ID: 1078570015

View in Genome Browser
Species Human (GRCh38)
Location 11:12449626-12449648
Sequence CTAGATCAGTAGTTCTCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 5, 3: 47, 4: 310}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078570009_1078570015 19 Left 1078570009 11:12449584-12449606 CCGCATTCTTCTTTCTTCCTCTC 0: 1
1: 3
2: 35
3: 413
4: 2895
Right 1078570015 11:12449626-12449648 CTAGATCAGTAGTTCTCCATGGG 0: 1
1: 0
2: 5
3: 47
4: 310
1078570011_1078570015 2 Left 1078570011 11:12449601-12449623 CCTCTCTGTATGTGGTACTTCCC 0: 1
1: 0
2: 1
3: 17
4: 163
Right 1078570015 11:12449626-12449648 CTAGATCAGTAGTTCTCCATGGG 0: 1
1: 0
2: 5
3: 47
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078570015 Original CRISPR CTAGATCAGTAGTTCTCCAT GGG Intronic
900774254 1:4570272-4570294 CTAGATTATTCGTTCTCAATAGG + Intergenic
901484300 1:9547763-9547785 CTAAACCAGTAGTTCTCAATTGG - Intronic
902173989 1:14635729-14635751 CTAGACCAGTGGTTCTCAACTGG + Intronic
902281848 1:15380418-15380440 CTAGAACAGTGGTTCTCAATTGG - Intronic
904809398 1:33153384-33153406 CTAGAGCAGTGGTTCTCAACTGG + Intronic
907529180 1:55076113-55076135 CTAGATCTATAGTTCTCTGTGGG + Intronic
908043770 1:60145670-60145692 CTAGAGCAGTGGCTCTCAATGGG + Intergenic
908478561 1:64513335-64513357 TTAGAACAGTATTTCTCAATTGG - Intronic
908485148 1:64584382-64584404 CTAGAGCACTAGTTCTACTTAGG - Intronic
909319264 1:74262374-74262396 CTAAATCAGTTGTTCTCAACTGG - Intronic
913370020 1:118087991-118088013 CTAGAGCAGTGGTTCTCAACAGG - Intronic
915019945 1:152769679-152769701 CTAATTCAGTGGTTCTCAATGGG - Intronic
916000139 1:160607577-160607599 CTAGATCAGTGGTTCTCAACTGG + Intergenic
916923165 1:169490203-169490225 ATAAATCAGTGGTTCTCAATCGG + Intergenic
918333137 1:183479445-183479467 CTAAATCAGTGGTTCTCAACTGG - Intronic
918815868 1:189182018-189182040 CTAAGGCAGTGGTTCTCCATTGG + Intergenic
919153902 1:193735935-193735957 CTGGCTCAGTAGTTCTCTCTGGG + Intergenic
921728797 1:218553701-218553723 CTGACTCAGTAGTTCTGCATTGG + Intergenic
923078603 1:230632561-230632583 CTAGATCAGTGGTTCTCACCTGG - Intergenic
924671093 1:246126197-246126219 TTAGATCAGTGGTTCTCACTGGG + Intronic
924690000 1:246338790-246338812 CCACACCAGTAGTTCTCAATGGG + Intronic
1065990422 10:31004040-31004062 CTACATAAGTACTTCTCAATGGG + Intronic
1066167473 10:32802732-32802754 CTACACCAGTAGTTTTCCAGGGG - Intronic
1066377334 10:34869192-34869214 CTAAAACAGTAGTTCTCAACTGG - Intergenic
1066683023 10:37953732-37953754 CTAGATCATGAATGCTCCATAGG + Exonic
1066790060 10:39052265-39052287 CTTATTCAGTAATTCTCCATAGG - Intergenic
1069340707 10:67404932-67404954 CTAGATATGTAATTCTGCATTGG - Intronic
1069384958 10:67875816-67875838 CTAGATCAGTGGTTCTCAACTGG - Intergenic
1070371879 10:75790311-75790333 CTAGATCAGTAGTTCTCAACTGG - Intronic
1070396821 10:76018385-76018407 TTAGATCAGTGGTTCTCAAGTGG - Intronic
1071445567 10:85743121-85743143 CTAGATAATTGGTTCTCAATGGG - Intronic
1071599805 10:86953529-86953551 TTAGACCAGTGGTTCTCAATGGG + Intronic
1072342145 10:94462495-94462517 TTAGATCAGTAATTCTCAACTGG - Intronic
1072566656 10:96621966-96621988 CTAAAGCAGTGGTTCTCAATTGG - Intronic
1073302239 10:102477938-102477960 CTAGAGCAGTGGTTCCCAATTGG - Intergenic
1073605430 10:104890886-104890908 CTAAATCAGTAGTTCTCAACTGG - Intronic
1074424356 10:113338142-113338164 CTAGAGAAGTTGTACTCCATGGG + Intergenic
1075215488 10:120529096-120529118 CTAGGGCAGTGGTTCTCCACTGG + Intronic
1078570015 11:12449626-12449648 CTAGATCAGTAGTTCTCCATGGG + Intronic
1078756692 11:14217893-14217915 CTAGGTCAATGGTTCTCCCTTGG + Intronic
1079372841 11:19866379-19866401 TTTGATCAGTAGTTCTCCACTGG - Intronic
1079435733 11:20447228-20447250 CTAGAACAGTGGTTTTCAATGGG + Intronic
1079544692 11:21618993-21619015 CTATATGAGTAGCTTTCCATGGG - Intergenic
1079989449 11:27231565-27231587 CTAGAGAAGCAGTTCTCCAAGGG - Intergenic
1080955668 11:37092091-37092113 CTAAATCAGTGCTTCTCCACTGG - Intergenic
1081230246 11:40577503-40577525 CTATATCGGTAGTTCTTAATGGG + Intronic
1081365357 11:42228497-42228519 CTAGAGCAGCAGTTCTCCACTGG - Intergenic
1084052685 11:66610864-66610886 TTAGATCAGTGGTTCTCAGTGGG + Intergenic
1086473129 11:87138874-87138896 CTAGAGCAGTGGTTCTTAATTGG + Intronic
1087009643 11:93501137-93501159 CTAGATCAGTGGTACTCAACAGG + Intronic
1088188445 11:107199585-107199607 CTGGCTAAGTAGTTCTCCATGGG - Intergenic
1092192726 12:6532751-6532773 CTACGTCAGTAGTGCTCCCTGGG + Intergenic
1092938020 12:13381963-13381985 ATAGAGCAGTAGATCACCATGGG - Intronic
1093146465 12:15572778-15572800 CTAGATCAATGGTTCTCAACTGG + Intronic
1093445296 12:19250123-19250145 CTAGACAAGTGGTTCTCAATTGG - Intronic
1093642164 12:21540820-21540842 CTGGATCAGTGATCCTCCATGGG + Intronic
1094125668 12:27020464-27020486 CTAGACCAGTGGTTCTCAATTGG + Intergenic
1094670849 12:32567364-32567386 CTAGGTGAGTAGTTCTCAAGCGG + Intronic
1096445025 12:51681739-51681761 CTAGCTCAATACTTTTCCATTGG + Intronic
1097244341 12:57598674-57598696 CTAGAGCAGTGTTTCTTCATAGG - Intronic
1098099231 12:66996108-66996130 GTAGATCAGTAGTTGTCTAGGGG + Intergenic
1098373448 12:69785265-69785287 CTGGAGCAGTGTTTCTCCATAGG + Intronic
1099673483 12:85726273-85726295 ATAGATTAGTAGTTCTCAAGTGG - Intergenic
1100783569 12:98055298-98055320 CTAGAACATTAGTTTTCCAAAGG + Intergenic
1102427330 12:112854256-112854278 CTAGAGCAGTGGTTCTCAACAGG - Intronic
1102545580 12:113652678-113652700 TTAGATCAGTGGTTCTCAACTGG - Intergenic
1102725403 12:115060072-115060094 CTAGAACAGAGGTTCTCAATGGG + Intergenic
1103308049 12:119981884-119981906 CTAAACCAGTAGTTCTCAACTGG - Intergenic
1104426007 12:128678617-128678639 CTAGACCAGTGGTTCTCTGTGGG + Intronic
1104991539 12:132626466-132626488 CTACATTAGCAGTTTTCCATCGG + Intronic
1106383267 13:29260758-29260780 CTAGAGCAGTGGTTCTTAATCGG + Intronic
1109646862 13:65270287-65270309 CTAGGTCAGTACTTGTCCACTGG - Intergenic
1110462689 13:75763116-75763138 TTAGATCAGTGGTTCTCAACTGG + Intronic
1112614581 13:100990322-100990344 CTAGACCAGTGATTCTCAATGGG + Intergenic
1115177519 14:30580913-30580935 TAAGATCAGTAGTTCTCAACTGG - Intronic
1115855563 14:37626132-37626154 TTAGGTCAGTGGTTCTCAATTGG - Intronic
1116219264 14:42061439-42061461 CAAAATCAGTATTTCTCCACAGG - Intergenic
1117138090 14:52758126-52758148 GTAGGTAAGTAGTTTTCCATAGG - Intronic
1117485479 14:56192559-56192581 CTAAATCAGTAGCCCTCCAGGGG - Intronic
1118108824 14:62693276-62693298 GTAGATCAGTAGTTCTCAACTGG - Intergenic
1118449303 14:65884371-65884393 CTAGATCATTAATTCTCAACTGG - Intergenic
1120263368 14:82217200-82217222 TTAGATCATGAGCTCTCCATGGG - Intergenic
1120374727 14:83688873-83688895 CTAGAACAGTGGTTCTAGATTGG + Intergenic
1120701907 14:87707296-87707318 CTAAATCAGTAGTACTCAAATGG + Intergenic
1120942695 14:89963988-89964010 CAACAGTAGTAGTTCTCCATGGG + Intronic
1121466066 14:94116228-94116250 CTAGCTCTGGAGTTCACCATGGG + Intronic
1122325034 14:100876761-100876783 CTTTATCAGTAGTTCTCCTCTGG + Intergenic
1127148499 15:56050009-56050031 CTAGGACAGTGGTTTTCCATGGG - Intergenic
1128394889 15:67214568-67214590 CTATGTCAGTGGTTCTCAATTGG - Intronic
1128397531 15:67243432-67243454 CTAAAGCAGTGGTTCTCTATGGG + Intronic
1129854908 15:78816621-78816643 CTAGAACAGTGGTTCTCAAGCGG + Intronic
1130016849 15:80194040-80194062 CTAGAACAGTAATTCTCAAAAGG + Intergenic
1130350478 15:83086974-83086996 CTAGATCTGCAGTTCTCAAACGG - Intergenic
1130835865 15:87649447-87649469 CTAGACCAGTGGTTCTCAACTGG + Intergenic
1131701264 15:94938632-94938654 TTACACCAGTGGTTCTCCATGGG - Intergenic
1133474817 16:6110706-6110728 CCAGAGCAGTGGTTCTCAATGGG + Intronic
1133661199 16:7919522-7919544 CTAGACCAGTGGTTCTCAACTGG - Intergenic
1134322087 16:13173526-13173548 CTAGATCAGCAGTTCTTAACTGG + Intronic
1134394204 16:13848146-13848168 CTACAACAGTAGTTCTCAATTGG - Intergenic
1134816739 16:17212047-17212069 CTAGAACAGTGGTTCTCAACTGG - Intronic
1134830865 16:17321674-17321696 TTAGAGCAGTGGTTCTCAATCGG + Intronic
1134864312 16:17591082-17591104 CTAGAGCAGTGGCTCTCCTTAGG + Intergenic
1135028120 16:19014364-19014386 TTAGATCAGTGGTTCTCAAGTGG - Intronic
1135080237 16:19427814-19427836 CTAGAGCAGTGGTTCTCAAGTGG - Intronic
1135187166 16:20325016-20325038 TTAGATCAGTGGTTCTCAACTGG - Intronic
1135285231 16:21187572-21187594 CTAGATCAGCAGTTCTCAGTTGG + Intergenic
1135885763 16:26305766-26305788 CTAGAGCAGTGGTTCTCAAACGG - Intergenic
1137341122 16:47606757-47606779 CTACAGCAGGATTTCTCCATGGG - Intronic
1138090349 16:54168705-54168727 CTAGAGCAGTGGTTCTCAACAGG + Intergenic
1138344922 16:56314840-56314862 CTAGATCAGCGGTTCTCAAAGGG - Intronic
1139153003 16:64407151-64407173 ATAGATCAAGAGTTCTCCACGGG - Intergenic
1139223072 16:65204547-65204569 CTAAATCAGTGTTTCTCCATGGG + Intergenic
1139892885 16:70265403-70265425 CTAGATCAGTGGTTCTCAAGTGG - Intronic
1140252946 16:73310473-73310495 AAAGACCAGTAGCTCTCCATGGG + Intergenic
1140304610 16:73791312-73791334 ATAGATCAGTAGTTCTCAAACGG + Intergenic
1140731731 16:77862658-77862680 GTAGAGCAGGATTTCTCCATCGG - Intronic
1141284612 16:82659958-82659980 CTAAAGCAGTGGTTCTCAATGGG - Intronic
1141338323 16:83178359-83178381 CTAAATCAGTGGTTCTCAACTGG - Intronic
1141737113 16:85861121-85861143 CTAATTCAGTAGTTCTCAACAGG + Intergenic
1143691029 17:8566171-8566193 CTAGGTCAGTGGTTCTTAATTGG - Intronic
1143793641 17:9318444-9318466 CTAGATTATTCCTTCTCCATTGG - Intronic
1143832007 17:9660046-9660068 CTAGAGCAGTAGCTCTCAACTGG - Intronic
1144068762 17:11647807-11647829 CTAGATTAGTGGTTCTCAACTGG + Intronic
1145103755 17:20097998-20098020 CTAGAACAATGGTTCTCAATGGG - Intronic
1146441226 17:32896874-32896896 CTAGAGCAGGGGTTCTCCACTGG - Intergenic
1147010801 17:37445797-37445819 GTAGATCAGTAATTCTCTATTGG + Intronic
1147505704 17:41015154-41015176 ATATACCAGTGGTTCTCCATGGG - Intronic
1147687634 17:42296358-42296380 CTAGGTCTGTAGTTCGCCAATGG + Intronic
1148541893 17:48487577-48487599 CTAAGTCAGTAGTTCTCAACAGG - Intergenic
1148979912 17:51563608-51563630 CAAGACCAGTAGTTCTTAATAGG + Intergenic
1149297122 17:55271097-55271119 CTAGACCAGTGGTTCTCCACCGG - Intronic
1149689804 17:58565884-58565906 CTAGAGCAGTGGTTCTCCAAGGG + Intronic
1151185751 17:72362778-72362800 CTAAATCAGTGGTTCTCAACTGG + Intergenic
1151401229 17:73857319-73857341 CTATAGCAGTGGTTCTCCCTGGG + Intergenic
1151991171 17:77575339-77575361 CTAGATCAGCAGTTCTAACTGGG - Intergenic
1153516413 18:5906757-5906779 CTAGATTAGTAGTTGCCCAGGGG + Intergenic
1153860121 18:9194300-9194322 CTATATCAGTAGTTCTCAAATGG - Intronic
1153995238 18:10434561-10434583 CTAGGACAGTGGTTCTCCAAGGG + Intergenic
1154240867 18:12653060-12653082 CTAGAGCAGTGGTTCTCAACTGG + Intronic
1156474237 18:37395531-37395553 TGAGATCAGTAGTTCTCTCTGGG + Intronic
1156541764 18:37919026-37919048 CTACATCACTAGTTCTCAATGGG - Intergenic
1157796269 18:50578477-50578499 CTAGACCAGTGGTTCTCAAATGG - Intronic
1158020875 18:52840029-52840051 CTCGTTCATTAGTTCTCCAGTGG + Intronic
1159022737 18:63156502-63156524 CTAAGGCAGTGGTTCTCCATGGG - Intronic
1165588247 19:36941241-36941263 CTACATCATTAGTTCTACAATGG - Intronic
1167854657 19:52227770-52227792 CTAGAGCAGTAGTTCTCAACTGG - Exonic
1168358963 19:55722102-55722124 CTAGCTCAGTAGTTCTCAATGGG - Intronic
925568546 2:5283913-5283935 CTAGAGCAGTGGTTCTCAACTGG - Intergenic
927290612 2:21401362-21401384 TTAAATCAGCAGCTCTCCATAGG - Intergenic
927539687 2:23897790-23897812 CTAGATTAGCATTTCTCCAAGGG + Intronic
927872766 2:26634023-26634045 CTAGCTTAGTAGTTCTCAACGGG + Intronic
929849931 2:45577134-45577156 CTAGAGCAGTGGTTCTCAATGGG + Intronic
932189572 2:69729435-69729457 ATAGAGCAGTGGTTCTCAATGGG + Intronic
932489045 2:72106843-72106865 CTAGATCAGTGGTTCTTGATGGG - Intergenic
933729327 2:85445289-85445311 CTGGCTCAGTTGTTCTCCCTGGG - Intergenic
935418243 2:102841193-102841215 CCAGATCAGTAGAGCTCCGTGGG - Intronic
936174622 2:110209009-110209031 CTAGAGCAGTAGTTTTCAACAGG - Intergenic
936740691 2:115503748-115503770 CTAGAGCAGTGTTTCTCCACTGG + Intronic
936937479 2:117852158-117852180 CTAGATCAATGGTTCTCAACTGG + Intergenic
937587746 2:123574682-123574704 CTGGATCAGTATTTCTCAACAGG + Intergenic
938925654 2:136039161-136039183 CGAAATCAGTAGTTCTCAACTGG - Intergenic
939293794 2:140230216-140230238 CTAGATCAGTAGTTCTGATCAGG + Intergenic
940584096 2:155622202-155622224 GTAGTTCAGTGGTTCTCAATAGG + Intergenic
940734383 2:157432658-157432680 CCAGATCCATGGTTCTCCATGGG - Intronic
940969952 2:159884839-159884861 CCAGAGCAGTGGTTCTCCAGGGG - Intronic
941766456 2:169302424-169302446 CTAAATCAGTGGTTCTCAACTGG + Intronic
942019870 2:171856432-171856454 CTAGAGCAGTGGTTCTCAATAGG - Intronic
942851559 2:180494141-180494163 CTAGCTCAGTTGTTGTTCATAGG - Intergenic
943008108 2:182411627-182411649 CTAAATCAATGGTTCTCAATTGG + Intronic
944543697 2:200778564-200778586 CTAGAACAGTGGTTCTCAACTGG + Intergenic
944773823 2:202941279-202941301 CTACTACAGTAGTTCTCAATTGG - Intronic
945005852 2:205405179-205405201 CTAGAACAGTGGTTCTCAATGGG + Intronic
945996472 2:216440956-216440978 TTAGATTGGTGGTTCTCCATGGG - Intronic
946431627 2:219629568-219629590 CTATGTCTGCAGTTCTCCATTGG + Exonic
948252117 2:236537528-236537550 TTTGAACAGCAGTTCTCCATTGG + Intergenic
948324166 2:237098547-237098569 CTTGCTCAGTATTTCTCCAAAGG - Exonic
948736088 2:240005992-240006014 CTAGATCATTAGGTCTCTCTAGG - Intronic
1170414097 20:16121762-16121784 CTTGTTCTGTATTTCTCCATTGG - Intergenic
1170934155 20:20795441-20795463 CTAGATCAGTGATTCTCCACTGG - Intergenic
1172179448 20:32992284-32992306 CTAAATCAGTGGTTCTCAATTGG - Intronic
1172879477 20:38190120-38190142 TTAAATCAGTAGTTCTCTAGGGG - Intergenic
1173862301 20:46292024-46292046 CTGGAGCAGTCATTCTCCATTGG - Intronic
1174603291 20:51741949-51741971 CTAGAGCAGGAGTTCTCAACTGG - Intronic
1174668895 20:52287113-52287135 CTATAGCAGTGGTTCTCAATGGG - Intergenic
1174754872 20:53148231-53148253 CTAGAACAGTGGTTCTCAACTGG + Intronic
1175454900 20:59105124-59105146 CTAAGTCAGTGGTCCTCCATGGG + Intergenic
1176672471 21:9747272-9747294 CTAGGCCAGTGGTTCTCCAACGG - Intergenic
1179070459 21:38066149-38066171 CTAGATCAGGGGTTCTCACTGGG + Intronic
1180618135 22:17141893-17141915 CCAGACCAGTGATTCTCCATGGG + Intronic
1182000642 22:26916868-26916890 CTGGGGCAGTTGTTCTCCATTGG - Intergenic
1182243698 22:28937689-28937711 CTAGATCAGTGGTTCTCAAAGGG - Intronic
1182886090 22:33775481-33775503 CTAAGTCAGTGGTTCTCAATAGG + Intronic
1183724756 22:39582290-39582312 CTATATCAGTGGTTTTCAATCGG + Intronic
1203293230 22_KI270736v1_random:15531-15553 CTAAATCAGAACTTCTCCTTGGG + Intergenic
949558141 3:5176817-5176839 CTACATCAGTGGTTCTCAATGGG + Intronic
950963137 3:17126472-17126494 CTAGATCAGTCATTCTCAACTGG - Intergenic
951048842 3:18071857-18071879 CTAAATCAGTACTTCTCAACTGG - Intronic
951685676 3:25341612-25341634 TTAAATCAGTAGTTCTCAACTGG + Intronic
952223926 3:31354109-31354131 CTAGAGCAGTGGTTCTCAACTGG + Intergenic
955531080 3:59873743-59873765 CTAGACCAGTGGTTCTCAGTTGG - Intronic
955709638 3:61764797-61764819 CTAGAGAAGTAGTTCTCAAGTGG + Intronic
955761770 3:62292617-62292639 TTAGAGCAGTAGTTCTCAATTGG + Intronic
955804817 3:62722988-62723010 CTAGATCAGTGGTTCTCAACTGG - Intronic
955981781 3:64534690-64534712 CTAAATCAGTGGTTCTCAACAGG + Intronic
958898262 3:99854700-99854722 ATAGATCAGTAGTTCTCAACTGG - Intronic
958991527 3:100851538-100851560 CTGGAGCAGTAGTTCTCAAATGG - Intronic
960022830 3:112974827-112974849 CTAGGTTAGCAGTTCTCCAAGGG + Exonic
960466347 3:118000321-118000343 CTAGACAAGTTGTACTCCATGGG - Intergenic
960705076 3:120473873-120473895 CTAGACCAGTGGTTCTCAACCGG - Intergenic
961661541 3:128471207-128471229 CTAAATCAGTGGTTCTCAACAGG + Intergenic
962034136 3:131632915-131632937 CTAGGTCAGTGGTTCTCCACTGG - Intronic
963438717 3:145308616-145308638 CTATATCAGTAGTCCAACATTGG + Intergenic
963883532 3:150554641-150554663 CTAGATCAGTGGTTCTTAAAGGG - Intronic
964593167 3:158389934-158389956 CTAAAACAATAGTTCTCAATGGG - Intronic
966825500 3:183961719-183961741 TTAGTTCAGTAGTTCTCTACAGG + Intronic
967174848 3:186853636-186853658 CTAGATCAAGAGTTCCCCAAAGG - Intronic
967718815 3:192793759-192793781 TTAGATATGTAATTCTCCATTGG + Intergenic
970874982 4:20858744-20858766 TTAGAGCAAAAGTTCTCCATAGG - Intronic
971265182 4:25090671-25090693 TTAGATCATTGGTTCTCCAAAGG - Intergenic
972126625 4:35774779-35774801 TCAGATAAATAGTTCTCCATTGG - Intergenic
973278949 4:48340225-48340247 CGTGATCAATAGTTCTCAATAGG - Intergenic
973988642 4:56380895-56380917 CTAAAGCAGTAGTTCTCAACTGG - Intronic
976516041 4:85967814-85967836 CTAGTTTAGTAGATCTTCATTGG + Intronic
977466402 4:97387338-97387360 CTCCTTCAGTAGCTCTCCATTGG + Intronic
977593536 4:98852672-98852694 CTAAATCAGTGGTTCTCAACTGG - Intergenic
977865627 4:102023588-102023610 CTAGCTCAGTGGATTTCCATTGG + Intronic
978742420 4:112152173-112152195 CTAAATCAGTGGTTCTCAACTGG + Intronic
980854735 4:138425450-138425472 CTAGAACAGTAGTTTGCCAAGGG + Intergenic
980857194 4:138454461-138454483 CTAGAGCAGTAATTCTTCACTGG - Intergenic
981435064 4:144710622-144710644 CTAGAACAGTGATTCTCAATGGG + Intronic
981715501 4:147747890-147747912 CTAGACCAGTGGTTCTCAAATGG + Intronic
983573367 4:169234118-169234140 CTAGAACAGTGGATCTCCACTGG + Intronic
983620314 4:169754687-169754709 CTAGAGCAGTGGTTCTCAACCGG + Intronic
985402259 4:189604559-189604581 CTAGGCCAGTGGTTCTCCAACGG + Intergenic
986732203 5:10643403-10643425 TTATATCAGTGGTTCTCGATGGG - Intronic
988897510 5:35693414-35693436 CTATATTAGTAGATCTCAATTGG + Intronic
989404909 5:41049632-41049654 GTTGGTCAGTATTTCTCCATGGG + Intronic
990371750 5:55126646-55126668 CTAAATCACTAGTTCTCAAAGGG + Intronic
990386616 5:55270175-55270197 CTAGACTAGTAGTTCTCAACTGG - Intronic
990516207 5:56533142-56533164 CTGGATCTGGAGTTCTGCATGGG + Exonic
991023710 5:62007752-62007774 CTAGATCAGTGTTTCTCAACTGG - Intergenic
992007342 5:72490816-72490838 CAAGTTCAGTAGTTCTCAACTGG - Intronic
992028556 5:72696589-72696611 CTAGGTCAGTGGTTCTCAATGGG - Intergenic
992807279 5:80350121-80350143 CTAGATTTGTAGTTAACCATTGG + Intergenic
993975896 5:94480231-94480253 CTAGAGGAATAGTTTTCCATTGG - Intronic
996547913 5:124700184-124700206 GAAGATCTGTAGTGCTCCATTGG - Intronic
997783126 5:136679854-136679876 TTAGAACAGTAGTTCTCAACTGG - Intergenic
998573327 5:143285303-143285325 ATAGATCAGTGGTTCTCAAAAGG + Intronic
998843174 5:146277964-146277986 CTAAAGCAGTGGTTCTCAATTGG - Intronic
998880149 5:146637253-146637275 CTAGATCAGTGGTTCTCAACTGG + Intronic
999057611 5:148596703-148596725 CTAGAGCAGTACTTCTCAACTGG - Intronic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
999840668 5:155422384-155422406 CTAGATCAGTTGTTCTCAACAGG - Intergenic
1000043226 5:157500720-157500742 CTGGAACAGAAGATCTCCATGGG + Intronic
1000398660 5:160802374-160802396 CTATATCAGTGGTTCTCAACTGG + Intronic
1000577391 5:162991183-162991205 CTAGATCAGTGGTTTTCAACTGG + Intergenic
1000986695 5:167868278-167868300 CTAGCTCAGTCATTCTCCACTGG - Intronic
1002720045 5:181253478-181253500 CTACATCAGTGGTTCTCAACTGG + Intergenic
1003444156 6:6169582-6169604 CTAGACTAGTAGTTGTCAATAGG + Intronic
1006954152 6:37852183-37852205 CTAGGTAAGTGGTTCTCCATGGG + Intronic
1007914906 6:45552374-45552396 CTAGCTAAGTGGTTCTCAATCGG - Intronic
1008401127 6:51064322-51064344 CTAGAATAGTAGTTCTCAACTGG - Intergenic
1008418235 6:51267876-51267898 CTAGTTCAGTGGTTCTGAATTGG - Intergenic
1008434106 6:51455023-51455045 CTAGATCACTAGTTCTTTACTGG + Intergenic
1010032284 6:71283837-71283859 CTAGGTCAGGAGCTCTCCCTAGG + Intergenic
1010046046 6:71445221-71445243 CTAGATCTCTATTTCTCAATAGG - Intergenic
1010392773 6:75356075-75356097 CTAGAACAGTGGTTCTCAATTGG - Intronic
1011026342 6:82873447-82873469 CTACATCAGTGGTTTTCCAGGGG + Intergenic
1011388095 6:86819499-86819521 CTAAATCAGTGGTTCTCAATTGG + Intergenic
1011552817 6:88545492-88545514 CTAGCTCAGTGGTTCTCAACAGG + Intergenic
1012272181 6:97226964-97226986 CTAGTTCAGTAGTTCTCAACTGG - Intronic
1012642774 6:101640796-101640818 CTAGATCAGTGATTCTCAAGTGG - Intronic
1014452201 6:121594366-121594388 CTAAACCAGAGGTTCTCCATCGG - Intergenic
1014491168 6:122063933-122063955 CTAGACCAGTGCTTCTCAATAGG + Intergenic
1016144756 6:140656024-140656046 CTAGATCAGTAGTTTGCCAGGGG + Intergenic
1016152719 6:140763560-140763582 CTAGATCAGGAGTTTGACATAGG + Intergenic
1016592478 6:145761852-145761874 CTAGAGCAGTGATTCTCAATAGG - Intergenic
1018591089 6:165423523-165423545 CTAGGTCAGTGCTTCTCAATAGG - Intronic
1019947545 7:4342029-4342051 CTGGAGCAGTGGTTCTCCACAGG + Intergenic
1020555171 7:9662012-9662034 CTAGTTCACTAGTTCACTATTGG - Intergenic
1021206144 7:17783472-17783494 CTAAATCAGTAGTTTTCAACTGG - Intergenic
1021248602 7:18295720-18295742 GTAGACCAGTAGTTCTCAACCGG + Intronic
1021792015 7:24215527-24215549 CTGGAGCAGTAGGTCTCTATAGG + Intergenic
1021799254 7:24287589-24287611 CTAAATCAGTGGTTCTCAACTGG + Intronic
1022769959 7:33459268-33459290 CTAGAGCTGTGGTTCTCAATTGG + Intronic
1022904480 7:34842538-34842560 TTAGAGCAGTGATTCTCCATTGG - Intronic
1023031896 7:36096892-36096914 CTAGGTCAGTAATTTTCCACTGG - Intergenic
1023666218 7:42526175-42526197 CTTTATCGATAGTTCTCCATGGG + Intergenic
1026427279 7:70308695-70308717 TTAGAACAGTAGTTCTCAACTGG + Intronic
1027346607 7:77266720-77266742 CTACACCAGCTGTTCTCCATAGG + Intronic
1027546505 7:79533319-79533341 CTAGTTCTGTGGTTCTCAATTGG - Intergenic
1028125140 7:87104298-87104320 CTAGATCAGTGATTCTCAAAGGG - Intergenic
1028243156 7:88445739-88445761 CTAGATCAGTGGTTCTTAGTGGG + Intergenic
1030045417 7:105490794-105490816 CTAGACCAGTGGTTCCCAATCGG + Intronic
1030266008 7:107622642-107622664 GTAAATCAGTAGTTCTCAACAGG + Exonic
1030899455 7:115104326-115104348 CTAGCTCCAGAGTTCTCCATAGG + Intergenic
1031192099 7:118565833-118565855 CTATATCAGTGGTTCTCCATTGG - Intergenic
1031425072 7:121595487-121595509 CTAGAGCAGTACTTCTCATTGGG - Intergenic
1032287480 7:130552032-130552054 CTAAAATATTAGTTCTCCATAGG - Intronic
1033166711 7:139045249-139045271 CTAGTTCAGTGGTTTTCAATGGG - Exonic
1033295521 7:140130798-140130820 TTAAATCAGTAGTTGTCAATGGG - Intronic
1036616314 8:10390380-10390402 CTAGGTCAGTGGTTCTCAACTGG - Intronic
1037408149 8:18565779-18565801 CTAAAGCAGTGGTTCTCAATAGG + Intronic
1037536151 8:19826692-19826714 CTAAGTCAGTGGTTCTCCACTGG + Intronic
1037576117 8:20204776-20204798 CTAGAACAGTAATTGTACATTGG + Intronic
1038034071 8:23672249-23672271 CTGGATGGGTAGTTTTCCATGGG - Intergenic
1039003211 8:33004952-33004974 CTACATAATTAGCTCTCCATAGG - Intergenic
1039075350 8:33685851-33685873 CTAGATTAGTAGTTCCACAGTGG - Intergenic
1042484645 8:69336823-69336845 CTAGAACAGCAGCTCCCCATGGG - Intergenic
1042662351 8:71168879-71168901 CTACATCAGTGGTTCTCAAAGGG + Intergenic
1042792693 8:72625847-72625869 GTAGAACACGAGTTCTCCATGGG + Intronic
1043291375 8:78605718-78605740 CTAGATCAGTGGTTCTAAAGTGG - Intergenic
1043838291 8:85069421-85069443 CTAGACCAGCAGTTCTCAAAGGG + Intergenic
1043943072 8:86218410-86218432 ATAGACCAGTAATTCTCAATTGG + Intronic
1046608864 8:116402254-116402276 CTTGACCAGTGGTTCTCAATTGG - Intergenic
1047318806 8:123759363-123759385 CTAAACCAGTAGTTCTCAACTGG - Intergenic
1047889334 8:129290615-129290637 CTAATTCAGTAGTTTTCCATCGG - Intergenic
1050732217 9:8721936-8721958 CAACATCAGTGGTTCTCAATTGG + Intronic
1051235696 9:14996289-14996311 CTAGAGCAGTGGTTCTCAACTGG - Intergenic
1052303883 9:26983380-26983402 CTAGAGCAGTGGTTCTCAACTGG + Intronic
1052468308 9:28858390-28858412 TTAGATCAGTAGTTCTACATTGG - Intergenic
1053275216 9:36778167-36778189 CTAGAGTAGTAGTACTCCAGAGG - Intergenic
1053553850 9:39113217-39113239 TTAAAGCAGTAGTTCTCAATCGG - Intronic
1053817959 9:41933372-41933394 TTAAAGCAGTAGTTCTCAATCGG - Intronic
1054108212 9:61077034-61077056 TTAAAGCAGTAGTTCTCAATCGG - Intergenic
1054612645 9:67254091-67254113 TTAAAGCAGTAGTTCTCAATCGG + Intergenic
1055565624 9:77565916-77565938 ATACATCAGTTGTTCTCAATGGG + Intronic
1056261287 9:84851199-84851221 CTAGGTCAGTGGTTCTCAAACGG - Intronic
1057734235 9:97638873-97638895 CTACAGCAGTAGTTCTCAACAGG - Intronic
1057879616 9:98783215-98783237 CTAAATCAGGACATCTCCATTGG + Intronic
1057998743 9:99844221-99844243 CTGGGGCAGTAGTTCTCAATTGG + Intronic
1058428324 9:104895539-104895561 CTAGAGCAGTGGTTCTCGACCGG - Intronic
1059135491 9:111802883-111802905 CTAGACCAGTGGTTCTCAATTGG + Intergenic
1059396456 9:114037018-114037040 CTAGAGCAGTGGTTCTCAAAGGG - Intronic
1060126552 9:121053369-121053391 CTACTTCAGTAACTCTCCATGGG + Intergenic
1060633683 9:125182854-125182876 CTAGACCAGTCGTTCTCAACTGG - Intronic
1185718663 X:2364198-2364220 CTACATCAGTGGTTTTCCATTGG + Intronic
1186075545 X:5874618-5874640 TTAAATCAGTAGTTCCCCAGTGG + Intronic
1186601284 X:11040495-11040517 CTAGCTCAGTGGTTCTCAACTGG + Intergenic
1186821993 X:13298330-13298352 ATAGATCAGTGGTTCTCAACTGG - Intergenic
1187007168 X:15243828-15243850 CTAGTTCAGTGGTTCTCCACTGG - Intronic
1187354611 X:18555277-18555299 CTAGTTCAATAGTTCTCCCTTGG - Intronic
1187387074 X:18858733-18858755 ATAGATCAGTATCTCTACATAGG - Intergenic
1188604845 X:32015560-32015582 CTAGAGTAGTAGTTCTCAAAGGG - Intronic
1188968001 X:36578852-36578874 CTAGATCATTAGATCTTCAAGGG - Intergenic
1189104657 X:38222765-38222787 CTAAAGAAGTAGTTCTCTATTGG - Intronic
1189162557 X:38825311-38825333 CTACACCAGTAGTTCTCGACTGG - Intergenic
1189719031 X:43896004-43896026 CTAGAGCAGTGGTTCTCAATAGG - Intergenic
1190311503 X:49120077-49120099 CTAGATCAGAAGCTCTGCAGGGG - Intronic
1191869038 X:65729795-65729817 CCAGATCTGTTCTTCTCCATTGG + Intronic
1192233256 X:69280082-69280104 CTAGACCAGGAGTTCTCCGAGGG + Intergenic
1193501084 X:82275756-82275778 CCTGAGCAGAAGTTCTCCATGGG + Intergenic
1195281560 X:103339668-103339690 CTAGATCAGGCGTTCTCAACTGG - Intergenic
1195537535 X:106025915-106025937 CTAAGACAGTAGTTCTCAATGGG + Intergenic
1195641666 X:107182374-107182396 CTAGTTCAGTAGTTCTCAGCTGG - Intronic
1195778820 X:108438353-108438375 CTAGATAAGAAGTGCTCCAAAGG + Intronic
1196165079 X:112529875-112529897 CTAGAGCAGTAGTTCTCAATGGG + Intergenic
1196709408 X:118746819-118746841 ATAGATCAGTGATTCTCAATTGG - Intronic
1197004362 X:121478824-121478846 CTAAATCAGTGTTTCTCAATAGG + Intergenic
1197189259 X:123627401-123627423 CAAGAGCAGTAGTTCTCAAGAGG - Intronic
1199201433 X:145094669-145094691 CTAGAATAGTAGTTCTCAACTGG + Intergenic
1199675489 X:150185749-150185771 CTAAATCAGTAGGTCTTCAGTGG - Intergenic
1199938889 X:152604818-152604840 CTAGATCAGTTGTTCAACCTTGG - Intergenic