ID: 1078570669

View in Genome Browser
Species Human (GRCh38)
Location 11:12455150-12455172
Sequence GTGTGTCTCTTCAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4806
Summary {0: 1, 1: 0, 2: 3, 3: 180, 4: 4622}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078570658_1078570669 23 Left 1078570658 11:12455104-12455126 CCCTGCATTTCCCAAAAACTGAT 0: 1
1: 0
2: 2
3: 36
4: 264
Right 1078570669 11:12455150-12455172 GTGTGTCTCTTCAGGGAAGATGG 0: 1
1: 0
2: 3
3: 180
4: 4622
1078570663_1078570669 12 Left 1078570663 11:12455115-12455137 CCAAAAACTGATGGGTAGATATA 0: 1
1: 0
2: 0
3: 17
4: 197
Right 1078570669 11:12455150-12455172 GTGTGTCTCTTCAGGGAAGATGG 0: 1
1: 0
2: 3
3: 180
4: 4622
1078570657_1078570669 24 Left 1078570657 11:12455103-12455125 CCCCTGCATTTCCCAAAAACTGA 0: 1
1: 0
2: 2
3: 25
4: 289
Right 1078570669 11:12455150-12455172 GTGTGTCTCTTCAGGGAAGATGG 0: 1
1: 0
2: 3
3: 180
4: 4622
1078570662_1078570669 13 Left 1078570662 11:12455114-12455136 CCCAAAAACTGATGGGTAGATAT 0: 1
1: 0
2: 0
3: 17
4: 213
Right 1078570669 11:12455150-12455172 GTGTGTCTCTTCAGGGAAGATGG 0: 1
1: 0
2: 3
3: 180
4: 4622
1078570656_1078570669 29 Left 1078570656 11:12455098-12455120 CCTGACCCCTGCATTTCCCAAAA 0: 1
1: 0
2: 2
3: 48
4: 308
Right 1078570669 11:12455150-12455172 GTGTGTCTCTTCAGGGAAGATGG 0: 1
1: 0
2: 3
3: 180
4: 4622
1078570655_1078570669 30 Left 1078570655 11:12455097-12455119 CCCTGACCCCTGCATTTCCCAAA 0: 1
1: 0
2: 3
3: 41
4: 390
Right 1078570669 11:12455150-12455172 GTGTGTCTCTTCAGGGAAGATGG 0: 1
1: 0
2: 3
3: 180
4: 4622
1078570659_1078570669 22 Left 1078570659 11:12455105-12455127 CCTGCATTTCCCAAAAACTGATG 0: 1
1: 0
2: 1
3: 17
4: 194
Right 1078570669 11:12455150-12455172 GTGTGTCTCTTCAGGGAAGATGG 0: 1
1: 0
2: 3
3: 180
4: 4622

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078570669 Original CRISPR GTGTGTCTCTTCAGGGAAGA TGG Intronic
Too many off-targets to display for this crispr