTTAGG + Intergenic
1095726967 12:45464538-45464560 CAAGATACGCAGGTATTTGTTGG - Intergenic
1095921525 12:47536244-47536266 CCAGTTTAGGAGGTATTTTTAGG - Intergenic
1097745997 12:63303727-63303749 CCTGAGAAGAAGTTAATTTTGGG - Intergenic
1098182250 12:67860476-67860498 CCAGAGCAGCAGTTCCTTTTTGG - Intergenic
1098412399 12:70200729-70200751 ACAGATAAACGTTTATTTTTAGG - Intergenic
1100045147 12:90370969-90370991 CCAGATAAGCAGCTTTTCTTGGG + Intergenic
1100354270 12:93814296-93814318 TGAGATAAGCAGTTTTTTTGTGG + Intronic
1100520566 12:95371347-95371369 CCAGACAAGCAGTTTTTGTGAGG - Intergenic
1106709574 13:32315640-32315662 CCAGAGGTGCAGTTCTTTTTTGG - Exonic
1107573679 13:41692518-41692540 CCAGTTATGTAGTTATGTTTTGG - Intronic
1109178981 13:59190452-59190474 CAACAGAAGAAGTTATTTTTTGG - Intergenic
1109875042 13:68390818-68390840 ACAGATGGACAGTTATTTTTCGG - Intergenic
1109916377 13:68990578-68990600 ACAGATATGCATTTATTTGTGGG - Intergenic
1110988493 13:82006455-82006477 CCATATAATCAGTAAATTTTTGG + Intergenic
1113504805 13:110808100-110808122 CCACATAAAAAGTTACTTTTAGG + Intergenic
1114351263 14:21854254-21854276 GCAGATCAGCAGTAGTTTTTAGG + Intergenic
1115339750 14:32280745-32280767 CCAGAGAAGAAGTTATGTTAGGG - Intergenic
1115348817 14:32371105-32371127 CAAGACAAGAATTTATTTTTAGG - Intronic
1115404849 14:33003176-33003198 ACTGATAAGTATTTATTTTTTGG - Intronic
1116403433 14:44538381-44538403 GGAGAGAAGGAGTTATTTTTTGG - Intergenic
1117534001 14:56686839-56686861 CCAGCTCAGCAGTGATTTTGGGG - Intronic
1119226823 14:72950748-72950770 TCAGATAAGCAGAAATTTTAAGG + Intronic
1120534120 14:85671733-85671755 CTACAAAACCAGTTATTTTTAGG + Intergenic
1125189844 15:36978041-36978063 TTTGATAAGCAGTTATTTTCTGG + Intronic
1125265438 15:37874417-37874439 CCAGCTAGGCAGTGATGTTTGGG - Intergenic
1128960274 15:71995928-71995950 CTATGTAGGCAGTTATTTTTTGG - Intronic
1130814141 15:87413099-87413121 ACAGATGAGGAGTTAGTTTTAGG - Intergenic
1131582624 15:93659913-93659935 CCAGATAAGAACTTATTTTAAGG + Intergenic
1134463083 16:14446745-14446767 CCACCAAAGCAGATATTTTTAGG - Intronic
1134894362 16:17871450-17871472 CCAGATGGGCGGTTATTCTTGGG + Intergenic
1135874174 16:26182154-26182176 CCAGTTCAGCAGATATTTATTGG + Intergenic
1144287059 17:13786853-13786875 CCAGATAAGCCATTGCTTTTAGG + Intergenic
1146061491 17:29609895-29609917 CCAGCCAGGCAGTCATTTTTAGG - Intronic
1153549679 18:6248625-6248647 AAAGATAAGCAGTTATATGTAGG + Intronic
1153570480 18:6467358-6467380 CCAGGTAAGTTTTTATTTTTTGG + Intergenic
1153758213 18:8304451-8304473 AGAGAAAAGCAGATATTTTTGGG - Intronic
1155280141 18:24230872-24230894 CTTGATAAGCACTTATTTGTGGG + Intronic
1155728876 18:29126882-29126904 CCAGTTTAGCTGCTATTTTTTGG - Intergenic
1155741485 18:29294305-29294327 CCAGATGAACAATTATTTTATGG - Intergenic
1156074890 18:33262546-33262568 CCAGATAATGAGTCATTTTAAGG - Intronic
1156571602 18:38260803-38260825 CCAGATAAACAGTTACTATGAGG - Intergenic
1158198392 18:54913048-54913070 CCAGATAAGCAGATATTGATGGG + Intronic
1159476417 18:68925854-68925876 TCTAATAAGCAGTTATTTTGAGG + Intronic
1159867447 18:73722948-73722970 CCAGAGAAATAGTTATTATTAGG + Intergenic
1161843793 19:6698393-6698415 TCAGACAAGCAGATATATTTTGG - Intronic
1167682457 19:50932431-50932453 CCAGATAAGCATCTAATTGTTGG - Intergenic
929301943 2:40314529-40314551 CCCAATAAGCATTTTTTTTTTGG - Intronic
930512909 2:52368403-52368425 GCAGATAAGAAGTTTGTTTTTGG - Intergenic
931842848 2:66172462-66172484 CCAGTTAAGTAGTTTTCTTTAGG - Intergenic
932856781 2:75241884-75241906 GCAGATAAGCACTTATCTTCTGG + Intergenic
933530583 2:83505562-83505584 CCAGATAAGCAATTACTATCTGG + Intergenic
933848061 2:86341486-86341508 CCAGATAAGTGTTTATTTTAGGG - Intergenic
934576930 2:95408269-95408291 CCAAATTAGAAGTTATCTTTGGG - Intronic
934670523 2:96209387-96209409 CCAGATAAGAAGATTTGTTTTGG - Intergenic
936602943 2:113917590-113917612 TCAGAATAGCATTTATTTTTTGG - Intronic
936651623 2:114433892-114433914 CTAGATAAGTAAATATTTTTTGG - Intergenic
936903077 2:117505985-117506007 CCATATAATCATGTATTTTTTGG - Intergenic
937107413 2:119330502-119330524 CCAGTTAAGCAGTTAGATTATGG + Intronic
937450585 2:121999215-121999237 GCAGATAAGCAGCTTTTTTCAGG + Intergenic
937755467 2:125532318-125532340 TCAATTAAGCAGTTATTTCTGGG - Intergenic
938244952 2:129769176-129769198 CCAGAAAAGCAATTTGTTTTTGG - Intergenic
941000569 2:160198611-160198633 CCAGATAAGGAGTTCCTATTTGG + Intronic
941028631 2:160486504-160486526 CCAGATAAACAGTGATTTCAGGG - Intronic
941475133 2:165942246-165942268 CTAGATAAGCAGTAATTTGGAGG - Intronic
941638133 2:167958185-167958207 CCACATAAGCAGACACTTTTTGG - Intronic
941664377 2:168229666-168229688 ACAGATAACGTGTTATTTTTCGG + Intronic
943049585 2:182899087-182899109 GCAGATAAGCAGATAATTCTGGG - Intergenic
944014951 2:195024882-195024904 CCAGATAAGAACACATTTTTAGG - Intergenic
947809233 2:232990680-232990702 AGAGATAAGAATTTATTTTTGGG - Intronic
1169823686 20:9742670-9742692 CCAGATAACCAATTTTTTTTAGG - Intronic
1174634468 20:51987123-51987145 CCAGAAAGGCAATTATGTTTTGG - Intergenic
1174988654 20:55484893-55484915 CTAGATAAACGGTTATATTTGGG - Intergenic
1176781874 21:13205604-13205626 CCAGTAAAGCTGTTTTTTTTTGG + Intergenic
1177053312 21:16266728-16266750 TCAGATATGCATTTATTTTGGGG + Intergenic
1177554183 21:22668661-22668683 CCACTTAAGCAGTAATTTTGAGG + Intergenic
1182577143 22:31280668-31280690 CCAGATCATCAGTTTTTTTCGGG - Intergenic
949575705 3:5337276-5337298 CCAGGTAGGAATTTATTTTTAGG + Intergenic
949743925 3:7266692-7266714 CCAGAAAAACATTTATTTTATGG + Intronic
949745600 3:7288639-7288661 CAATAAAAGCAGTTATTATTGGG + Intronic
950352108 3:12365391-12365413 CCAGATAATCAGTTATTTCATGG + Intronic
951455331 3:22885785-22885807 TAAGATAAGCACTTTTTTTTTGG - Intergenic
952626489 3:35411612-35411634 CCTGAGAAGCAGATCTTTTTTGG + Intergenic
952671891 3:35978709-35978731 GCAGATCAGCAGTTGTTTCTGGG - Intergenic
953939167 3:47075646-47075668 ACAGAGAAATAGTTATTTTTTGG + Intronic
954341870 3:49960654-49960676 CAAGATAAGAAGTTATTTCCAGG - Intronic
955470091 3:59277804-59277826 CCTGATAAGAATTTATTGTTTGG - Intergenic
956629362 3:71300021-71300043 CCAGATAAGTAGAGATTCTTGGG - Intronic
956983635 3:74670415-74670437 CCAGATCATTAGTTATTATTAGG + Intergenic
957114457 3:76007445-76007467 TTCGATAAGCAGTTATTTTTAGG - Intronic
957176936 3:76823880-76823902 CCTGATTAGCAGTTGTTTTATGG + Intronic
958641094 3:96805923-96805945 GAAGAAAAGCAGTTATTCTTAGG - Intergenic
959200891 3:103245384-103245406 CCAGATAAGGAGTTAATTCTGGG - Intergenic
959312986 3:104764266-104764288 CCAGATAAGAAATCATTTTATGG + Intergenic
959421238 3:106131725-106131747 CCAAATAAGCTTTTATTCTTGGG - Intergenic
959769017 3:110070748-110070770 CCAGATAACCTTTTATTATTTGG + Intergenic
963656343 3:148056111-148056133 CTATATAAGCAGTCATTTCTTGG - Intergenic
963952643 3:151220047-151220069 CCAGATAATTATTTATTTTTGGG + Intronic
963967876 3:151393523-151393545 AAAGATAAGCTGTTAATTTTAGG + Intronic
965014310 3:163136981-163137003 CAATATATGGAGTTATTTTTGGG + Intergenic
965107871 3:164381091-164381113 CCAGATGTGAAGTTATTATTTGG + Intergenic
965482551 3:169237698-169237720 TCAGGTATGCAGTGATTTTTGGG - Intronic
966511802 3:180772434-180772456 ACAGAAAAACAGTGATTTTTGGG - Intronic
968419376 4:470452-470474 CCTGATAACAAGTTAATTTTGGG + Intronic
973962820 4:56128964-56128986 ATATATAAACAGTTATTTTTGGG + Intergenic
974460643 4:62183411-62183433 CCAGTTCAACAGTTATTTGTTGG + Intergenic
974853800 4:67434973-67434995 ACTCATAGGCAGTTATTTTTGGG - Intergenic
975453449 4:74558224-74558246 CCAGATAAAATATTATTTTTGGG + Intergenic
978938429 4:114408274-114408296 CCAGGTGAGCAGTTATTATCTGG + Intergenic
979221947 4:118237133-118237155 CCAGAGAAGCAGCTCTTTTAGGG - Exonic
979837430 4:125388710-125388732 CCAAATAAGGATTTATTTTAAGG - Intronic
981226982 4:142308367-142308389 CCTGATATACAGTTATTTTTAGG - Intronic
981599223 4:146466976-146466998 CCAGAGATGAAGTTGTTTTTTGG - Intronic
982131361 4:152231411-152231433 CCAGATAGGTACTTATTTTAGGG + Intergenic
982336996 4:154251208-154251230 CAAGGCAAGCAGTTATTTTCAGG - Intronic
983123906 4:163925281-163925303 CCAGATATGCAGTATTTGTTTGG + Intronic
983611323 4:169648492-169648514 CCAAATAATCAGTTATCTCTGGG - Intronic
984428931 4:179624018-179624040 CAAGATAAGAAATTATTTTTGGG + Intergenic
984773837 4:183463196-183463218 CAAGATAAGCACTTTTTTTTTGG + Intergenic
985121958 4:186652589-186652611 CAAGATACGCAGATATTTTAAGG - Intronic
986508379 5:8476180-8476202 CCAGAGAAGCATTGCTTTTTAGG + Intergenic
986616663 5:9624391-9624413 GCAGATAAGCAGTGGTATTTTGG + Intergenic
987196367 5:15530524-15530546 CCAGATAAGTAGATATGTTAGGG + Intronic
988035273 5:25820017-25820039 CCTGATGAGCAGATATTTGTGGG + Intergenic
990787184 5:59434779-59434801 CCTGATTAGCAGTTATTGTCTGG - Intronic
990950324 5:61292362-61292384 TCATATCAGCAGTTATTTTATGG - Intergenic
992627811 5:78649806-78649828 TCAGATTAGCAGTCAATTTTGGG + Intronic
992775945 5:80089473-80089495 CCAGATAAGCAGACATGTTTAGG - Intergenic
995482167 5:112604238-112604260 CTAGCTAAGCAGTTATGATTGGG - Intergenic
996734502 5:126746398-126746420 CTAGATAAAGAGTTATTTTCAGG + Intergenic
996916686 5:128720648-128720670 CCAGATTAGCAGATACTTCTTGG + Intronic
996959756 5:129233318-129233340 CCAGATCACCAGTTGTTTTTGGG - Intergenic
1000531801 5:162431256-162431278 TCAGATAAGCTATTATTTTTGGG - Intergenic
1002623913 5:180511099-180511121 CCAGACAGGCAGGTTTTTTTTGG + Intronic
1004216130 6:13705984-13706006 TTAGATAAGCAATTATATTTAGG + Intronic
1004249015 6:14007109-14007131 TCTGATAAGCAGTTATTACTTGG - Intergenic
1004607637 6:17208882-17208904 CCAGATATGAAGTTATGCTTAGG - Intergenic
1006524847 6:34595138-34595160 TCAGAGAGACAGTTATTTTTAGG - Intronic
1008278967 6:49573073-49573095 CCACATAACCAGTGATTTTGTGG + Intergenic
1010371578 6:75116000-75116022 CCAGGTAAGCATTTATACTTTGG - Exonic
1010426408 6:75733267-75733289 CTATATAAGTAGGTATTTTTTGG - Intergenic
1012879701 6:104771837-104771859 CTAGATAAGCAGTAGTATTTTGG - Intronic
1013022935 6:106237765-106237787 CTATATAAGCAGTGATTATTTGG - Intronic
1013290171 6:108712834-108712856 CCAGATGCCCAGTTTTTTTTGGG - Intergenic
1013334737 6:109144541-109144563 CCATTTAAGCAGGTAATTTTTGG - Intronic
1014149132 6:118033406-118033428 TAAAATAAGGAGTTATTTTTGGG + Intronic
1014283666 6:119469720-119469742 CAAGAAAAGTAGTTATTTGTAGG + Intergenic
1015306942 6:131719667-131719689 ACAGATAAGCAATTATGTTTTGG - Intronic
1016154113 6:140782250-140782272 CTAGATATGCAGATATTTTCTGG - Intergenic
1016426527 6:143941681-143941703 CCAGAGAGGCAGGTATTGTTAGG + Exonic
1016717983 6:147255906-147255928 CATGATAAGCAGGTATTTTTTGG + Intronic
1017597592 6:156045715-156045737 CCAGCTGAGAAGTTATTTTCAGG - Intergenic
1020585255 7:10057444-10057466 ACTGATAAGCAGTTACTCTTTGG + Intergenic
1020960238 7:14793771-14793793 CCAGATTAAGCGTTATTTTTGGG + Intronic
1021243822 7:18237238-18237260 CATGATTAGAAGTTATTTTTAGG + Intronic
1021411560 7:20334837-20334859 CAAGAGAAGAAGTTATTTTGGGG - Intronic
1021665088 7:22969123-22969145 CCAGAGACTCAGATATTTTTAGG - Intronic
1022313100 7:29216044-29216066 GCAGAGAAGCAGCTATTGTTGGG + Intronic
1022336191 7:29424141-29424163 CTAAAGAAGAAGTTATTTTTTGG + Intronic
1022581055 7:31554908-31554930 CAAGAGAAGCAGTTATGCTTTGG + Intronic
1024024050 7:45396466-45396488 CCAGAGAAGAAGTTATATTTGGG - Intergenic
1026412895 7:70143965-70143987 ACAGATAAGTAGTCATTTGTTGG - Intronic
1026939068 7:74276476-74276498 TCAGCTAAGCAGGTATGTTTAGG + Intergenic
1028809474 7:95068068-95068090 CCACATATCCAGTTTTTTTTTGG - Intronic
1029411302 7:100413082-100413104 CCAGTTAAGAAGTTAGTATTAGG - Intronic
1030125556 7:106149657-106149679 TCAGAAAAGCAGTTAGTTTGTGG + Intergenic
1030327839 7:108240024-108240046 GCAGATAAGCGCTTCTTTTTCGG + Exonic
1031255284 7:119439597-119439619 CCAGATAAGTAGATAATTTTTGG - Intergenic
1034050949 7:147983984-147984006 CCTGCTAAGCAGTTTTTTTGTGG - Intronic
1034907313 7:154961585-154961607 CCAAATAAGCCATTAATTTTAGG + Exonic
1035004655 7:155646317-155646339 CCAGATAAACAGGCATTTTTGGG + Intronic
1035546932 8:488946-488968 GCAGTTAAGCATTTTTTTTTTGG + Intergenic
1036955939 8:13188466-13188488 TTAGATTAGCAGTTACTTTTGGG + Intronic
1039668695 8:39568730-39568752 ACAGATACGCAATTAATTTTTGG + Intergenic
1040912514 8:52534461-52534483 ACAGCTAACCAGTTATTTCTGGG + Exonic
1042740327 8:72036439-72036461 CCAGAAAAGGAATTATTTTATGG - Exonic
1043609102 8:82039895-82039917 GAAGGTAAGCAGTTAGTTTTTGG - Intergenic
1044052589 8:87526331-87526353 CCAGAAAATCTGTTATATTTAGG + Intronic
1044537391 8:93373054-93373076 CCAGAGAGGCATTTATATTTAGG + Intergenic
1047350378 8:124067803-124067825 ACAGGTAAGCAGTTATTCTGGGG + Exonic
1048155408 8:131943617-131943639 CCAGATAATTACTTACTTTTGGG + Intronic
1049105325 8:140609017-140609039 CCAGATCTGCAGACATTTTTCGG - Intronic
1050319187 9:4433658-4433680 AGAGATAAGTAGTTCTTTTTAGG - Intergenic
1051502007 9:17788340-17788362 CCAAATGAGCATTTAGTTTTTGG + Intronic
1051581978 9:18686466-18686488 GTAAATAAGCAGTTCTTTTTAGG + Intronic
1051684342 9:19641854-19641876 AGAAATAAGCAGTAATTTTTTGG - Intronic
1051885538 9:21889102-21889124 CAAGAAAATCAGTTATTCTTAGG + Intronic
1052640750 9:31163999-31164021 CCAGATCAACAGGTATGTTTGGG + Intergenic
1053042773 9:34888980-34889002 CCACATAAGAAGTACTTTTTAGG + Intergenic
1053215630 9:36268164-36268186 CCAGATAAGAAATAATTTATTGG - Intronic
1053623945 9:39849485-39849507 CCAAATAAGCTGATATTATTTGG + Intergenic
1053880924 9:42593744-42593766 CCAAATAAGCTGATATTATTTGG - Intergenic
1054219952 9:62401215-62401237 CCAAATAAGCTGATATTATTTGG - Intergenic
1054230763 9:62507957-62507979 CCAAATAAGCTGATATTATTTGG + Intergenic
1058631929 9:106998035-106998057 CCAGATAAGTAAATATTTTTAGG - Intronic
1060716953 9:125940809-125940831 TCAGATTAATAGTTATTTTTGGG + Intronic
1186748483 X:12596011-12596033 CCAGATAAGAAGCAATTTATGGG - Intronic
1187652370 X:21422550-21422572 CATGATAACCAGTTATTATTTGG + Intronic
1189166290 X:38864351-38864373 CCACATTACCAGTTATTTTTAGG + Intergenic
1189635700 X:43006246-43006268 CCAGATGTACAGTTATTTTTTGG + Intergenic
1189879014 X:45470128-45470150 CCAGAACACCAGTTATTCTTAGG + Intergenic
1193608024 X:83592607-83592629 CAATATAAGCAGCTATTTTCAGG - Intergenic
1195428986 X:104766801-104766823 GCAAATAAGCCGTTATTGTTAGG + Intronic
1195620633 X:106951019-106951041 CAAGTTAAACAGTTATTTATTGG + Intronic
1196360002 X:114842204-114842226 CCAGATATGCAGCTAATTTGAGG + Intronic
1197848664 X:130832916-130832938 CCAGTTAGGGAGTTATATTTAGG - Intronic
1198089149 X:133310667-133310689 CCAGATACGCATTTGTTATTTGG - Intronic
1198539447 X:137621186-137621208 CCTTATAAGCAGTAATTTTAAGG + Intergenic
1198857346 X:141032348-141032370 ACAGATTAACAGTGATTTTTAGG - Intergenic
1198861095 X:141071277-141071299 CCAGAGAAGCAGTTTTCTTAGGG + Intergenic
1198901597 X:141516106-141516128 CCAGAGAAGCAGTTTTCTTAGGG - Intergenic
1198905349 X:141555018-141555040 ACAGATTAACAGTGATTTTTAGG + Intergenic