ID: 1078569441

View in Genome Browser
Species Human (GRCh38)
Location 11:12444791-12444813
Sequence GAGACCTCAGCGTTGGCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078569439_1078569441 -10 Left 1078569439 11:12444778-12444800 CCAGAGGCATGCTGAGACCTCAG 0: 1
1: 0
2: 3
3: 21
4: 240
Right 1078569441 11:12444791-12444813 GAGACCTCAGCGTTGGCCCTAGG 0: 1
1: 0
2: 0
3: 5
4: 136
1078569436_1078569441 17 Left 1078569436 11:12444751-12444773 CCACTGGTTATTACTACATAGAT 0: 1
1: 0
2: 2
3: 10
4: 126
Right 1078569441 11:12444791-12444813 GAGACCTCAGCGTTGGCCCTAGG 0: 1
1: 0
2: 0
3: 5
4: 136
1078569438_1078569441 -9 Left 1078569438 11:12444777-12444799 CCCAGAGGCATGCTGAGACCTCA 0: 1
1: 1
2: 3
3: 19
4: 190
Right 1078569441 11:12444791-12444813 GAGACCTCAGCGTTGGCCCTAGG 0: 1
1: 0
2: 0
3: 5
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078569441 Original CRISPR GAGACCTCAGCGTTGGCCCT AGG Intronic
900372350 1:2337564-2337586 GAGACAGCAGGGTGGGCCCTGGG - Intronic
900375135 1:2350742-2350764 GAGACCTCAGGGGTGGCACGGGG + Intronic
900550516 1:3252248-3252270 AGGACCTCAGAGCTGGCCCTCGG - Intronic
901592643 1:10358340-10358362 GAAACCTCAGCAGTGGTCCTGGG + Intronic
906252514 1:44321581-44321603 AACACCTCAGAGTTGGCTCTTGG - Intronic
907861806 1:58361179-58361201 CAGACCACAGCCTTGCCCCTGGG + Intronic
910338238 1:86156774-86156796 GAGTCCTCTGCTTTGGGCCTGGG + Intronic
912495815 1:110090416-110090438 GACCCCTCAGGGTCGGCCCTAGG + Intergenic
913475088 1:119229503-119229525 GAGACCTCAGACTTGGCACCTGG + Intergenic
919916596 1:202143446-202143468 GAAACCTCAGCTTTGGGACTGGG + Intronic
920516603 1:206589069-206589091 TAGACCTCAGCATAGGCCTTGGG - Intronic
1063415592 10:5870324-5870346 GTGAGGTCAGCGTTGGCTCTTGG + Intronic
1064271532 10:13870491-13870513 GAGACCACAGCGATGGGCTTTGG - Intronic
1069744977 10:70709242-70709264 GAGACCCTGACGTTGGCCCTGGG + Intronic
1069749398 10:70735859-70735881 GACAGCTCAGCCTGGGCCCTGGG - Intronic
1075023607 10:118968194-118968216 GTGACCTCAGGGGTGGCCCAGGG + Intergenic
1076732697 10:132446442-132446464 GGGGCCTCAGGGTGGGCCCTGGG + Intronic
1077042017 11:529036-529058 GAGTGCTCAGGGATGGCCCTTGG - Intergenic
1077059484 11:611552-611574 GGGAGCCCAGCTTTGGCCCTGGG + Intronic
1077384282 11:2261674-2261696 GGGCCATCAGCGTGGGCCCTGGG + Intergenic
1077886015 11:6388633-6388655 CAGTCCTCAACCTTGGCCCTTGG - Intergenic
1078245982 11:9573698-9573720 GAGACCTCAGCCTCGGTGCTCGG + Exonic
1078569441 11:12444791-12444813 GAGACCTCAGCGTTGGCCCTAGG + Intronic
1079882385 11:25944004-25944026 CAGACTTCAGAGTGGGCCCTGGG + Intergenic
1084213546 11:67634780-67634802 GAGACCTGAGCCTTTGCCCCAGG + Intronic
1096186854 12:49587206-49587228 GAAACCTGAGCCTTGGGCCTGGG - Intronic
1096657703 12:53102055-53102077 GGGACCTCGGCGCTGCCCCTGGG - Exonic
1099873286 12:88374227-88374249 GAGATCTGAGCCCTGGCCCTTGG - Intergenic
1102792403 12:115658285-115658307 CACACCTCAGAGTTGGCCCAGGG + Intergenic
1111939865 13:94597238-94597260 AAGACATCAGCGTAGGACCTAGG - Intergenic
1112726703 13:102312654-102312676 GAGACATCAGTGATAGCCCTAGG + Intronic
1113993177 14:16045126-16045148 GATACCTCTGCATTGGCCCGAGG + Intergenic
1122859747 14:104577270-104577292 GAGAGGCCAGCGTTGGCCCAGGG - Intronic
1123038975 14:105482727-105482749 GTGACCGCAGCATCGGCCCTGGG + Intergenic
1123789442 15:23706041-23706063 GTTACTTCAGCTTTGGCCCTTGG + Intergenic
1126048101 15:44663304-44663326 GAGGCCTCGGCGTGAGCCCTTGG + Intronic
1127006418 15:54575593-54575615 GAAATTTCAGCGGTGGCCCTTGG - Intronic
1128390563 15:67179893-67179915 GAGATGTCAGCCTGGGCCCTGGG + Intronic
1129606551 15:77028016-77028038 CTGACCTCAGCCTTGGTCCTCGG + Intronic
1131953428 15:97705974-97705996 GAGACATCAGCATGGGGCCTGGG - Intergenic
1132073114 15:98797248-98797270 GGGAGCTCAGTGTTGGCCCCTGG + Intronic
1134145414 16:11756984-11757006 GAAACCTCAGCTTTAGCACTTGG - Intronic
1135182378 16:20287033-20287055 ATGACCTCAGCCTTGTCCCTGGG - Intergenic
1135504717 16:23026518-23026540 GAGCCATCAGCGTTAGCCTTGGG + Intergenic
1139953248 16:70681859-70681881 GAAACCTCAGCCCTGGCCCAAGG + Intronic
1140593107 16:76376594-76376616 GAGAGCCCAGCGTTGGCCAAAGG + Intronic
1141696816 16:85624163-85624185 GAGACCTCAGTGCCCGCCCTGGG + Intronic
1144453783 17:15402783-15402805 GAGACCTCAGCAGTGGTCCCAGG + Intergenic
1144681845 17:17201324-17201346 CAGACCTCAGGATGGGCCCTGGG + Exonic
1146353146 17:32112659-32112681 GCGGCCTCAGCGCTGGCCCGAGG - Intergenic
1146491575 17:33287269-33287291 CAGACCTCAGCGTGGGTCTTTGG - Intronic
1147948108 17:44091896-44091918 GAGACCTTGGCCTTGGCCCCAGG - Intronic
1151757039 17:76080932-76080954 GAGACCACAGCGGTAGCCCTGGG + Intronic
1152161080 17:78669149-78669171 GAGTCCTAAGTGTTGGGCCTGGG - Intergenic
1152868058 17:82735877-82735899 GAGGGGTCAGCTTTGGCCCTTGG + Intronic
1153787352 18:8546527-8546549 GGGTCCTCAGGCTTGGCCCTGGG - Intergenic
1156479338 18:37426353-37426375 CAGACCCCAGCTTTGGTCCTAGG + Intronic
1159948471 18:74461035-74461057 AAGACCTCACCCGTGGCCCTGGG - Intergenic
1162784967 19:13028913-13028935 GACACCTAAGCCTTGGTCCTAGG + Intronic
1163349750 19:16768929-16768951 GAGACAGCAGCACTGGCCCTGGG - Intronic
1165388109 19:35523591-35523613 GAGACCTCAGCCCCGCCCCTCGG + Intronic
1166372559 19:42310267-42310289 GAGACCCCAGGCTTGGCCCCTGG - Exonic
1168289232 19:55348986-55349008 AGCACCTCAGCGGTGGCCCTGGG + Intergenic
1168319972 19:55503379-55503401 GATACCACAGCGCTGGGCCTGGG - Intronic
928127565 2:28626918-28626940 CAAACCTCAGTGGTGGCCCTGGG + Intronic
928199071 2:29235614-29235636 GTGCCCTGAGGGTTGGCCCTGGG + Intronic
934775319 2:96933601-96933623 GAGTCCTCAGCCTGGGCCTTAGG + Intronic
936280270 2:111133470-111133492 GAGACCTCCTCTTTGACCCTAGG + Intronic
937145501 2:119640853-119640875 GTGACCTCAGCCATGCCCCTTGG + Intronic
937984481 2:127632418-127632440 CAGCCCCCAGCATTGGCCCTGGG + Intronic
944201002 2:197107360-197107382 TTGACCTCACCATTGGCCCTAGG - Intronic
944835892 2:203579470-203579492 GAGACCTCAGCTTTCTCTCTTGG - Intergenic
948427780 2:237898753-237898775 GAGGCCTCAGCCCGGGCCCTGGG - Intronic
948461109 2:238130446-238130468 GAGGCCTCAGAGGTGGCCCCCGG + Exonic
1170816507 20:19719119-19719141 GAGCCCTGAGCATTGGCCATGGG + Intronic
1171811846 20:29750725-29750747 GATACCTCTGCATTGGCCCGAGG - Intergenic
1173196006 20:40913370-40913392 GCGACCTTAGCATCGGCCCTAGG + Intergenic
1174587882 20:51622954-51622976 GAGAGCTCAGCGTGGGTGCTGGG - Intronic
1175501866 20:59456443-59456465 GAGACCTCAGAGCTGGGACTTGG - Intergenic
1176553042 21:8238388-8238410 GATACCTCTGCATTGGCCCGAGG + Intergenic
1176571964 21:8421412-8421434 GATACCTCTGCATTGGCCCGAGG + Intergenic
1176579873 21:8465995-8466017 GATACCTCTGCATTGGCCCGAGG + Intergenic
1179819852 21:43930447-43930469 GCGACCTCAGCGTGGCCCATGGG + Intronic
1180093225 21:45542913-45542935 GCGCCCTCAGGGGTGGCCCTGGG + Intronic
1180314091 22:11262387-11262409 GATACCTCTGCATTGGCCCGAGG - Intergenic
1180341268 22:11621147-11621169 GATACCTCTGCATTGGCCCAAGG + Intergenic
1184643327 22:45883478-45883500 GAGAGTGCAGTGTTGGCCCTGGG - Intergenic
1203258040 22_KI270733v1_random:155430-155452 GATACCTCTGCATTGGCCCGAGG + Intergenic
950532429 3:13559965-13559987 GTGATCTCAGCCTTGGCCGTGGG + Intronic
950565631 3:13768136-13768158 CAGACCTCAGGGTGGACCCTTGG + Intergenic
952653122 3:35750307-35750329 GAGACCTTATCTTTGGCCCGTGG + Intronic
954291854 3:49654048-49654070 GAGAACTCTGCTGTGGCCCTTGG - Exonic
956605485 3:71069131-71069153 GAGAACTCAGTGTTTTCCCTTGG - Intronic
961581660 3:127888263-127888285 GAGAACTCAGCATTGGCTCTTGG - Intergenic
961745403 3:129061120-129061142 GACACCACACCGGTGGCCCTGGG + Intronic
962600785 3:136989568-136989590 GAGACTCCAGCCTTGGCCTTTGG + Intronic
966678823 3:182618745-182618767 GAGATCTCATTGTTTGCCCTTGG - Intergenic
967843910 3:194029559-194029581 GAAACCTCAAGGGTGGCCCTTGG - Intergenic
975376207 4:73649371-73649393 GAGAGCTCAGCTTTGGATCTTGG + Intergenic
976890970 4:90047307-90047329 CAGCCCTCAACCTTGGCCCTTGG - Intergenic
982200664 4:152957036-152957058 AAGACTCCAGGGTTGGCCCTGGG - Intronic
984943774 4:184955403-184955425 GGGAACTCAGCCTTGGCCCCGGG + Intergenic
985521111 5:374200-374222 GAGACCCCCGTGCTGGCCCTGGG - Intronic
985578092 5:682950-682972 GAGACCTCAGAGCCAGCCCTCGG + Intronic
985593019 5:775091-775113 GAGACCTCAGAGCCAGCCCTCGG + Intergenic
985646983 5:1089594-1089616 CACAGCTCAGCGTCGGCCCTGGG + Intronic
986291842 5:6406475-6406497 GAGCCCTCAGAGTTGACCATGGG + Intergenic
986569249 5:9148434-9148456 GTGACCTAAGCTTTGGCCCCAGG + Intronic
1001407261 5:171484878-171484900 GAGGCCTCTGCATTGGGCCTGGG - Intergenic
1003831553 6:10017493-10017515 GGAACCCCAGCTTTGGCCCTTGG - Intronic
1004779099 6:18885844-18885866 GAGAACTTATCATTGGCCCTTGG + Intergenic
1017072841 6:150591645-150591667 GATACCTTAGTGATGGCCCTCGG + Intergenic
1019155803 6:170038144-170038166 GTGCCCTCAGCGCTGGCCATGGG + Intergenic
1019742693 7:2682647-2682669 GAGACCTCAGTGTCGGGCCATGG + Intronic
1020369837 7:7419875-7419897 GAGGACTCACCTTTGGCCCTTGG + Exonic
1029451239 7:100642736-100642758 GGGGCCTCAGCGTAGGCCTTAGG - Intronic
1032012811 7:128357871-128357893 GAAACCTCAGCCTTGGCCCCAGG - Intronic
1032724255 7:134576344-134576366 GGGTCCTCAGGTTTGGCCCTAGG - Exonic
1037857218 8:22380505-22380527 GAGGCCTCAGTGTTGCCACTGGG + Intronic
1040996413 8:53407354-53407376 GAGACCTCAGCTCTGGCGCTAGG - Intergenic
1045252695 8:100494885-100494907 GAGACAGCAGCTTTGGCCTTCGG + Intergenic
1049175384 8:141189496-141189518 GAGTGCTCAGTGTTGGCCTTGGG + Intronic
1049541367 8:143210660-143210682 CAGACCTTAGCCCTGGCCCTGGG + Intergenic
1049818074 8:144617543-144617565 GAGAGCCCAGCCTTGGCCCCAGG + Intergenic
1051332803 9:16040395-16040417 GAGCCCTCAGAGTTGTCTCTGGG + Intronic
1051609937 9:18951276-18951298 GAGACCTCAGGGGAGGACCTGGG - Intronic
1053825655 9:42021792-42021814 CAGAGCTCAGCTTTGACCCTAGG - Intronic
1054604907 9:67165566-67165588 CAGAGCTCAGCTTTGACCCTAGG + Intergenic
1058671787 9:107366504-107366526 TTGACCTCAGCCGTGGCCCTGGG + Intergenic
1058711311 9:107681826-107681848 GAGAGCTCAGCGTTGGTCCCTGG + Intergenic
1059436919 9:114282552-114282574 GAGTCCTCACCGTTGGTCCCAGG - Exonic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1060994415 9:127868060-127868082 GAGCCCTCAGCGTTGACCTGTGG + Exonic
1061817820 9:133206987-133207009 GAGACCCCAGAAGTGGCCCTTGG + Intronic
1203474234 Un_GL000220v1:137453-137475 GATACCTCTGCATTGGCCCGAGG + Intergenic
1203362403 Un_KI270442v1:228506-228528 GATACCTCTGCATTGGCCCGAGG - Intergenic
1185883758 X:3763530-3763552 GAGATGTCAGACTTGGCCCTTGG + Intergenic
1186355398 X:8784307-8784329 GCGACCACAGCGCTGGGCCTGGG + Intergenic
1186483296 X:9912606-9912628 GGGACCTCTGCGTTTGCTCTCGG + Intronic
1196075187 X:111568463-111568485 GAGACTTCTAGGTTGGCCCTGGG + Intergenic
1196941904 X:120785344-120785366 CAGAACTCAGCTTTGGCACTTGG + Intergenic
1201075844 Y:10187754-10187776 GATACCTCTGCATTGGCCCAAGG + Intergenic