ID: 1078570049

View in Genome Browser
Species Human (GRCh38)
Location 11:12449807-12449829
Sequence CAGGATAATCCCTTGTTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 768
Summary {0: 1, 1: 2, 2: 13, 3: 136, 4: 616}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078570049 Original CRISPR CAGGATAATCCCTTGTTGTG GGG (reversed) Intronic
901591425 1:10346832-10346854 CTGGATAATTCTCTGTTGTGAGG + Intronic
902063388 1:13664212-13664234 CTGGATACTTCCTTGTTGTGGGG + Intergenic
902158778 1:14512310-14512332 CTGGATCATTCTTTGTTGTGGGG + Intergenic
902171193 1:14612667-14612689 CCAGATAATTCTTTGTTGTGGGG + Intronic
902261398 1:15227389-15227411 CAGGATAATTCTCTGCTGTGGGG - Intergenic
902341828 1:15788495-15788517 CAGGAGAATCCCTTGTACTTGGG + Intergenic
903469584 1:23576662-23576684 CTGGATAATTCTTTGTTGTGAGG + Intergenic
903516650 1:23915778-23915800 CTGGATAATTCCTTGCTGTAGGG - Intergenic
903948499 1:26979696-26979718 CAGGATAATCACTTGAACTGGGG + Intergenic
904899381 1:33844406-33844428 CTGGATAATTCTTTGTTGTGAGG - Intronic
905138045 1:35815708-35815730 CTGGGTAATTCTTTGTTGTGGGG + Intronic
905187820 1:36209373-36209395 CAGGATTATTCTTCGTTGTGAGG + Intergenic
905784143 1:40739440-40739462 CCAGATAATTCTTTGTTGTGAGG + Intronic
905959437 1:42031484-42031506 CTGAATAATTCTTTGTTGTGGGG + Intronic
906203216 1:43972935-43972957 CCAGATAATTCTTTGTTGTGGGG + Exonic
906259096 1:44372843-44372865 CTGGATAATTCCTTGTTAGGGGG - Intergenic
906721021 1:48004638-48004660 CAGGATAATTCTTTGTTGTGAGG - Intergenic
906905859 1:49891509-49891531 CCAGATAATTCTTTGTTGTGGGG - Intronic
907190767 1:52646213-52646235 CCAGATAATTCTTTGTTGTGAGG - Intronic
907879171 1:58528634-58528656 CTGGATAATTCTTTGTTGTGGGG - Intronic
907976128 1:59433138-59433160 CCAGATAATTCTTTGTTGTGGGG + Intronic
908134548 1:61117025-61117047 AAGGATAGTCTCTTGTTGAGAGG + Intronic
908191889 1:61712203-61712225 CTGGGTAATTCATTGTTGTGGGG - Intronic
908263712 1:62358653-62358675 CAGGAGAATCCCTTGAACTGGGG + Intergenic
908456334 1:64308370-64308392 CTGCATAATTCTTTGTTGTGAGG - Intergenic
908562923 1:65324869-65324891 CAGGAAAGTTCTTTGTTGTGAGG - Intronic
908565362 1:65350004-65350026 TTGGATAATTCTTTGTTGTGGGG - Intronic
909130951 1:71736693-71736715 CAGGATATTACCTTGTGATGAGG + Intronic
909892864 1:81029605-81029627 CAAGATAATTCCTTGTTATGGGG - Intergenic
909947037 1:81675672-81675694 CAGGAGAATCCCTTGAGCTGGGG - Intronic
910164193 1:84306736-84306758 CAGGAGAATCCCTTGAACTGGGG + Intronic
910423498 1:87096597-87096619 CCAGATAATTCTTTGTTGTGGGG + Intronic
910509603 1:87988844-87988866 CTAGATAATTCTTTGTTGTGAGG - Intergenic
910764720 1:90770202-90770224 CCAGATAATTCTTTGTTGTGGGG + Intergenic
911663598 1:100530416-100530438 CTGGATAATTCTTTATTGTGAGG + Intergenic
911711027 1:101073278-101073300 CCAGATAATTCTTTGTTGTGCGG + Intergenic
911927527 1:103853395-103853417 CAGGAGAATTGCTTGATGTGAGG + Intergenic
912659917 1:111518371-111518393 CTGGATAACTCTTTGTTGTGAGG + Intronic
912923479 1:113892178-113892200 CCAGATAATTCTTTGTTGTGAGG - Intergenic
913370001 1:118087832-118087854 CTAGATAATTACTTGTTGTGGGG + Intronic
913411882 1:118561331-118561353 CTGGACAATTCTTTGTTGTGGGG + Intergenic
914710052 1:150204988-150205010 CAGGAGAATCCCTTGAACTGAGG - Intergenic
915362909 1:155296433-155296455 CAGGATAATCACTTGAACTGGGG - Intronic
915926149 1:160021181-160021203 CCAGATAATTCTTTGTTGTGGGG + Intergenic
915947250 1:160162548-160162570 CTGGATAATTCTTTGTTGTGCGG + Intronic
916125656 1:161568649-161568671 CCAGATAATTCTTTGTTGTGGGG + Intergenic
916135571 1:161650480-161650502 CCAGATAATTCTTTGTTGTGGGG + Intronic
916212573 1:162370840-162370862 CTGGATGATTCTTTGTTGTGGGG - Intronic
916280682 1:163047974-163047996 CAGGAGAATTCTTTGTTGTGGGG + Intergenic
917043145 1:170828721-170828743 CCAGATAATTCCTTGTTGTGAGG + Intergenic
917379948 1:174395009-174395031 CAAGATGATCCATTGGTGTGTGG + Intronic
917657052 1:177136931-177136953 CCTGATAATCCTTTGTTGTGTGG + Intronic
918722112 1:187866272-187866294 TGGGATAATTCTTTGTTGTGGGG + Intergenic
919073907 1:192790980-192791002 CAGGAGAATCACTTGTGGTCAGG - Intergenic
919266565 1:195274916-195274938 CAGGATAATCGCTTGAACTGGGG - Intergenic
920008049 1:202847675-202847697 CAGGATAATTCTTTGTGGTGTGG + Intergenic
920104405 1:203541095-203541117 CTGGATAATTCTTTGTTGTGGGG + Intergenic
920114794 1:203612763-203612785 CAGGATAATCTCTTGAACTGGGG + Intergenic
920193646 1:204211899-204211921 CAGGATAATTCTTTGTTGTGGGG - Intronic
920723062 1:208406653-208406675 CCTGATAATTCTTTGTTGTGGGG + Intergenic
921188645 1:212691033-212691055 CAGCATAATTCCTTGTTGTTGGG - Intronic
921708537 1:218350454-218350476 CAGGATAATTCTTTGATGTTGGG - Intronic
921734254 1:218608915-218608937 CTAGATAATTCTTTGTTGTGGGG - Intergenic
921873555 1:220168488-220168510 CAGGATAATCCCTTGTACCTGGG - Intronic
922540147 1:226412874-226412896 CAGGAGAATCCCTTGATCTTGGG + Intergenic
923899425 1:238309745-238309767 CTGGGTAATTCTTTGTTGTGGGG + Intergenic
924012767 1:239684303-239684325 CTGGATAATTCTTTGTTGTGGGG - Intronic
924197752 1:241625842-241625864 CTGGATAATTCTTTGTTATGAGG + Intronic
924520039 1:244798089-244798111 CCGGATAATTCTTTGTGGTGGGG - Intergenic
924953296 1:248905719-248905741 CTGGATAATTCTTTGTTGAGAGG - Intergenic
1063270711 10:4507645-4507667 CAGGATCATTCTTTGTTGAGGGG - Intergenic
1065337080 10:24663828-24663850 CCAGATAATTCTTTGTTGTGGGG + Intronic
1065477635 10:26157999-26158021 CTGGATAATTCTTTGTTGTGGGG - Intronic
1065505949 10:26430439-26430461 CAGGAGAATCCCTTGAGCTGGGG - Intergenic
1066341889 10:34542456-34542478 CTGGATTATTCTTTGTTGTGTGG - Intronic
1067361239 10:45581262-45581284 TTGGATAATTCTTTGTTGTGGGG - Intronic
1067372153 10:45695078-45695100 CTAGATAATGCTTTGTTGTGAGG + Intergenic
1067387627 10:45831066-45831088 CTAGATAATGCTTTGTTGTGAGG - Intronic
1067418501 10:46126205-46126227 CTAGATAATGCTTTGTTGTGAGG + Intergenic
1067446648 10:46353547-46353569 CTAGATAATGCTTTGTTGTGAGG + Intergenic
1067503854 10:46832782-46832804 CTAGATAATGCTTTGTTGTGAGG + Intergenic
1067590735 10:47507220-47507242 CTAGATAATGCTTTGTTGTGAGG - Intronic
1067637854 10:48015319-48015341 CTAGATAATGCTTTGTTGTGAGG - Intergenic
1067776513 10:49168294-49168316 CAGGAGATTCCCTGGCTGTGTGG - Intronic
1067875636 10:50005026-50005048 CTAGATAATGCTTTGTTGTGAGG + Intronic
1067917237 10:50413545-50413567 CAGGATAACTCTTTGCTGTGGGG + Intronic
1068486376 10:57664525-57664547 AAGGACAATCCCTTGAAGTGAGG + Intergenic
1068693219 10:59939364-59939386 CTGAATAACTCCTTGTTGTGGGG + Intergenic
1068780412 10:60913701-60913723 CTGGGTAATTCTTTGTTGTGGGG - Intronic
1069226360 10:65949968-65949990 CTGGATAATTCTTTGTTGTGGGG - Intronic
1069447565 10:68487564-68487586 TTGGATCATCCTTTGTTGTGGGG + Intronic
1069525656 10:69168305-69168327 CTGAATAATTCTTTGTTGTGGGG - Intronic
1069692565 10:70363609-70363631 CTGGATAATTCTTTGTTCTGGGG - Intronic
1069956998 10:72058046-72058068 CAGGAGAATCGCTTGAAGTGGGG + Intergenic
1070013760 10:72503519-72503541 CAGGATAATTCATTATTGTGAGG - Intronic
1070195588 10:74153366-74153388 CCAGATAATTCTTTGTTGTGGGG - Intronic
1070247852 10:74748809-74748831 CAGAATAATCCCTGGAAGTGGGG - Intergenic
1070371856 10:75790147-75790169 CTGGATAATTCTGTGTTGTGGGG + Intronic
1071599833 10:86953679-86953701 CTAGATAATTCCTTGTGGTGGGG - Intronic
1071607268 10:87004666-87004688 CTAGATAATGCTTTGTTGTGAGG + Intergenic
1072033928 10:91546993-91547015 CAGGATAATCACTTGAACTGAGG + Intergenic
1072248359 10:93562598-93562620 CTGGACAATTCTTTGTTGTGGGG + Intergenic
1072739925 10:97903201-97903223 CTGGATAATCCTTTGTTGTGGGG + Intronic
1073155887 10:101346527-101346549 CTGGACAATTCTTTGTTGTGGGG + Intergenic
1073161015 10:101395149-101395171 CAGGAAAATCCCTCTGTGTGAGG - Intronic
1073524580 10:104168132-104168154 CTGGATCATTTCTTGTTGTGGGG - Intronic
1073564923 10:104526750-104526772 CAGGATGAGCCCATGTTATGGGG + Intergenic
1073686410 10:105759245-105759267 CTGGATCATTCTTTGTTGTGGGG - Intergenic
1074271586 10:111958961-111958983 CAGGATAAATATTTGTTGTGGGG - Intergenic
1074580763 10:114717428-114717450 CTGGATAATATCTTGTTTTGGGG + Intergenic
1074893224 10:117752401-117752423 CAGGACAGTCCCCGGTTGTGTGG - Intergenic
1074930369 10:118119008-118119030 GGGGATAATTCTTTGTTGTGGGG + Intergenic
1075018144 10:118926312-118926334 CAGGATCATTCCTATTTGTGGGG + Intergenic
1075234541 10:120714854-120714876 CTGGATAACTCCATGTTGTGGGG - Intergenic
1075363847 10:121864918-121864940 CTGGATAATTCTTTGTTGTGAGG - Intronic
1075382416 10:122030077-122030099 CTGGATAATTCTTTATTGTGGGG - Intronic
1075449274 10:122537606-122537628 CAGGAGAATCACTTGATGGGAGG + Intergenic
1075789054 10:125070256-125070278 CAGGAGAATCCCTTGAACTGGGG + Intronic
1078075183 11:8152361-8152383 CTGGATAATACTGTGTTGTGTGG - Intronic
1078372504 11:10761085-10761107 CTGGATAATTCTTTGTTGTGGGG + Intronic
1078489627 11:11757145-11757167 CCAGATAATTCCTTATTGTGAGG + Intergenic
1078570049 11:12449807-12449829 CAGGATAATCCCTTGTTGTGGGG - Intronic
1079468816 11:20758682-20758704 CTAGATAATTCTTTGTTGTGGGG + Intronic
1079906924 11:26260125-26260147 CAGAATTATCCCTTTGTGTGGGG - Intergenic
1080101554 11:28465765-28465787 CTAGATAATTCTTTGTTGTGGGG + Intergenic
1080459900 11:32445297-32445319 CTGGATAATTCTTTGTTCTGGGG - Intergenic
1080494586 11:32804229-32804251 CAGGATAATCACTTGATCTTGGG - Intergenic
1080837024 11:35948800-35948822 CTGGATAGTTCTTTGTTGTGGGG + Intronic
1081314610 11:41616575-41616597 CAGGATAATCCCTTGAACTAAGG - Intergenic
1081531979 11:43968165-43968187 CTAGATAATTCTTTGTTGTGGGG - Intergenic
1081846954 11:46247547-46247569 CTGGATGATTCTTTGTTGTGGGG + Intergenic
1081938683 11:46922197-46922219 ATGGATAATTCTTTGTTGTGGGG - Intergenic
1082808924 11:57466917-57466939 CCGGATAGTTCCTCGTTGTGGGG - Intronic
1083121658 11:60519291-60519313 CTGGATAATTCTTTGTTGTGAGG - Intronic
1083362700 11:62122228-62122250 CCGGGTAATTCCTTGCTGTGGGG + Intergenic
1083599211 11:63936288-63936310 CAGGAGAATCACTTGAAGTGGGG - Intergenic
1085257922 11:75187033-75187055 CATAATAATCCCTTTTTGTCAGG - Intronic
1085375745 11:76059634-76059656 CTGGATAATTCTTTGTTGTGGGG - Intronic
1085555840 11:77420891-77420913 CAGGATAATTCTTTGTTATGAGG - Intronic
1086029357 11:82335127-82335149 CTGAATAATTCTTTGTTGTGAGG - Intergenic
1086346157 11:85899419-85899441 CCAGATAATTCTTTGTTGTGAGG + Intronic
1086498363 11:87426843-87426865 CCAGATAATTCTTTGTTGTGGGG - Intergenic
1086945160 11:92837479-92837501 CTGGATAATTCTTTGTTGTTGGG - Intronic
1087006902 11:93479974-93479996 CAGGAGAATCCCAGGTTGAGTGG - Intronic
1087721471 11:101670669-101670691 CCAGATAATTCTTTGTTGTGGGG - Intronic
1088396862 11:109378642-109378664 CTGAATAATTCCTTGTTATGGGG - Intergenic
1088611471 11:111581414-111581436 CTGGATAATTCTTTGTTGTTGGG - Intergenic
1089395546 11:118134476-118134498 CAGGATGATTCTTTGTTGTGGGG + Exonic
1089741660 11:120588705-120588727 CCGCACAATTCCTTGTTGTGGGG + Intronic
1090231412 11:125108832-125108854 CAGGACAATTCTTCGTTGTGAGG + Intronic
1090469528 11:126967877-126967899 CAGGGTAATTCTTTGTTGTGAGG - Intronic
1090904243 11:131060441-131060463 CAGGAAAATTCTTTGTTGTGTGG - Intergenic
1090998815 11:131891141-131891163 CAAGCTAATCCCTTGTAGGGAGG + Intronic
1091428500 12:412495-412517 CTGGATGATTCTTTGTTGTGAGG + Intronic
1092466081 12:8733212-8733234 CAGAATAATTCTTTGTTGTTGGG - Intronic
1093190333 12:16067061-16067083 CAGAATAATATTTTGTTGTGTGG + Intergenic
1094261623 12:28507319-28507341 CCAGATAATTCTTTGTTGTGGGG + Intronic
1096031669 12:48421620-48421642 CAGGATAATCGCTTGAACTGGGG - Intergenic
1096033441 12:48441935-48441957 TAGGATAATTCCTTGATGTCAGG - Intergenic
1096084496 12:48856698-48856720 CTGGATAATGCTTTGTTGTGAGG - Intergenic
1096322843 12:50630762-50630784 CAGGATAATCGCTTGAACTGGGG - Intronic
1096970271 12:55659895-55659917 CCAGATAATTCTTTGTTGTGGGG + Intergenic
1098228442 12:68348546-68348568 CTGGATGATCCCTTGATGTCTGG + Intergenic
1098240296 12:68460398-68460420 CCAGATAATTCTTTGTTGTGGGG + Intergenic
1098375920 12:69814504-69814526 CTGGATAATTCTTTGTTGTGGGG + Intronic
1098596851 12:72282969-72282991 CTGGATAATTATTTGTTGTGGGG - Intronic
1099407088 12:82277737-82277759 CAGCAAAATGACTTGTTGTGGGG - Intronic
1099484606 12:83213302-83213324 CCAGATAATTCCTTGTTGTGAGG + Intergenic
1099716821 12:86305344-86305366 CAGGAGAATCCCTTGAACTGAGG + Intronic
1099827921 12:87802377-87802399 CTGGATAATTCTTTGTTGTGAGG - Intergenic
1100192357 12:92206176-92206198 TCAGATAATCCTTTGTTGTGAGG - Intergenic
1100641058 12:96482665-96482687 CAGGAGAATCCCTTGAACTGGGG + Intergenic
1100682044 12:96935569-96935591 CTGGGTAATTCTTTGTTGTGAGG + Intronic
1101063394 12:100994998-100995020 CTGGATAATTTTTTGTTGTGGGG - Intronic
1101304614 12:103515072-103515094 CTGGATAATTCTTTGTTGTGTGG - Intergenic
1101343264 12:103861815-103861837 CTGGATAAATCTTTGTTGTGGGG + Intergenic
1101779259 12:107821196-107821218 CATTATAATTCCTTGTAGTGAGG + Intergenic
1102227328 12:111237900-111237922 CTGGATGATTCCTTGTGGTGGGG + Intronic
1102908696 12:116696519-116696541 CTGGATAATTCTTTGTTGCGGGG - Intergenic
1102955366 12:117055232-117055254 CAGGATAATCCCTTGAACTCGGG - Intronic
1103025478 12:117570399-117570421 CCAGATAATTCTTTGTTGTGGGG - Intronic
1103289261 12:119830751-119830773 CTGAATAATTCTTTGTTGTGGGG - Intronic
1103299372 12:119916400-119916422 CTAGATAATTCCTTGTTGTGGGG + Intergenic
1103620688 12:122185379-122185401 CAGGAGAATCACTTGAGGTGGGG + Intronic
1103843592 12:123885686-123885708 TAGCATAATCCTTTGTGGTGGGG - Intronic
1105521186 13:21132132-21132154 CAGGAGAATCACTTGAAGTGTGG + Intergenic
1106080597 13:26497394-26497416 CTGGATAATTGTTTGTTGTGAGG - Intergenic
1106399531 13:29416006-29416028 CAGGAGAATCACTTGATGGGAGG - Intronic
1107164722 13:37270960-37270982 CCAGATAATCCTTTGTTATGAGG - Intergenic
1107352250 13:39528072-39528094 CAGCAAAAGCCCTTCTTGTGAGG - Intronic
1107713301 13:43172097-43172119 TAGGATAATTCTTTGTTGTATGG - Intergenic
1108615416 13:52128048-52128070 CGGGGTAATCCTTTATTGTGCGG - Intronic
1108766759 13:53640531-53640553 CTGGGTAATTCTTTGTTGTGGGG - Intergenic
1108915742 13:55608763-55608785 CAGGATTATTCTTTGTTGTGAGG - Intergenic
1109199400 13:59413761-59413783 TAGGATAATTCGTTGTCGTGAGG - Intergenic
1109298409 13:60563523-60563545 CTGGATAATTTTTTGTTGTGTGG + Intronic
1109855452 13:68120949-68120971 TAGTATAAACCATTGTTGTGTGG - Intergenic
1110491074 13:76108662-76108684 CTGGATAATTCTATGTTGTGAGG - Intergenic
1110622736 13:77616961-77616983 CAGCATAACCCCTTGTTTTAAGG - Intronic
1111019684 13:82432447-82432469 CAGGAGAATCACTTGTTTTGAGG - Intergenic
1111664448 13:91249415-91249437 CCCGATAATTCTTTGTTGTGGGG + Intergenic
1112392082 13:98994444-98994466 CTGGATAATTCTTTGTTGAGGGG - Intronic
1112677226 13:101716038-101716060 CTGGATAATTCCTTGTTTGGGGG - Exonic
1112695471 13:101943513-101943535 CTGGATAATACTTTGTTGTGAGG - Intronic
1112729903 13:102349135-102349157 CTGGAGAATTCTTTGTTGTGGGG - Intronic
1113229608 13:108197741-108197763 CTGGATAATTCCTGTTTGTGGGG + Intergenic
1114005634 14:18310210-18310232 CAAGAAAATCCCTTGATCTGGGG + Intergenic
1114475927 14:22994834-22994856 CTGGATAATTCTTTGTTATGGGG + Intronic
1114664818 14:24371335-24371357 CAGGATAATTCTTTGTTATGTGG + Intronic
1115152068 14:30297332-30297354 CTGGATAATTCTTTGTTATGGGG + Intergenic
1116296429 14:43117795-43117817 CAGGAGAATCGCTTGATCTGGGG + Intergenic
1116459056 14:45149937-45149959 CCAGATAATTCTTTGTTGTGGGG - Intronic
1117109237 14:52431610-52431632 CAGGATAATTCTTTGTTGTGGGG + Exonic
1117484306 14:56178586-56178608 CTGGATAATGCTTTGTTGTGAGG + Intronic
1117777732 14:59199761-59199783 CTGGATAATTATTTGTTGTGAGG + Intronic
1117962589 14:61177960-61177982 CAGGATGATTCTTTTTTGTGTGG + Intergenic
1118673927 14:68162009-68162031 CTGGGTAATTCTTTGTTGTGAGG - Intronic
1118777538 14:68982478-68982500 CTGGATAATTCTTTGTTGTGGGG - Intergenic
1118883894 14:69850960-69850982 CTGGATAATTCTTTGTTGTGGGG + Intergenic
1119055268 14:71413055-71413077 CAGGATAATTCTTTGTTGGAGGG + Intronic
1119084022 14:71723250-71723272 CACCACAATCCCTAGTTGTGAGG + Intronic
1119580929 14:75780251-75780273 CAGGAGAATTCTTTGTCGTGTGG + Intronic
1119591508 14:75892622-75892644 CTGGATAATTCTTTGTAGTGAGG - Intronic
1119798956 14:77425669-77425691 CAGGATAATCCTTTGTTGTGGGG + Intergenic
1119821942 14:77623989-77624011 CAGGAGAATCACTTGAAGTGGGG + Intergenic
1120267383 14:82268501-82268523 CCAGATAATTCCTTGTTGTGAGG + Intergenic
1120354913 14:83419949-83419971 CTGGATCATCTTTTGTTGTGGGG + Intergenic
1120628692 14:86861339-86861361 CAGGATAACTCTTGGTTGTGGGG + Intergenic
1121080564 14:91104465-91104487 CCAGATAATTCCATGTTGTGGGG - Intronic
1121238950 14:92414172-92414194 CTGGATAATTCTTTGTTGTAGGG + Intronic
1121883587 14:97522647-97522669 CAGGATCATCCCTTATTGAAGGG + Intergenic
1122045708 14:99021673-99021695 CCGGATGCTCCCTTGTTGTGGGG + Intergenic
1122817858 14:104322402-104322424 CAGGAGAATCGCTTGAAGTGGGG + Intergenic
1124241465 15:28031635-28031657 CTGGATAATTCTTTGTGGTGGGG + Intronic
1124420932 15:29521162-29521184 CTGGATAATTCTTTGTTGTGGGG - Intronic
1124474859 15:30024384-30024406 CTGGATAATTCTTTGTTGAGGGG + Intergenic
1125076350 15:35623343-35623365 CAGGAGAATCCCTTGAAGTAGGG + Intergenic
1125080239 15:35664276-35664298 TCAGATAATTCCTTGTTGTGAGG + Intergenic
1125449773 15:39796115-39796137 CCAGATAATTCTTTGTTGTGAGG + Intergenic
1125873651 15:43124939-43124961 CAGGAGAATCCCTTGAGGTCAGG - Intronic
1125929109 15:43587195-43587217 CTGGATAATTCTTGGTTGTGAGG - Intronic
1125942276 15:43687027-43687049 CTGGATAATTCTTGGTTGTGAGG - Intergenic
1126006814 15:44265851-44265873 CTAGATAATTCTTTGTTGTGCGG + Intergenic
1126737225 15:51742728-51742750 CAGGAGAATCCCTTGAGGTCAGG + Intronic
1127058031 15:55152482-55152504 CTGGATAATTCTTTGTTGTGGGG - Intergenic
1127376662 15:58391430-58391452 TAGGATAATCCTATGTTGTGGGG - Intronic
1127395557 15:58541625-58541647 CCAGAGAATTCCTTGTTGTGGGG - Intronic
1127799588 15:62466376-62466398 CTGGATGATTCTTTGTTGTGCGG + Intronic
1127990613 15:64113281-64113303 CTGGATAATTCTTTGTTGAGGGG + Intronic
1128476603 15:68002192-68002214 CTGGATAATCGTTTGTTATGAGG - Intergenic
1128670245 15:69569355-69569377 GAAGATAATACCTTGTTTTGAGG + Intergenic
1128709581 15:69861627-69861649 CTGAATAATCCTTTGCTGTGAGG + Intergenic
1128855662 15:71011950-71011972 CCAGATAATTCTTTGTTGTGGGG + Intronic
1129728850 15:77918068-77918090 CAGGAGAATCACTTGATGTCAGG - Intergenic
1129876694 15:78980022-78980044 CAGGATGATCCTTTGTTGAGGGG - Intronic
1130063613 15:80587263-80587285 CTGGATAATTCTTTGTTGTGGGG + Intronic
1130364033 15:83217242-83217264 CAGGAGAATTCTTTGTTGGGTGG - Intergenic
1130369507 15:83272836-83272858 CTGGATAATGCTTTGTAGTGGGG + Intronic
1130748278 15:86680657-86680679 CAGGATAATCCCTTGTACCCAGG - Intronic
1130920007 15:88335879-88335901 CTGGGTAATTCCTGGTTGTGGGG - Intergenic
1131018987 15:89082002-89082024 TGGGATAATTCTTTGTTGTGGGG + Intergenic
1132011929 15:98283804-98283826 CCTGATCATTCCTTGTTGTGGGG + Intergenic
1133654839 16:7851129-7851151 CAGGAGAATCGCTTGATCTGGGG - Intergenic
1133968172 16:10546796-10546818 CTGGATAATCCTTTGTTGTAGGG - Intronic
1133995691 16:10746341-10746363 CAGGATCACTCTTTGTTGTGGGG + Intronic
1134027260 16:10963887-10963909 CTGGGTAATTCCCTGTTGTGGGG - Intronic
1134197456 16:12170044-12170066 CTGGATAATCCTTTGTAGTGGGG + Intronic
1134317468 16:13132467-13132489 CTGGATAATTCTTTGCTGTGGGG + Intronic
1134363307 16:13552949-13552971 CCAGATAATCGTTTGTTGTGGGG + Intergenic
1134397028 16:13874477-13874499 CTGGATAATTCCTTGTCCTGGGG - Intergenic
1134503322 16:14785960-14785982 CTGAATAATTCTTTGTTGTGGGG - Intronic
1134577246 16:15342938-15342960 CTGAATAATTCTTTGTTGTGGGG + Intergenic
1134725198 16:16413555-16413577 CTGAATAATTCTTTGTTGTGGGG - Intergenic
1134761348 16:16717838-16717860 CAGGAGAATCCCTTGATCTCGGG - Intergenic
1134764391 16:16743951-16743973 CTGGATGATCCTTTGTTGTGCGG + Intergenic
1134833667 16:17344185-17344207 CAGGATTATTCTTTGTTGTGAGG - Intronic
1134942234 16:18298303-18298325 CTGAATAATTCTTTGTTGTGGGG + Intergenic
1134981667 16:18615263-18615285 CTGGATGATCCTTTGTTGTGCGG - Intergenic
1134984711 16:18641332-18641354 CAGGAGAATCCCTTGATCTCGGG + Intergenic
1135173371 16:20206639-20206661 CTGGATAATTCTTTGTTGTACGG + Intergenic
1135389341 16:22076493-22076515 CCAGATAATTCTTTGTTGTGGGG - Intronic
1136053895 16:27673565-27673587 CTGGATCATTCTTTGTTGTGGGG + Intronic
1136147005 16:28321709-28321731 CAGGACAATCCCTTGTGGTTAGG - Exonic
1137269135 16:46891494-46891516 CAGGGTAATCCCTTGAAGTCAGG - Intronic
1137277420 16:46945080-46945102 CAGGAGAATCGCTTGAAGTGGGG + Intergenic
1138197388 16:55061517-55061539 CCAAATAATTCCTTGTTGTGGGG + Intergenic
1138676673 16:58656389-58656411 CAGGAGAATCCCTTGAACTGGGG + Intergenic
1138693865 16:58793132-58793154 CTGGGTAATTCCTTGTAGTGGGG + Intergenic
1139270967 16:65682186-65682208 TTGGATAATTCTTTGTTGTGGGG - Intergenic
1139718803 16:68836297-68836319 CTGGATAATTCTTTGTTGTGAGG - Intergenic
1139729322 16:68929144-68929166 CAGGTGAATCACTTGATGTGAGG - Intronic
1140226902 16:73085349-73085371 CAGGAGAATCACTTGCTGGGAGG - Intergenic
1140252966 16:73310624-73310646 CTGGATAATTCGTTGTTGTGAGG - Intergenic
1140789431 16:78376611-78376633 CCAGATAATCCTTTGTTATGGGG + Intronic
1141269568 16:82526660-82526682 CTGGATAATCTTTTGTTGTGAGG + Intergenic
1141484843 16:84331891-84331913 CAGGATCATTCTTTGTGGTGGGG + Intergenic
1141640236 16:85336692-85336714 CAGGAGAATCGCTTGTACTGAGG - Intergenic
1141752990 16:85971883-85971905 CAAGAAAACCCCTTGTTGTCTGG + Intergenic
1143366480 17:6411960-6411982 CAGGAGAATCCCTTGAACTGAGG + Intronic
1143504755 17:7357446-7357468 CGGGATAATTCTTTGCTGTGGGG - Intergenic
1143598645 17:7930182-7930204 CTGGATAATTCTTTATTGTGGGG - Intronic
1144006462 17:11104569-11104591 CAGCTTCATCCCCTGTTGTGGGG - Intergenic
1144200898 17:12941507-12941529 CTGGATAATTCATTGGTGTGGGG - Intronic
1144309214 17:13997116-13997138 CAGGAGAATTCCTTTCTGTGTGG + Intergenic
1144895790 17:18531152-18531174 CAAGATAATGCCTTGTTTTTAGG + Intergenic
1145136428 17:20413081-20413103 CAAGATAATGCCTTGTTTTTAGG - Intergenic
1146035853 17:29406106-29406128 TAGGATAATTCATTGTTGGGGGG + Intronic
1146539398 17:33681291-33681313 CTGGATAATTCTTTGTTGTGGGG + Intronic
1146555383 17:33818669-33818691 CTGGATAATTCTTTGTTGTGGGG - Intronic
1146595725 17:34166845-34166867 CTGGATAATTATTTGTTGTGGGG + Intronic
1146760014 17:35468921-35468943 CAGGAGAATCTCTTGATGTCGGG + Intronic
1146775833 17:35615068-35615090 CTGGATAATTCTTTGTTGTCGGG - Intronic
1147249036 17:39142016-39142038 CTGGATAATTCATTGTTATGCGG + Intronic
1147372198 17:40000164-40000186 CAGGAGAATCGCTTGAAGTGGGG + Intergenic
1147666582 17:42152684-42152706 CAGGAGAATCCCTTGATCTCGGG + Intronic
1147855126 17:43474050-43474072 CAGGATTATTCTTTGTTGTTGGG - Intergenic
1147887428 17:43693548-43693570 CCGGGTAATTCTTTGTTGTGGGG + Intergenic
1147992421 17:44343123-44343145 CAGGATACTTCTTTGTTGTGGGG + Intergenic
1148992846 17:51681475-51681497 CTGGATAGTTCTTTGTTGTGGGG + Intronic
1149382655 17:56109365-56109387 CCAGATAATTCTTTGTTGTGAGG + Intergenic
1150261670 17:63797487-63797509 CTGGATAATTATTTGTTGTGGGG + Intronic
1150471356 17:65440041-65440063 CTGGATCATTCTTTGTTGTGAGG + Intergenic
1150723852 17:67635990-67636012 CCAGATAATTCTTTGTTGTGAGG - Intronic
1150913121 17:69409934-69409956 CCAGATAATTCTTTGTTGTGGGG + Intergenic
1151468077 17:74300724-74300746 CCGGATATTGCCTTATTGTGGGG + Intronic
1151821651 17:76500192-76500214 CTGGATAATTCCTCGTTATGTGG + Intronic
1152217029 17:79039320-79039342 CTAGATAATCCCCTGTGGTGGGG - Intronic
1153493861 18:5677477-5677499 CTGGATGATTCTTTGTTGTGAGG - Intergenic
1154531795 18:15353664-15353686 CAAGAAAATCCCTTGATCTGGGG - Intergenic
1154983258 18:21522035-21522057 TTGGATAATTCTTTGTTGTGGGG - Intronic
1155003734 18:21709491-21709513 AGGGATAATCCATTGTAGTGAGG - Intronic
1155367050 18:25059006-25059028 CCAGATAATTCATTGTTGTGCGG + Intergenic
1155969955 18:32073470-32073492 CAGGATAATTCTTTGTTGCAAGG - Intergenic
1156109531 18:33708563-33708585 CTGGATAATCCTCTGTGGTGGGG + Intronic
1156328908 18:36101179-36101201 CAGGAGATTCCCTTGTGGCGAGG - Intergenic
1157215775 18:45782308-45782330 CTGGATAATGCTTTGTTATGGGG - Intergenic
1158011236 18:52730314-52730336 CTGGATAATTCTTTGTTGTGGGG - Intronic
1158604539 18:58883681-58883703 CTGGATAATTCTTGGTTGTGGGG + Intronic
1159085430 18:63784267-63784289 CTGGATAAATCTTTGTTGTGAGG + Intronic
1160584898 18:79907849-79907871 CTGGAGAATCCCTTATTGTGGGG - Intronic
1161083655 19:2323880-2323902 CAGGAAACCCCATTGTTGTGGGG - Intronic
1161300789 19:3542258-3542280 CAGGCTACTCCCATGTTCTGTGG + Intronic
1163683251 19:18695913-18695935 CTGGATAATTCCCTGTGGTGGGG - Intronic
1164320099 19:24136957-24136979 CAGGGTATTCCCTTTTTCTGTGG + Intergenic
1164487702 19:28674637-28674659 CCAGATAATCCCTTGTTGTGGGG + Intergenic
1165605218 19:37096989-37097011 CAGGAGAATCCCTTGAACTGGGG - Intronic
1166214998 19:41329009-41329031 CAGGACAATCACTGGGTGTGGGG + Intronic
1166992633 19:46701760-46701782 CAGGATAATTCCTTGTTTTAGGG + Intronic
1167015210 19:46836819-46836841 CAGGACAATCCCTCATTGTGAGG - Intergenic
1167092783 19:47356048-47356070 CTGGATAATTCCTTGTCGTGGGG + Intronic
1167092989 19:47357600-47357622 CTGGATAATTCCTTGTCGTGGGG - Intronic
1167236678 19:48319937-48319959 TGGGATAATTCTTTGTTGTGGGG - Exonic
1167394338 19:49218021-49218043 CAGGAGAATCCCTTGAACTGGGG - Intergenic
1168358886 19:55721583-55721605 CTAGATAATCCTTTGTTGTTGGG + Intronic
925497222 2:4465635-4465657 CAGGATAATCTCCTGTTTTAAGG - Intergenic
926234120 2:11026541-11026563 CAGGATGATCCCAGGCTGTGAGG + Intergenic
927229178 2:20803166-20803188 CTGGATAATTATTTGTTGTGGGG - Intronic
927778607 2:25921456-25921478 CAGGAGAATCCCTTGAACTGAGG + Intergenic
928241943 2:29594105-29594127 CAGGATAATTCTTTGTTTTGGGG - Intronic
928592148 2:32828029-32828051 CTGGATAATTCTTTGTTGTTGGG + Intergenic
928685958 2:33748933-33748955 CAGGAGAATCCCTTGAACTGAGG + Intergenic
928773778 2:34733919-34733941 CTAGATAATTCTTTGTTGTGGGG + Intergenic
929059196 2:37905905-37905927 CTGGATAATTCTTTGCTGTGGGG + Intergenic
929644975 2:43617409-43617431 CAGGATAATCCCTTGAGCTCAGG + Intergenic
929852483 2:45605015-45605037 CAAGACAATTCTTTGTTGTGGGG - Intronic
929914205 2:46120409-46120431 CTGGATAAATCTTTGTTGTGAGG - Intronic
929916298 2:46138828-46138850 CTGGATAATCCTGTGTTGTGGGG - Intronic
930515332 2:52400893-52400915 CTGGATAATTCTTTGTTGTAGGG - Intergenic
930675500 2:54196626-54196648 CTGGATAATTCTTTGTTGTGAGG + Intronic
930773525 2:55150832-55150854 CAGGAGAATCACTTGAGGTGGGG + Intergenic
930943860 2:57047406-57047428 TTGTATAATCCTTTGTTGTGGGG + Intergenic
931045663 2:58349779-58349801 CTGGATAATTCTTTGTTGTGGGG + Intergenic
931234850 2:60404443-60404465 CAGGAGAATTCTTTGTTGTGGGG - Intergenic
931369602 2:61649995-61650017 CAGGAGAATCCCTTGAGGTCAGG + Intergenic
931412795 2:62049543-62049565 CTGGAAAATTCTTTGTTGTGGGG - Intronic
932244595 2:70185887-70185909 CTGGATAATTCTTTGTTGTGGGG + Intronic
932522669 2:72429777-72429799 ATGGATAATTCTTTGTTGTGGGG - Intronic
932810576 2:74822385-74822407 CTGGATAATTCTTTGTTGTGGGG + Intergenic
932860522 2:75286716-75286738 CCAGATAATTCTTTGTTGTGAGG - Intergenic
932909342 2:75789487-75789509 CCAGATAATTCTTTGTTGTGGGG + Intergenic
933687756 2:85157001-85157023 CCAGATAATTCTTTGTTGTGAGG - Intronic
934064431 2:88327495-88327517 CTGGACAATTTCTTGTTGTGGGG + Intergenic
935019468 2:99215897-99215919 TAGGACTATCCCTGGTTGTGTGG - Intronic
935072752 2:99710344-99710366 CATGATAATCCCTTGAACTGGGG - Intronic
936922547 2:117704003-117704025 CTGGATAATTCCTTGTCGTGGGG + Intergenic
937275686 2:120682540-120682562 CAGGAGAATCGCTTGAAGTGGGG - Intergenic
937370016 2:121290857-121290879 CTGGATAATTCTTTGTTGTGGGG - Intergenic
937850027 2:126623697-126623719 CTGGATAATTCTTTCTTGTGAGG - Intergenic
938530892 2:132184903-132184925 CAAGAAAATCCCTTGATCTGGGG - Intronic
938735385 2:134181277-134181299 CTGGATAATTCCTGGCTGTGGGG - Intronic
939207501 2:139126159-139126181 CTGGATAATTCTTTGTTATGGGG + Intergenic
939372968 2:141326719-141326741 CCAGATAATTCCTTGTTGTGGGG - Intronic
940197038 2:151106194-151106216 CTGGATAATTCTTTGTTGTGGGG - Intergenic
941069927 2:160944450-160944472 CTAGATAATTCTTTGTTGTGAGG - Intergenic
941550219 2:166906727-166906749 CAGGAGAATCACTTGTTGCCAGG + Intronic
941661796 2:168203041-168203063 CAGGATAATTCTTCGTTGTGAGG + Intronic
942019849 2:171856276-171856298 TTGGATAATTCTTTGTTGTGGGG + Intronic
942074682 2:172345845-172345867 CAGCATAATGGCTTGTTTTGGGG + Intergenic
942658280 2:178237636-178237658 CTGGATAATTCTTTGTTGTAGGG + Intronic
942844080 2:180402078-180402100 CTGGATAATCACTTGCTGTGGGG + Intergenic
943187352 2:184628220-184628242 CAGGATAATCGCTTGAACTGGGG + Intronic
943745947 2:191463090-191463112 CCAGATAATCCTTTGTTGTAGGG - Intergenic
944145932 2:196507543-196507565 CTGGATAATTATTTGTTGTGGGG - Intronic
944195822 2:197051891-197051913 CAGGATAATTCTTTGTTGTGGGG - Intronic
944405234 2:199376559-199376581 CAGGATAATTCTTTGTGGTGGGG - Intronic
944883613 2:204040851-204040873 CTGGATACTTCTTTGTTGTGGGG + Intergenic
945150328 2:206783971-206783993 CTGGATAATTCCTTATTGTGAGG - Intronic
945288056 2:208102083-208102105 CAGAATAATCTCTATTTGTGAGG + Intergenic
945635477 2:212344239-212344261 CTGGATAATTCTTTGTTGTGGGG + Intronic
947512133 2:230765797-230765819 CTAGATAACCCTTTGTTGTGGGG - Intronic
948158087 2:235800822-235800844 CTGGATAATTCCCTGCTGTGAGG - Intronic
948204662 2:236156895-236156917 CAGGACAATTCTTTGTGGTGTGG - Intergenic
1169155597 20:3327210-3327232 CTGGATAATTCTTTGCTGTGGGG + Intronic
1169524787 20:6412639-6412661 CTGGATAATTCTTTGTTGTGGGG + Intergenic
1169764358 20:9132980-9133002 CTGGTTAATTCCTTGTTGTCGGG - Intronic
1170244573 20:14206186-14206208 CTGGATAATTCTTTGTTGTGAGG - Intronic
1170584176 20:17721908-17721930 CCAGATAATTCTTTGTTGTGGGG + Intronic
1170746162 20:19100686-19100708 CTGGATAATTCCTTGTTGTGGGG - Intergenic
1172186407 20:33033814-33033836 CAGGATAATTCTTTGTCATGAGG - Intronic
1173619642 20:44427040-44427062 CTGGACAATTCTTTGTTGTGTGG + Intronic
1174008301 20:47428039-47428061 CTGGATAATTCTTTGTTGCGGGG - Intergenic
1174075817 20:47935694-47935716 CAAGATAATTATTTGTTGTGTGG + Intergenic
1174481333 20:50833419-50833441 CTGGAAAATTCTTTGTTGTGGGG + Intronic
1174548241 20:51342555-51342577 CCAGATAATTCTTTGTTGTGGGG - Intergenic
1174671707 20:52314090-52314112 CCGAATAATTCTTTGTTGTGGGG - Intergenic
1174935638 20:54865262-54865284 CCAGATCATCCTTTGTTGTGGGG + Intergenic
1174945676 20:54982810-54982832 CAGGAGAATCCCTTGAACTGGGG - Intergenic
1175042809 20:56071720-56071742 CCAGATAATGCTTTGTTGTGGGG - Intergenic
1175105687 20:56613188-56613210 CCAGATAATGCTTTGTTGTGGGG + Intergenic
1175112528 20:56658559-56658581 TTGGATAATTCTTTGTTGTGGGG - Intergenic
1175554737 20:59841846-59841868 CTAGATAATCCTTTGTTGTGGGG - Intronic
1175646326 20:60675669-60675691 CTGAATAATTCTTTGTTGTGAGG + Intergenic
1175662054 20:60821913-60821935 CTGGATCATTCTTTGTTGTGTGG - Intergenic
1176765565 21:13014509-13014531 CAAGAAAATCCCTTGATCTGGGG + Intergenic
1177082032 21:16651534-16651556 TTGGATAAGTCCTTGTTGTGGGG - Intergenic
1177190330 21:17844539-17844561 CCACATAATTCCTTGTTGTGGGG + Intergenic
1177336188 21:19731809-19731831 CAGGAGAATCACTTGTACTGGGG - Intergenic
1178277013 21:31248077-31248099 CTGGATAATTATTTGTTGTGAGG - Intronic
1178288506 21:31346154-31346176 CTGGATAATTCTTTGTCGTGGGG - Intronic
1179070489 21:38066330-38066352 CTGGATAATGCTTTGTTGTGGGG - Intronic
1180430143 22:15240996-15241018 CAAGAAAATCCCTTGATCTGGGG + Intergenic
1181446788 22:22982817-22982839 CCAAATAATTCCTTGTTGTGAGG + Intergenic
1182027200 22:27129588-27129610 CAGGATCCTCCCTTGTTCTTTGG + Intergenic
1182301216 22:29338162-29338184 CAGGACAGTTGCTTGTTGTGGGG - Intronic
1182338129 22:29598769-29598791 CTGGATAATTCTTTATTGTGGGG + Intergenic
1182340592 22:29617379-29617401 CTGGATGATTCTTTGTTGTGGGG + Intronic
1182649100 22:31836261-31836283 CCAGATAATTCTTTGTTGTGGGG - Intronic
1182779408 22:32855668-32855690 CCGGATAATTCTTTGTTCTGGGG + Intronic
1182782244 22:32877468-32877490 CTGGATAATTCTCTGTTGTGGGG + Intronic
1183523285 22:38309021-38309043 CTGGAGAATTCCTGGTTGTGGGG + Intronic
1183725793 22:39589012-39589034 CTGGATGATTCTTTGTTGTGGGG + Intronic
1183805909 22:40210839-40210861 CTGGGTAATTCTTTGTTGTGGGG + Intronic
1183992529 22:41607532-41607554 CTGGATACTTCTTTGTTGTGTGG + Intronic
1184451474 22:44585318-44585340 CAGGAGAATCCCTTGAACTGGGG + Intergenic
949112646 3:281145-281167 CTGAATAATTCCTTGTTGTGAGG - Intronic
949163167 3:906543-906565 CAGGAGAATCCCTTGCACTGGGG - Intergenic
949499520 3:4666041-4666063 CAGGATAATTCTTGGTTGTGTGG - Intronic
949870441 3:8583556-8583578 CGGGATAATCCCTAGTTGCCTGG - Intergenic
949888300 3:8713553-8713575 CTGGATAATCCTTTGTTGTGGGG + Intronic
950920009 3:16684683-16684705 CTGGGTAATTCTTTGTTGTGAGG - Intergenic
951688617 3:25372234-25372256 CTGGATAATTCTTTGCTGTGAGG + Intronic
951770192 3:26246646-26246668 CTGGATAATTCTTTGTTGTGAGG - Intergenic
952375236 3:32761646-32761668 CAGGAGAATCCCTTGAACTGGGG - Intronic
952399227 3:32948370-32948392 CAGGAGAATCCCTTGAACTGGGG + Intergenic
952699643 3:36312462-36312484 CAGGATAATTCTTTGTTGTAGGG + Intergenic
952848477 3:37708673-37708695 CTGGATAATTCTTTGTTGTATGG - Intronic
952965726 3:38620147-38620169 CAGGAGAAACCCTTGCTGAGGGG - Intronic
953281708 3:41564549-41564571 CAGGAGAATCGCTTGAAGTGGGG - Intronic
953504710 3:43473706-43473728 CTGGAAAATTCTTTGTTGTGGGG + Intronic
953682159 3:45047698-45047720 CTGGATAATTCTTTGTTGTGGGG + Intergenic
954957656 3:54536464-54536486 ATGGATAATCCCTTGTGGGGTGG - Intronic
955057053 3:55464161-55464183 CAGGATAATTATTTGTCGTGAGG - Intergenic
955057177 3:55465223-55465245 CTGGATAATTCTTTGTTGTAGGG - Intergenic
955103322 3:55873058-55873080 CTGGATAATTCTTTCTTGTGGGG - Intronic
955149668 3:56354516-56354538 CTGGATAATCCCTTGTTATGGGG - Intronic
955166046 3:56512309-56512331 GTGGATAATTCTTTGTTGTGGGG - Intergenic
955738766 3:62067302-62067324 CAGGAAACTCCCATGATGTGGGG + Intronic
955800090 3:62677577-62677599 CTGGATAATTCCTTGTTGCAGGG - Intronic
955962043 3:64350567-64350589 CTGGAGAATTCCTTGTTGTGGGG - Intronic
956224966 3:66947285-66947307 CAGGACAGTTCCCTGTTGTGAGG + Intergenic
956228178 3:66983130-66983152 CCAGATAATTCTTTGTTGTGGGG + Intergenic
956334022 3:68143518-68143540 CCAGATAATTCCTTGTCGTGGGG + Intronic
956375866 3:68613132-68613154 CGGGATAATTCTTCGTTGTGGGG + Intergenic
956431467 3:69190762-69190784 CTGGATAATCCTTTGTCCTGGGG + Intronic
956488086 3:69742330-69742352 CCAGATAATCCTTTGTTGTGGGG - Intronic
956538781 3:70310456-70310478 CAGGATAATCGCTTGAACTGGGG - Intergenic
956566952 3:70649695-70649717 CTGAATAATTCTTTGTTGTGGGG - Intergenic
956766559 3:72489212-72489234 CTGGATAATTCTTTGGTGTGGGG - Intergenic
957997258 3:87706280-87706302 CTGGATAATTCTTTGTTGTATGG + Intergenic
958033833 3:88147906-88147928 CAGGATAATCTTTTGTCGAGGGG - Intronic
958819859 3:98960900-98960922 CCAGATAATTCCTTGTTGTGAGG - Intergenic
959399722 3:105884993-105885015 CAGGGTCATTCCTTGTTGTGGGG - Intergenic
959980115 3:112506728-112506750 CTGGATAATTCTTTGGTGTGAGG - Intergenic
960596027 3:119409070-119409092 CTGGATAAGTCTTTGTTGTGGGG + Intronic
961611220 3:128141587-128141609 CAGGAGAATCGCTTGATCTGGGG - Intronic
961924190 3:130459569-130459591 CTTGATAATTCATTGTTGTGAGG - Intronic
961930201 3:130525048-130525070 CAGGATAATGGGTTGTTGTAAGG - Intergenic
962099428 3:132326207-132326229 CTAGATAATTCTTTGTTGTGGGG - Intronic
962396848 3:135023345-135023367 CTGAATAATTCTTTGTTGTGGGG + Intronic
963136069 3:141905405-141905427 CTGAATAATTCTTTGTTGTGGGG - Intronic
963161724 3:142157743-142157765 TGGGATAATTCTTTGTTGTGGGG - Intergenic
963392744 3:144689066-144689088 CTAGATAATTCTTTGTTGTGAGG - Intergenic
963902576 3:150746510-150746532 CCTGATAATTCGTTGTTGTGGGG + Intronic
964025755 3:152072077-152072099 CTGGATAATTACTTGCTGTGGGG + Intergenic
964054097 3:152431156-152431178 CTGGATAATTCTTTGTTGCGAGG + Intronic
964472278 3:157068249-157068271 CTGGATAATTCTTGGTTGTGGGG - Intergenic
965019608 3:163212433-163212455 CAGGAGAATCACTTGAAGTGGGG - Intergenic
965269929 3:166601993-166602015 CAGGAGAATCCCTTGAGCTGGGG + Intergenic
965330270 3:167364099-167364121 CCGAATAATTCTTTGTTGTGGGG + Intronic
965691631 3:171363177-171363199 CTGGATAATTCTTTGTTGTGGGG - Intronic
966323755 3:178731357-178731379 CTAGATAATTCCCTGTTGTGAGG + Intronic
966825582 3:183962417-183962439 CCAGATAGTCCATTGTTGTGTGG - Intronic
967501864 3:190206762-190206784 CAGGATAATCCCTTGAACTAGGG - Intergenic
969170116 4:5355577-5355599 CCAGATAATCCCTTGTTATGGGG + Intronic
971133738 4:23842569-23842591 CCAGATAATCCTTTGTTTTGGGG + Intronic
971220670 4:24703117-24703139 CAAGATAATCAGTAGTTGTGTGG - Intergenic
973005871 4:45006375-45006397 CCAGATAATCCTTTGTTGAGGGG - Intergenic
973250066 4:48051089-48051111 CTGGATAATTCTTTGTTGTGGGG + Intergenic
973257057 4:48124168-48124190 CAGGATCATTCTTTATTGTGGGG + Intronic
973588119 4:52412672-52412694 CCAGATAATGCCTTGTGGTGGGG - Intergenic
973789884 4:54368033-54368055 TTGGATAATTCCTTGTTGTGGGG + Intergenic
973954116 4:56046603-56046625 CTGGATAATTCTTGGTTGTGGGG + Intergenic
974984020 4:68996384-68996406 CAGGACAAACACTTGTTTTGTGG + Intergenic
975345108 4:73284258-73284280 CAGGATAATCACTTGAACTGGGG + Intergenic
976196348 4:82535841-82535863 CTGAATAATCCCTTGTTGTGGGG + Intronic
976223074 4:82773647-82773669 CTTGATAATTCCTTGATGTGGGG + Intronic
976382533 4:84416133-84416155 CCAGATAATCCTTTGTTGTAGGG - Intergenic
977007114 4:91581774-91581796 CTGGATAAATCTTTGTTGTGAGG + Intronic
977212081 4:94230532-94230554 CCAGATAATTCTTTGTTGTGAGG + Intronic
977866711 4:102037264-102037286 CTGGATAATTCTTTGTTATGGGG - Intronic
978627606 4:110704858-110704880 CTGGATAATTCTCTGTTGTGGGG - Intergenic
980609871 4:135145806-135145828 CAGGATAATCACTTGTTGATAGG + Intergenic
980732572 4:136842197-136842219 CTGGGTAATTCTTTGTTGTGGGG + Intergenic
980786344 4:137561149-137561171 CTGGATAATTATTTGTTGTGAGG + Intergenic
981645872 4:146998237-146998259 CTGGATAATTCTTTGTTGTGAGG - Intergenic
981775221 4:148359441-148359463 CACTAGAATCCTTTGTTGTGGGG - Intronic
983763512 4:171445855-171445877 CTGGAGAATTCCTTGTTCTGGGG - Intergenic
984419870 4:179507210-179507232 CAGGACAATCACTTGAGGTGGGG + Intergenic
985010939 4:185581346-185581368 CTGGATAATTCTTAGTTGTGAGG + Intergenic
985135726 4:186783975-186783997 CAGGAGAATCCCTTGAACTGGGG + Intergenic
985928729 5:3038097-3038119 CATGAAAATCCCTCGTTTTGTGG + Intergenic
986637379 5:9836394-9836416 CAGGATAATTCTTTGTTGGAGGG + Intergenic
986732184 5:10643240-10643262 CCAGATAATTCTTTGTTGTGGGG + Intronic
987192146 5:15489444-15489466 CTGGATAATTCTTTGTTGGGAGG - Intergenic
987576956 5:19741918-19741940 CTGGATAATTCTTTGTTGTGAGG - Intronic
988266874 5:28962959-28962981 CAGGATAATCACTTGAACTGGGG - Intergenic
988414731 5:30931707-30931729 CCAGATAATTCTTTGTTGTGAGG + Intergenic
988557811 5:32253205-32253227 CCAGATAATTCTTTGTTGTGGGG - Intronic
988947986 5:36225832-36225854 CAGAATAATTCTTTGTTGTGGGG + Intronic
989404917 5:41049675-41049697 CAGGACAATTCTTTGTTGTGAGG + Intronic
989458681 5:41671024-41671046 CCTGATAATTCCTTGTTGTCAGG + Intergenic
990190999 5:53260174-53260196 CTGAATAAACACTTGTTGTGTGG - Intergenic
990208965 5:53461005-53461027 CAGGAGAATCGCTTGAGGTGGGG - Intergenic
990335002 5:54763961-54763983 TGGGATAATCCTTTGTTGTGGGG - Intergenic
990449461 5:55921018-55921040 CCAGATAATTCTTTGTTGTGAGG - Intronic
990621167 5:57560408-57560430 CAGGATAATCACTTATTGGGTGG + Intergenic
990891015 5:60650384-60650406 CCGGATAGTTCTTTGTTGTGGGG + Intronic
991469574 5:66953797-66953819 CTGGATAATTCTTTGTTGTGGGG + Intronic
991511991 5:67388234-67388256 CTGGATAATTCTTTGTTGTGGGG - Intergenic
992043318 5:72859237-72859259 CTGGATAATTCTTTGTTGTTGGG + Intronic
993414455 5:87609323-87609345 TTGGATAATTCTTTGTTGTGTGG + Intergenic
993811918 5:92490669-92490691 CCGGATAATTCTTTGTTGTGGGG + Intergenic
993969310 5:94397612-94397634 TTGGATGATCCTTTGTTGTGAGG + Intronic
994343624 5:98661119-98661141 CAGGATAATCGCTTGAACTGAGG - Intergenic
995512666 5:112923893-112923915 CTGGATAATTCTTTGTTGTGGGG - Intergenic
995634855 5:114176115-114176137 CTGGATAATTCTTTGTTGTTGGG + Intergenic
995733707 5:115274279-115274301 CTAGATAATTCTTTGTTGTGGGG - Intronic
996933560 5:128920893-128920915 CAGAATAATTCTTTGTTGTGGGG + Intronic
997137480 5:131342185-131342207 CAGGATAATCACTTGAACTGGGG + Intronic
997680014 5:135743469-135743491 CAGGATTATTCTTTGTTGTGGGG - Intergenic
998585288 5:143420704-143420726 CCGGGTAATTCTTTGTTGTGGGG - Intronic
999009448 5:148019627-148019649 CTGGATAATCCTCTGTTTTGTGG + Intergenic
999191808 5:149753784-149753806 CAGGAGAATTGCTTGTTGTGGGG - Intronic
1000512654 5:162203148-162203170 CTGGATAATTCTTTGCTGTGAGG + Intergenic
1000957584 5:167560984-167561006 CTGGATCATGGCTTGTTGTGGGG - Intronic
1001570037 5:172724882-172724904 CCAGATAATCCTGTGTTGTGGGG + Intergenic
1001679707 5:173547263-173547285 CTGGATAATTCTTTGTTGTAGGG - Intergenic
1001929450 5:175662409-175662431 CAGGATAATTTTTTGTTATGAGG - Intronic
1002548457 5:179968878-179968900 CTGGACAATCCCTTCTTGTGGGG - Intronic
1003055140 6:2811337-2811359 CCGGATAATTCTTTGTTGTGGGG + Intergenic
1003136586 6:3439122-3439144 CCGGATCATCCCTTGTGGTGTGG + Intronic
1003430994 6:6037228-6037250 CCGGATAGTTCCTTATTGTGGGG - Intergenic
1003897426 6:10620964-10620986 CTGGATGATTCTTTGTTGTGGGG - Intronic
1004029703 6:11854594-11854616 CTGGATAATTCTTTGCTGTGGGG - Intergenic
1004309849 6:14535469-14535491 CTGGATAATTCTTTGTTGCGGGG - Intergenic
1004773588 6:18816070-18816092 CAGGAGGATCACTTGTTGTCAGG + Intergenic
1004853400 6:19724451-19724473 CTGGATGATTCTTTGTTGTGGGG - Intergenic
1004927427 6:20429112-20429134 CTGGATAATTCTTTGTTGTGGGG - Intronic
1005888652 6:30117726-30117748 CTGGATAATTCTTTGGTGTGTGG + Intergenic
1005912240 6:30320979-30321001 CAGGATCATACATTGTTGTAAGG + Intergenic
1006328403 6:33371781-33371803 CAGGAGAATCCCTTGAACTGGGG - Intergenic
1006544123 6:34765155-34765177 CTGGATAATCTTTTGCTGTGAGG + Intronic
1006715839 6:36119769-36119791 CTGGGTAATTCCTCGTTGTGGGG - Intergenic
1007025294 6:38565273-38565295 CTGGATAATTCTTTGTTGTAGGG + Intronic
1007561594 6:42813512-42813534 CAAGATAAACACTTTTTGTGGGG + Intronic
1008488010 6:52056015-52056037 CTGGATAATTCTTTGTTGTAGGG + Intronic
1008606666 6:53146685-53146707 CCAGATAATTCTTTGTTGTGGGG + Intronic
1008709864 6:54211761-54211783 CTGGGTAATTCTTTGTTGTGTGG - Intronic
1008833235 6:55794753-55794775 CAGTTTAATCCTTTGTTTTGAGG - Intronic
1009053729 6:58310884-58310906 CAGGATAATTCTTTGTTGGGAGG - Intergenic
1009237396 6:61139665-61139687 CAGGATAATTCTTTGTTGGGAGG + Intergenic
1009653395 6:66506403-66506425 CCAGATAATTCTTTGTTGTGGGG + Intergenic
1009676745 6:66833946-66833968 AAGGATAATCCCTTCTTCAGTGG - Intergenic
1010152772 6:72754604-72754626 CCTGATAATTCTTTGTTGTGTGG - Intronic
1010159263 6:72832492-72832514 CCAGAGAATCCTTTGTTGTGGGG - Intronic
1010231613 6:73540117-73540139 CTGGATAGTGCCTTGTTGTAGGG - Intergenic
1011117507 6:83909908-83909930 CCAGAAAATCCTTTGTTGTGGGG - Intronic
1011120859 6:83951069-83951091 CTGGATAATTCTTTGTTGTAGGG - Intronic
1011449503 6:87477773-87477795 CTGGATAAATCTTTGTTGTGAGG - Intronic
1011527260 6:88278230-88278252 CAGGACCATCCATTGTGGTGAGG + Intergenic
1011826339 6:91309855-91309877 CAAGATAATATCTTGTGGTGAGG + Intergenic
1011917968 6:92533297-92533319 CTGCATAATCCCTAGGTGTGGGG - Intergenic
1012135265 6:95548138-95548160 CAGGATAATTTCTTGTGGTGAGG - Intergenic
1012432548 6:99180419-99180441 CTGGATAATTCTTTGTTGTGAGG - Intergenic
1012449514 6:99340190-99340212 CAGGAGAATCGCTTGAAGTGGGG - Intronic
1013316989 6:108952562-108952584 CTGGATAATTCTTTGTTGTGGGG - Intronic
1013521125 6:110934756-110934778 CAGAATATTTCCTTATTGTGGGG - Intergenic
1014406933 6:121064350-121064372 AAGGAAAATCCCATTTTGTGAGG + Intergenic
1014433897 6:121400367-121400389 CCAAATAATCCCTTGTTGTTGGG - Intergenic
1014446115 6:121530062-121530084 CAGGCTTATCTCTTGTTGTTGGG - Intergenic
1015290359 6:131531949-131531971 CAGTATAATCTCCTGGTGTGCGG + Intergenic
1015638791 6:135307937-135307959 CTGGATAATTCTTTGTTGTTGGG - Intronic
1016087842 6:139936752-139936774 CAGGATAATCACTTGAACTGGGG - Intergenic
1016515887 6:144892762-144892784 CTGGATAATTCTTTGCTGTGAGG + Intergenic
1016656542 6:146524750-146524772 CCAGATAATTCCTTGTTGTATGG - Intergenic
1016925289 6:149339268-149339290 CAGGAGAATCGCTTGAAGTGGGG + Intronic
1018069426 6:160149406-160149428 CAGGAGAATCACTTGAAGTGGGG - Intronic
1018259470 6:161955173-161955195 CAAGATAACCCTTTGCTGTGGGG + Intronic
1018415646 6:163600190-163600212 CAGGCTAAACCCCGGTTGTGAGG + Intergenic
1018710263 6:166493834-166493856 CTGGACACTTCCTTGTTGTGGGG - Intronic
1020141066 7:5612084-5612106 CAGGAGAATCCCTTGAACTGGGG + Intergenic
1020559926 7:9718022-9718044 CAGGATAATGCCTAGTCATGAGG + Intergenic
1020973534 7:14978259-14978281 CAGTATAATTCCTTGTTGTCAGG - Intergenic
1021246552 7:18269990-18270012 CTGGATAATTCTTTGTTGTAGGG + Intronic
1021829351 7:24588092-24588114 CCAGATAATTCTTTGTTGTGGGG - Intronic
1021882552 7:25108686-25108708 CCAGATAATTCTTTGTTGTGGGG + Intergenic
1022034693 7:26522402-26522424 CAGGAGAATCCCTTGAACTGGGG + Intergenic
1022121563 7:27313414-27313436 CTGGACAATTCTTTGTTGTGGGG + Intergenic
1022262658 7:28721272-28721294 CTAAATAATCCTTTGTTGTGGGG - Intronic
1022343373 7:29488825-29488847 CTGGAAAATTCTTTGTTGTGGGG - Intronic
1022397812 7:30006643-30006665 CAGAATAATTCTTCGTTGTGTGG + Intergenic
1022851595 7:34268486-34268508 CTGGATAATTCTTTGTTGTTGGG - Intergenic
1023176665 7:37442178-37442200 CTGGATAATCCTTTGTTGTAAGG - Intronic
1023255500 7:38308522-38308544 CTGGATAATTCTTTGTTGTGGGG + Intergenic
1023507150 7:40911611-40911633 CCAGATAATTCTTTGTTGTGGGG + Intergenic
1023609538 7:41958980-41959002 CTGGATAATTCTTTGTTGTAGGG - Intergenic
1025030144 7:55550080-55550102 CAGGACCCTCCCTTGTTCTGGGG - Intronic
1028103486 7:86849660-86849682 CATGATAAACCCTGGTTCTGAGG + Intronic
1028217036 7:88146465-88146487 CTGGATAATCCTTTGTTGTAAGG + Intronic
1029061144 7:97799129-97799151 CTGGGTAATTCTTTGTTGTGGGG - Intergenic
1029441773 7:100590690-100590712 CAAAATAATTCCTTGATGTGGGG + Intronic
1029946667 7:104540466-104540488 CCAGATAATTCTTTGTTGTGGGG - Intronic
1030014588 7:105206049-105206071 CTGGATAATTCATTGCTGTGGGG + Intronic
1030044738 7:105484953-105484975 CAGGATAATTCCTTGATTTCAGG - Intronic
1030045438 7:105490956-105490978 CTGGATAATTCTTTGTTGTAGGG - Intronic
1030470123 7:109952970-109952992 CAGGTTCATCCCATGATGTGGGG + Intergenic
1030638796 7:111980597-111980619 CTGAATATTTCCTTGTTGTGGGG + Intronic
1031606239 7:123771391-123771413 CTGCATAATTCTTTGTTGTGGGG + Intergenic
1032203503 7:129841045-129841067 CTAGATAATCCTTTGTTGTGGGG - Intronic
1033166629 7:139044034-139044056 CAGAATAATTCTTCGTTGTGTGG - Exonic
1033599850 7:142881319-142881341 CAGGATAATTCTTTGCAGTGAGG - Intronic
1033912091 7:146276554-146276576 TAAGATAATCCCTACTTGTGTGG + Intronic
1033924095 7:146435787-146435809 CATGATCATATCTTGTTGTGAGG - Intronic
1034037485 7:147839573-147839595 CAGAATAATTCTTTGTTGTCAGG + Intronic
1035906091 8:3511663-3511685 CAGGAGAATCCCTTGAACTGGGG + Intronic
1036426732 8:8651924-8651946 CAGGAGAATCGCTTGAAGTGGGG - Intergenic
1038130728 8:24728363-24728385 CTGGATAATTCCCTGTTTTGGGG - Intergenic
1038155677 8:24987594-24987616 CAGTATGATACCTTCTTGTGAGG - Intergenic
1038301133 8:26350154-26350176 CAGGAGAATCACTTGATGGGAGG - Intronic
1038392641 8:27218366-27218388 GAGCATAAACCCTTGTTGTCAGG - Intergenic
1038500275 8:28037909-28037931 CCGGATCATGCTTTGTTGTGAGG - Intronic
1039574026 8:38609446-38609468 CAGGATAATCCCTTGAACTCAGG - Intergenic
1039942385 8:42102266-42102288 CAGGATAATTCTTTGTAGAGGGG + Intergenic
1040057602 8:43073823-43073845 CTGGATAATTCTTTGTTGTGGGG - Intronic
1041354022 8:56981032-56981054 CTGTATAATTCCTTGTTGTGGGG + Intronic
1042789029 8:72582555-72582577 CAAGATAATGTCTTTTTGTGAGG + Intronic
1042806069 8:72772287-72772309 CCAGATAATTCTTTGTTGTGGGG + Intronic
1042967326 8:74368783-74368805 CCAGATAATTCTTTGTTGTGTGG + Intronic
1044154115 8:88822109-88822131 CAGCATAATTCCATCTTGTGAGG + Intergenic
1044477613 8:92646654-92646676 CTGGATAATCCTTTGTTGTGGGG - Intergenic
1044828928 8:96226062-96226084 CTAGATAATTCTTTGTTGTGGGG - Intronic
1045612302 8:103859763-103859785 CAGGGTAATTACTTGTTATGTGG + Intronic
1046617030 8:116489149-116489171 CCAGATAATTCTTTGTTGTGAGG + Intergenic
1046918591 8:119703331-119703353 CAGGAGAATCCCTTGAACTGGGG + Intergenic
1046923893 8:119766361-119766383 TTGGATAATTCTTTGTTGTGGGG - Intronic
1047130993 8:122019185-122019207 CAGGATAATCACTTGAACTGGGG - Intergenic
1047622251 8:126620058-126620080 CTGGATAATTCTTTGCTGTGGGG + Intergenic
1047702683 8:127465443-127465465 CCAGATAATTCTTTGTTGTGAGG - Intergenic
1047824967 8:128563314-128563336 CTGGATAATTCTTTATTGTGGGG + Intergenic
1048064765 8:130956625-130956647 CAGAATAATGCCTTGTGGTATGG + Intronic
1048257215 8:132914109-132914131 CAGGATACTCCTTTATTTTGAGG + Intronic
1049399991 8:142420936-142420958 CAGGAGAATCACTTGAAGTGAGG + Intergenic
1049941057 9:546382-546404 CTGGATAATTCTTTGTTGTCAGG - Intronic
1050554293 9:6775862-6775884 CTTGGTAATTCCTTGTTGTGGGG + Intronic
1051657156 9:19394012-19394034 CAGAAGAATCCCTTGAAGTGGGG + Intergenic
1051689507 9:19695213-19695235 CTGGATAATTCATTGTTGTGAGG - Intronic
1051897276 9:22000837-22000859 AAGGATAATCCATTGTTCTTCGG - Intronic
1051955388 9:22686915-22686937 CAGGATAATCCCTTGAACTCGGG + Intergenic
1052407525 9:28081105-28081127 CTGGATAATTCTTTCTTGTGCGG + Intronic
1052906044 9:33834815-33834837 CAGGAGAATCCCTTGTTCCCGGG + Intronic
1053153859 9:35760331-35760353 GAGGATAATCCTTTGTTGTGGGG + Intergenic
1053179863 9:35959834-35959856 CTGGATAACCCTTTGGTGTGAGG + Intergenic
1053224809 9:36345419-36345441 CTGGATAATTCTTTGTTGTCGGG + Intronic
1053545611 9:39020177-39020199 CTGGATAATTCTGTGTTGTGGGG + Intergenic
1053809937 9:41841876-41841898 CTGGATAATTCTGTGTTGTGGGG + Intergenic
1054620656 9:67345552-67345574 CTGGATAATTCTGTGTTGTGGGG - Intergenic
1054784393 9:69197059-69197081 CAGGATAATCACTTGAACTGGGG - Intronic
1054928212 9:70609619-70609641 CAGGATAATTCTTCATTGTGGGG - Intronic
1055106928 9:72522877-72522899 CCTGATAATCCTTTTTTGTGAGG + Intronic
1055460953 9:76519787-76519809 CTAGATAATTCTTTGTTGTGGGG + Intergenic
1055650484 9:78402199-78402221 CCAGATAATTCTTTGTTGTGAGG - Intergenic
1055696155 9:78886789-78886811 CTGGATAATTCTTTGTTGTGAGG - Intergenic
1055871876 9:80890081-80890103 CAGAAAAATCCTTTTTTGTGAGG - Intergenic
1055931128 9:81560696-81560718 CTGGATAATTCTTTGTTGTGGGG - Intergenic
1055939992 9:81640125-81640147 CAGGATAATTCTCTGTGGTGAGG - Intronic
1057470966 9:95355871-95355893 CAGGGTAATTCCTGGTTGTTTGG + Intergenic
1058630582 9:106982362-106982384 CAGGATAATTCCTTGTTGTGGGG - Intronic
1058681912 9:107447415-107447437 CCAGATAATTCCTTGCTGTGGGG + Intergenic
1059508625 9:114823104-114823126 CCAGATAATTCTTTGTTGTGGGG + Intergenic
1059691493 9:116689111-116689133 CAGGATAATTCCTTACTGCGGGG - Intronic
1060124210 9:121026522-121026544 CAGGATAATTCTTTGTTGTAGGG + Intronic
1061527323 9:131176970-131176992 CTAGATAACCCTTTGTTGTGGGG - Intronic
1061694416 9:132361269-132361291 CAGGAGAATCCCTTGAACTGGGG - Intergenic
1185582230 X:1218445-1218467 CTGGATAATTCTTGGTTGTGTGG + Intergenic
1185661355 X:1731383-1731405 CAGGATGATCTCATGTTGAGAGG - Intergenic
1185738267 X:2509884-2509906 CAGGAGAATCCCTTGAAGTTGGG + Intergenic
1186250852 X:7664599-7664621 CTGGATAATTCCTTGTTATAGGG - Intergenic
1186269934 X:7876064-7876086 CTGGATAATTCTTTGTGGTGGGG + Intergenic
1186544292 X:10433108-10433130 CTGGATCATTCTTTGTTGTGGGG - Intergenic
1186561923 X:10621870-10621892 CAGGATAATTCTTTGTCGTGAGG + Intronic
1186570093 X:10706014-10706036 CTGGACAATTCCTTGTTATGGGG + Intronic
1186646695 X:11514398-11514420 CTGGATAATTCATTGTCGTGGGG + Intronic
1186711654 X:12204244-12204266 CTGGGTAATTCTTTGTTGTGGGG - Intronic
1186714556 X:12237000-12237022 CAGGCTAATACTTTGCTGTGGGG - Intronic
1186833724 X:13417140-13417162 CAGAATCATTCTTTGTTGTGAGG - Intergenic
1186971020 X:14843200-14843222 CTGGATAATTCTTTGTTGTAGGG + Intergenic
1186981085 X:14958218-14958240 TGGGATAATTCTTTGTTGTGGGG + Intergenic
1186986966 X:15027707-15027729 CTGGATAATTCTTTGTTGTAGGG + Intergenic
1187033103 X:15508884-15508906 CTGGGTAATTCTTTGTTGTGAGG - Intronic
1187408361 X:19024690-19024712 CTGGATCATTCTTTGTTGTGGGG - Intronic
1187522698 X:20027478-20027500 CTGGATAGTGCTTTGTTGTGGGG + Intronic
1187595595 X:20768789-20768811 CTGGATAATTATTTGTTGTGGGG - Intergenic
1187796007 X:23005300-23005322 CCAGATAATTCTTTGTTGTGAGG - Intergenic
1187899937 X:24018010-24018032 CAGGAAAATCGCTTGCGGTGAGG + Intronic
1188188919 X:27149738-27149760 CTAGATAATTCTTTGTTGTGGGG + Intergenic
1188198834 X:27274807-27274829 CTGGATAGTCTCTTGCTGTGAGG - Intergenic
1188380898 X:29490438-29490460 CAGGAGAATCCCTTGAACTGGGG + Intronic
1189065844 X:37807900-37807922 CTGTATAATTCTTTGTTGTGGGG - Intronic
1189402460 X:40684187-40684209 CTGGAAAATCCTTTGTTGCGGGG + Intronic
1189505643 X:41611148-41611170 CCAGATAATTCTTTGTTGTGGGG - Intronic
1189718974 X:43895454-43895476 CAGGATAATTCTTTGTTGTGGGG + Intergenic
1189841167 X:45080001-45080023 CTGGATAATTCTTTGTTGTGGGG + Intronic
1190168604 X:48093616-48093638 CTGGATAATTCTTTGTTGTGGGG + Intergenic
1190363531 X:49670986-49671008 CCAGATGATCCTTTGTTGTGGGG + Intergenic
1190438070 X:50447723-50447745 CAGGATAATCCTTTGTGTTCAGG + Intronic
1190627659 X:52352292-52352314 CAGGATGATCCCTTGTGGCCAGG - Intergenic
1192139534 X:68635855-68635877 CTGGATAATTCTTTGTTGTGAGG - Intergenic
1192258780 X:69490313-69490335 CCAGATAATTCTTTGTTGTGTGG - Intergenic
1194468905 X:94268254-94268276 CAGGATAATCCCTTGAACTCAGG + Intergenic
1195765956 X:108297404-108297426 CTGGATAATTCTATGTTGTGAGG + Intronic
1195817400 X:108903544-108903566 CAGGGTGATCCCTTGATATGTGG - Intergenic
1196216493 X:113058310-113058332 CTGGATAATTCTTTATTGTGAGG + Intergenic
1197330771 X:125151833-125151855 CTGGATAATTCTTTGTTGTGAGG - Intergenic
1197992188 X:132330148-132330170 CTGAATCATTCCTTGTTGTGGGG + Intergenic
1198161892 X:134016285-134016307 CTGGATAATTCTTTGTTGTGGGG + Intergenic
1198426673 X:136527910-136527932 CAGGATAATCCCTAGGTTTGGGG - Intergenic
1200803661 Y:7410416-7410438 CTGGATAATCCTTTGTCCTGAGG + Intergenic
1201531802 Y:14998418-14998440 CAGGAGAATCACTTGTACTGGGG - Intergenic