ID: 1078570295

View in Genome Browser
Species Human (GRCh38)
Location 11:12452147-12452169
Sequence CCTTATATGCAAGCGGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 70}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078570288_1078570295 5 Left 1078570288 11:12452119-12452141 CCCAGGGCCAGTGCTGCTCATCT 0: 1
1: 0
2: 1
3: 28
4: 228
Right 1078570295 11:12452147-12452169 CCTTATATGCAAGCGGAAACAGG 0: 1
1: 0
2: 0
3: 7
4: 70
1078570289_1078570295 4 Left 1078570289 11:12452120-12452142 CCAGGGCCAGTGCTGCTCATCTC 0: 1
1: 0
2: 2
3: 28
4: 277
Right 1078570295 11:12452147-12452169 CCTTATATGCAAGCGGAAACAGG 0: 1
1: 0
2: 0
3: 7
4: 70
1078570284_1078570295 23 Left 1078570284 11:12452101-12452123 CCTGAGCAATCCATTTAGCCCAG 0: 1
1: 0
2: 0
3: 8
4: 86
Right 1078570295 11:12452147-12452169 CCTTATATGCAAGCGGAAACAGG 0: 1
1: 0
2: 0
3: 7
4: 70
1078570287_1078570295 13 Left 1078570287 11:12452111-12452133 CCATTTAGCCCAGGGCCAGTGCT 0: 1
1: 0
2: 3
3: 14
4: 176
Right 1078570295 11:12452147-12452169 CCTTATATGCAAGCGGAAACAGG 0: 1
1: 0
2: 0
3: 7
4: 70
1078570282_1078570295 30 Left 1078570282 11:12452094-12452116 CCCGGCACCTGAGCAATCCATTT 0: 1
1: 0
2: 0
3: 15
4: 159
Right 1078570295 11:12452147-12452169 CCTTATATGCAAGCGGAAACAGG 0: 1
1: 0
2: 0
3: 7
4: 70
1078570283_1078570295 29 Left 1078570283 11:12452095-12452117 CCGGCACCTGAGCAATCCATTTA 0: 1
1: 0
2: 0
3: 15
4: 139
Right 1078570295 11:12452147-12452169 CCTTATATGCAAGCGGAAACAGG 0: 1
1: 0
2: 0
3: 7
4: 70
1078570290_1078570295 -2 Left 1078570290 11:12452126-12452148 CCAGTGCTGCTCATCTCCCTGCC 0: 1
1: 0
2: 3
3: 42
4: 442
Right 1078570295 11:12452147-12452169 CCTTATATGCAAGCGGAAACAGG 0: 1
1: 0
2: 0
3: 7
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078570295 Original CRISPR CCTTATATGCAAGCGGAAAC AGG Intronic
911268647 1:95774328-95774350 CCTTCTATGCACCAGGAAACAGG + Intergenic
914260240 1:145992991-145993013 TCTTAAATGTAAGCTGAAACTGG - Exonic
922923263 1:229326882-229326904 CCTTATTTGCTAGAGGAAACAGG - Exonic
923985779 1:239380293-239380315 CCTTTTATGGATGGGGAAACTGG - Intergenic
1063721384 10:8585481-8585503 CCCTATATGAATGAGGAAACCGG + Intergenic
1074069647 10:110053268-110053290 CATTATACCCAAGCAGAAACTGG - Intronic
1078032788 11:7770146-7770168 CCTTATTAGAAAGCTGAAACTGG + Intergenic
1078570295 11:12452147-12452169 CCTTATATGCAAGCGGAAACAGG + Intronic
1080223174 11:29930666-29930688 TTTTATATGCAAGAAGAAACAGG - Intergenic
1084012492 11:66360405-66360427 CCTTTTATGGAAGAGGAGACTGG - Intronic
1085355778 11:75835497-75835519 CATTTTATGGAAGGGGAAACAGG - Intronic
1085700281 11:78739829-78739851 CATTGTATGGAAGAGGAAACTGG + Intronic
1093760264 12:22902071-22902093 CCATATGTGAAAGCTGAAACTGG + Intergenic
1093800914 12:23372021-23372043 CCTTATATGCCAGCTGAAATTGG - Intergenic
1097435752 12:59550606-59550628 CCTTATATCCAGGGGGAAAGAGG + Intergenic
1099181253 12:79474354-79474376 CCTAATATCCAGGCGGAAAGAGG + Intergenic
1099828267 12:87807150-87807172 CCTAATATGCAATGGGAAGCTGG - Intergenic
1100878923 12:98994774-98994796 CCTTATAAGAAAGAGGAAATTGG - Intronic
1103036368 12:117660087-117660109 CCTTAAATGCCAGCTGGAACAGG - Intronic
1108882121 13:55133097-55133119 CCATATGTACAAGCTGAAACTGG - Intergenic
1114436429 14:22711070-22711092 CCTAATATCCAAGAGGAGACAGG + Intergenic
1116517169 14:45817064-45817086 CCTAATATGCAGGGGGAAATAGG + Intergenic
1121235629 14:92389619-92389641 CGTTATATGGAAGGGGACACAGG + Intronic
1122285598 14:100650332-100650354 CCTGATTAGCAAGGGGAAACTGG - Intergenic
1131060676 15:89402311-89402333 CCTTTTATAAAAGAGGAAACTGG + Intergenic
1132502957 16:292725-292747 CCTTATGAGCAAGCTGAAAATGG + Intronic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1138284114 16:55794769-55794791 CCTTATCAGCAAGAGGAAGCCGG + Intergenic
1138284888 16:55802218-55802240 CCTTATCAGCAAGAGGAAGCCGG - Intergenic
1144631878 17:16877724-16877746 CCCTAAATGCAAGTGGAGACAGG - Intergenic
1149805179 17:59610428-59610450 CCTTTTATAAAAGGGGAAACAGG + Intergenic
1159680925 18:71351043-71351065 CCTTCTATGAAACAGGAAACAGG + Intergenic
926492332 2:13539792-13539814 CCTTATATAAAAGTGGAAATAGG + Intergenic
933086160 2:78057038-78057060 CCTTACATGCCAGAAGAAACTGG - Intergenic
933456929 2:82529151-82529173 CCTAATATGCAAGGGGAGAGAGG + Intergenic
942520766 2:176801211-176801233 CCCTATGTGGAAGCTGAAACTGG + Intergenic
943946836 2:194076460-194076482 ACTTATATGCAAGAGGCAAAGGG - Intergenic
944144632 2:196493817-196493839 CCTTTTATGCTATTGGAAACTGG + Intronic
1172619849 20:36311706-36311728 CATTTTATGGAAGAGGAAACTGG + Intronic
1173169737 20:40714266-40714288 CCTTTTATAGAAGAGGAAACTGG + Intergenic
1173429107 20:42969945-42969967 CATTATATGGATGAGGAAACAGG + Intronic
1173798528 20:45879692-45879714 CCTTATATTCTAGCGGGAAGAGG + Intergenic
1179557516 21:42189869-42189891 TCTTAAATGCAAGCTGACACTGG - Intergenic
951172766 3:19561536-19561558 CCTTATAAGAAAGAGGAAAAAGG + Intergenic
951416133 3:22423717-22423739 CCTTATATGCTAGCTGCAATTGG + Intergenic
952567053 3:34671118-34671140 CCTTATAGGCAAGGGGAGAGTGG + Intergenic
953086112 3:39669181-39669203 CCTTAAATACAAGAGGAAAAAGG + Intergenic
959587077 3:108034666-108034688 CCTGAGATGCACCCGGAAACGGG + Intergenic
960353872 3:116627433-116627455 CCTTATAGGCCAGGGGAGACTGG - Intronic
965273038 3:166643294-166643316 CCATATATGAATGAGGAAACTGG + Intergenic
967330643 3:188286033-188286055 ACTTATATGGAGGCGGAAATGGG + Intronic
977796500 4:101171836-101171858 CCTTATATCCTAGCAGAAATCGG - Intronic
978816643 4:112914062-112914084 CCTTTTGTGAAAGTGGAAACTGG + Intronic
992658911 5:78938713-78938735 TCTTATATGTAAGGGGAAAAGGG + Intronic
995841194 5:116444923-116444945 CCTTATTTGCTAGCAGAAAAGGG - Exonic
996568618 5:124908113-124908135 TCTTATTTACAAGTGGAAACAGG - Intergenic
1000655417 5:163872900-163872922 CCATATATAGAAGCTGAAACTGG + Intergenic
1005383183 6:25258768-25258790 ACTTAAATGTAAGGGGAAACTGG + Intergenic
1009248757 6:61273286-61273308 CCATATGTGAAAGCTGAAACTGG + Intergenic
1011934541 6:92758964-92758986 ACTTATATTCAGGCAGAAACTGG + Intergenic
1015085205 6:129282518-129282540 CCTTATATGCAAGGGTAGAGGGG + Intronic
1017565383 6:155679377-155679399 CATTTTATACAAGGGGAAACTGG + Intergenic
1019836392 7:3389330-3389352 CCTTATAAGAGAGAGGAAACAGG + Intronic
1023534733 7:41196330-41196352 CCCTCTATGCCAGCAGAAACAGG - Intergenic
1026562898 7:71465047-71465069 CCTTTTATGCTAGGGGAAAGGGG + Intronic
1030266047 7:107622990-107623012 CCTTGTATGTAAGTGGAAATAGG + Exonic
1032541359 7:132705702-132705724 CCTTATATGCAGAAGGAAACAGG + Intronic
1034675652 7:152891077-152891099 CCTTTTATACATGAGGAAACAGG + Intergenic
1036240067 8:7073919-7073941 CCTAATATCCAGGGGGAAACAGG - Intergenic
1036905735 8:12707176-12707198 CCTAATATGCAAGTGGGGACAGG + Intergenic
1044734356 8:95264027-95264049 CATTATATTCAAGAGGAAGCTGG + Intronic
1050880754 9:10697260-10697282 CCTGAGAGGCAAGCGGAAACCGG - Intergenic
1054771054 9:69084382-69084404 CCTTATATGCCAGCTAAAACTGG - Intronic
1055255523 9:74365593-74365615 CCTTAAAAGCAACCAGAAACAGG - Intergenic
1059064668 9:111070448-111070470 CCATATATGCATGAGGAAACTGG + Intergenic
1187008760 X:15258154-15258176 CATTTTATGAAAGCAGAAACCGG + Intronic
1195938931 X:110150989-110151011 CCTTTTATGGAAGAGGAAACTGG + Intronic
1201506218 Y:14703358-14703380 CCGTATGTGAAAGCTGAAACTGG - Intronic