ID: 1078575056

View in Genome Browser
Species Human (GRCh38)
Location 11:12494302-12494324
Sequence ATGAGAAAGGGGAAGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1199
Summary {0: 1, 1: 0, 2: 11, 3: 123, 4: 1064}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078575056_1078575067 -6 Left 1078575056 11:12494302-12494324 CCAGCTTCCTTCCCCTTTCTCAT 0: 1
1: 0
2: 11
3: 123
4: 1064
Right 1078575067 11:12494319-12494341 TCTCATGGGTCGGGGGTATGAGG 0: 1
1: 0
2: 0
3: 13
4: 255
1078575056_1078575069 27 Left 1078575056 11:12494302-12494324 CCAGCTTCCTTCCCCTTTCTCAT 0: 1
1: 0
2: 11
3: 123
4: 1064
Right 1078575069 11:12494352-12494374 CAATCCTTTAATCATATGCTTGG 0: 1
1: 0
2: 5
3: 39
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078575056 Original CRISPR ATGAGAAAGGGGAAGGAAGC TGG (reversed) Intronic
900015081 1:142777-142799 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
900016684 1:155599-155621 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
900045348 1:501386-501408 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
900046945 1:514191-514213 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
900067545 1:743116-743138 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
900069148 1:755909-755931 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
900439368 1:2645698-2645720 AGCAGGAAGGGGCAGGAAGCTGG - Intronic
900679898 1:3910971-3910993 ATGAGACAGGGGAACGAAGTCGG + Intergenic
900932906 1:5747861-5747883 AAGGGAAAGGGGAGGGAGGCAGG + Intergenic
901228460 1:7628761-7628783 AAGAGACAGGGGAGGGCAGCAGG + Intronic
901439039 1:9266332-9266354 CTGAGACTGGGGAAGTAAGCGGG + Exonic
901945677 1:12701707-12701729 GCAAGAAAAGGGAAGGAAGCCGG + Intergenic
902546194 1:17191979-17192001 AAGAAAAAGGAGAAGGAAGAGGG - Intergenic
902652077 1:17843660-17843682 AAGTGAAAGGAGAAGGAAGGTGG - Intergenic
902816185 1:18918011-18918033 CAGAGGAAGGGGCAGGAAGCGGG + Intronic
902987926 1:20166720-20166742 ATGAGAAAGGGAGAGGGGGCAGG - Intronic
903053179 1:20616674-20616696 ATGAAAAAGCTGAAGGAGGCAGG + Intronic
903331791 1:22600338-22600360 AGGAGAAAGGAGAAGGAAGTGGG + Intronic
903799460 1:25955717-25955739 AAGAGAAAAAGGAAGGAAGGAGG + Intergenic
903853671 1:26322873-26322895 TTGAGTAAGGGGGAGGTAGCAGG - Intronic
904087191 1:27917133-27917155 AGGAGGAAGGGGAAGGAGGAAGG - Intergenic
904348512 1:29889856-29889878 AGGAGAAATGGGAAGGAGGCAGG + Intergenic
904389402 1:30171916-30171938 AAGGGAAAGGGGAAGAAGGCTGG + Intergenic
904409511 1:30316950-30316972 ATGAGAAAAGGCATGGAAGTGGG - Intergenic
904648953 1:31989807-31989829 ATGAAAAAGGTGAAGGATGCCGG - Intergenic
904721225 1:32510373-32510395 GACAGAAAGGGGGAGGAAGCAGG - Intronic
904772029 1:32886120-32886142 GTGGGTATGGGGAAGGAAGCGGG + Intronic
904848834 1:33441545-33441567 AGGAGGAAGGAGAAGGAAGAAGG - Intergenic
905012934 1:34759391-34759413 AGGAGAGAGGGCAAGGAGGCAGG + Intronic
905776372 1:40669903-40669925 GTGAGGAAGAGGAAGGAATCAGG - Intergenic
906114548 1:43348041-43348063 ATGAGTAAGGGGAAGGGATAAGG - Intronic
906651387 1:47515489-47515511 AGGAGAAAAGGGAAGGATGGTGG + Intergenic
906749349 1:48245208-48245230 AAGAGAAGGAGGAAGGAAGAAGG + Intronic
906869010 1:49455777-49455799 ATGAGCAAAGGGAAGGTAGCAGG - Intronic
906884700 1:49631690-49631712 AAGACTAAGGGAAAGGAAGCAGG + Intronic
907325410 1:53634897-53634919 ATGAGATGGGGGATGGAAGGCGG - Intronic
907459538 1:54597226-54597248 ATGGGATAAGGGAGGGAAGCAGG - Intronic
907517562 1:55002282-55002304 ATGAGAGAGGAGAAGGGATCAGG + Intronic
907535662 1:55153465-55153487 ATGAGAGAGAGAAAGGAAGGAGG - Intronic
907708153 1:56850634-56850656 AAGAGAAAGTGGAAGAAAGGAGG - Intergenic
907770116 1:57453076-57453098 ATGGGAAAGGGGTAGAAAGAAGG + Intronic
907837608 1:58125985-58126007 AGGAGCCAGGGGAAGGGAGCAGG + Intronic
908043410 1:60141488-60141510 ATGGAAAAGCAGAAGGAAGCTGG + Intergenic
908300843 1:62759652-62759674 ATCAAAAAGGGGAAGGAAAGGGG + Intergenic
908605668 1:65793903-65793925 GTGAAAAACGGGAAGGAAGGAGG - Intronic
908630313 1:66098401-66098423 CTGAGAAAAGGTAAAGAAGCAGG - Intronic
908825212 1:68126369-68126391 AGGAGGAAGGAGAAGCAAGCTGG + Intronic
909540061 1:76781378-76781400 TGGAGAGAGGGAAAGGAAGCCGG - Intergenic
910114658 1:83718602-83718624 ATAAGAAAGGTGAAGCCAGCCGG - Intergenic
910240351 1:85079681-85079703 TTGAGAGAGGGGAGGGCAGCAGG + Intronic
910549601 1:88461111-88461133 ATGTGAAAGGAGCAGGAAGCAGG + Intergenic
910712469 1:90196120-90196142 ATGAGAAAGGGGAAAGTACTGGG - Intergenic
910714312 1:90214483-90214505 CTGACAAAAGGGAAGCAAGCTGG - Intergenic
911276701 1:95869106-95869128 ATGAGAAGAGGAAAGGCAGCAGG + Intergenic
911511848 1:98816717-98816739 AAGAGAACTTGGAAGGAAGCTGG - Intergenic
911951008 1:104173169-104173191 GTGTGAAAGGGGACGGGAGCAGG - Intergenic
912023412 1:105137513-105137535 GGCAGACAGGGGAAGGAAGCTGG + Intergenic
912100859 1:106202387-106202409 ATCTGAAAGGGCAAGGGAGCTGG + Intergenic
912139335 1:106702715-106702737 AAGGGAAAGGGCAAGGAAGAAGG - Intergenic
912157375 1:106938434-106938456 ATGGGAAAAGAGAAGGATGCTGG - Intergenic
912183301 1:107244651-107244673 AGGAGAAGGAGGAAGGAAGAGGG - Intronic
912359148 1:109080435-109080457 AAGAAAAAGGGGAAAGAAGTTGG + Intergenic
912510002 1:110182929-110182951 ATGAGAAATGGGATGGTAACTGG + Intronic
912580281 1:110714735-110714757 ATGAGTAGGGGGAAGGGAGCGGG + Intergenic
912727100 1:112068132-112068154 CTGAGGAAGGGAAAGGAAACTGG + Intergenic
913092032 1:115482797-115482819 CTGAGATAGGTGAAGGAATCAGG - Intergenic
913322876 1:117601583-117601605 ATGAGAAAGGGGTACGAGGTTGG + Intergenic
913703041 1:121392281-121392303 AGGAGGAGGGGGAAGGAAGAAGG - Exonic
913979211 1:143493442-143493464 AGGAGGAGGGGGAAGGAAGAAGG - Intergenic
913998889 1:143675515-143675537 ATCAGAATGGGGAAGAAAGGGGG + Intergenic
914043602 1:144072776-144072798 AGGAGGAGGGGGAAGGAAGAAGG - Intergenic
914073614 1:144319092-144319114 AGGAGGAGGGGGAAGGAAGAAGG - Intergenic
914105541 1:144647268-144647290 AGGAGGAGGGGGAAGGAAGAAGG + Intergenic
914134485 1:144887715-144887737 AGGAGGAGGGGGAAGGAAGAAGG + Exonic
914439454 1:147691093-147691115 AGGAGAAAGGGGGAGAAAGAGGG - Intergenic
914994852 1:152534543-152534565 TTGAGAAAGGGGCGCGAAGCAGG + Intronic
915010101 1:152677327-152677349 TAGAGGAAGGGGAGGGAAGCAGG + Intergenic
915041493 1:152971676-152971698 ATGAGAATGGGCAAGGATGTAGG - Intronic
915122873 1:153642462-153642484 AAGAGAAAAGGGAAGGGAGTAGG - Intronic
915157606 1:153891269-153891291 AAGAAAAAAGGGAAGGCAGCCGG + Intronic
916160953 1:161914247-161914269 ATGAGGAAGGGGAAAAAATCAGG - Intronic
916600717 1:166290719-166290741 ATGTGAAAGGGGAAGGGGTCTGG + Intergenic
916874907 1:168958790-168958812 TTGAGATAGGGGAAGGAGGAGGG - Intergenic
917145905 1:171891166-171891188 ATAAGGAAGGTGAAGGAGGCAGG + Intronic
917238167 1:172917163-172917185 ATGTGAAAGGGGTAGGAGTCAGG - Intergenic
917443504 1:175087305-175087327 AAGAGAAAGGAGCAGGTAGCGGG + Intronic
917452884 1:175161855-175161877 ATGAGGAAGAGGAAGGTAGAAGG - Intronic
917610915 1:176688240-176688262 ATGAAAAAGGTGAAGGCACCTGG + Intronic
918045711 1:180939828-180939850 ATGAGAAAGGGGGAAGAGGCAGG - Intronic
918224622 1:182470368-182470390 ATGAGTGAGGGGAGGGAAGTAGG - Intronic
918317101 1:183331372-183331394 AGGAGAGAGGAGAAGGGAGCTGG + Intronic
918562054 1:185880740-185880762 ATGAAATAGGGGAATGAAGTTGG + Intronic
918840236 1:189526376-189526398 ATGAGTAAGCGGAAGTAAGAAGG + Intergenic
919003041 1:191859613-191859635 AGGAGAGAGAGGAAGGAAGGAGG - Intergenic
919123462 1:193369380-193369402 ATCAGACAGGGGAAGGAGGCTGG - Intergenic
919317090 1:195985202-195985224 TTGAGAAAGAGGAACAAAGCTGG - Intergenic
919514392 1:198503711-198503733 TTGAGAAAGAAGAATGAAGCTGG - Intergenic
919550596 1:198981160-198981182 ATGAGAAAGGGGGAGGGCCCTGG + Intergenic
919842552 1:201619759-201619781 ATGAGGAAGAGGCAGGAGGCAGG + Intergenic
919849588 1:201663665-201663687 ATGAGAGAAGAGAAGGAACCAGG - Intronic
919912534 1:202120604-202120626 AAGAGAAAAGGAAAGGAAGTTGG - Intergenic
920055898 1:203191474-203191496 ATGATAAAGGACAAGGAACCTGG - Intergenic
920389371 1:205589369-205589391 ATGAGGATGGGGAAGTAAACAGG + Intronic
920439383 1:205968992-205969014 AGGAGAAAGTGGAATGAAGCTGG + Intergenic
920947335 1:210542028-210542050 AAGAGAAAGCAGAAGGAAGGAGG - Intronic
921080861 1:211737499-211737521 ATGAGGAATGGGAAGGAGCCAGG - Intergenic
921364984 1:214365129-214365151 ATCAGTGAGGGGAAGGAAGAAGG - Intronic
921408526 1:214809241-214809263 ATGAGAAAGTGGAAGGCATGAGG + Intergenic
921714706 1:218406138-218406160 ATTAGAAAGGAAAAGGAAACGGG - Intronic
921756666 1:218864676-218864698 AAGGGAAGGGGGAAGGTAGCAGG - Intergenic
921942159 1:220853518-220853540 ATGGGAAAGGGAAAGGAGGAAGG - Intergenic
922102148 1:222485889-222485911 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
922104509 1:222501301-222501323 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
922147124 1:222957629-222957651 TTTAGAAAGGTGAAAGAAGCAGG - Intronic
922227223 1:223655973-223655995 ATCAGAAAGGACCAGGAAGCAGG + Intronic
922263231 1:223961000-223961022 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
922264827 1:223973814-223973836 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
923012166 1:230096479-230096501 AGGGGAAAGGGGAAGGAAGGCGG - Intronic
923260312 1:232261847-232261869 ATGAGAGAGGGGAAGCCAGCAGG + Intergenic
923455815 1:234164354-234164376 AGGAGAGAGGGGAAAGAAGGAGG - Intronic
923672478 1:236052492-236052514 GTGAGAAAGAGGAAGGAACCAGG - Intronic
924257273 1:242194871-242194893 AGGAGGAAAGGGAGGGAAGCGGG + Intronic
924345071 1:243066009-243066031 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
924346684 1:243078820-243078842 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
924497201 1:244601998-244602020 AAGGGGAAGGGGAAGGAAGGAGG + Intronic
924547819 1:245046796-245046818 ATGAGGTAGGGGAAGGGAGGTGG - Intronic
924650967 1:245927137-245927159 ATTGGAAAGGAGAAGGAAACGGG + Intronic
1062946968 10:1468733-1468755 AGGCGAAAGGGAAAGGTAGCCGG - Intronic
1063475333 10:6323477-6323499 GTGAGAAAGGGGCATGAGGCTGG - Intergenic
1063758582 10:9044935-9044957 ACGTGAAAGGGGAAGGAAGGAGG - Intergenic
1063901266 10:10734668-10734690 AAGAGAAAAGGGAAGGAAATAGG + Intergenic
1065518759 10:26551670-26551692 CTGAGTAAGGGGTAGGAAGCAGG - Intronic
1066549383 10:36538537-36538559 AAGAGAGAAGGGAAGGAGGCAGG + Intergenic
1066729665 10:38426029-38426051 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1067145283 10:43689605-43689627 GTCAGAAAGCGGACGGAAGCTGG + Intergenic
1068248567 10:54406458-54406480 AGGAGAAAGGAGGAGGAAGAGGG - Intronic
1068289253 10:54981225-54981247 ACGAGAGAAGGGGAGGAAGCTGG - Intronic
1068475627 10:57520771-57520793 AAGATAAAGAGAAAGGAAGCAGG + Intergenic
1068586230 10:58802140-58802162 ATAAGTAAAGGAAAGGAAGCAGG - Intronic
1068788030 10:60998606-60998628 AAGAAAAACGGGAAGGAAGGGGG + Intronic
1068797251 10:61097187-61097209 ATGAGAAAGGAAAAGGAAGTGGG - Intergenic
1068956629 10:62824260-62824282 GTGAGAAAGGTGGAGGGAGCAGG + Intronic
1069078450 10:64063325-64063347 AAAAAAAAGGGGAAGGAAGGAGG - Intergenic
1069108171 10:64409424-64409446 AAAAGAAAGAGGAAGGAAGGAGG + Intergenic
1069133935 10:64740692-64740714 ATGAGAAAAGGGAAGGATGCCGG - Intergenic
1069178914 10:65331767-65331789 GTGAGAGATGAGAAGGAAGCAGG + Intergenic
1069250915 10:66265802-66265824 ATGAGTGATAGGAAGGAAGCAGG - Intronic
1069718518 10:70535587-70535609 AAGAGGAAGGAGAAGGAAGGAGG - Intronic
1069917067 10:71793707-71793729 AAGAGAAAGGAGAAAGAAGGGGG - Intronic
1069933794 10:71901196-71901218 ATGGGAATGGGGAGGGAAGATGG - Intergenic
1069933801 10:71901215-71901237 ATGGGAATGGGGAGGGAAGATGG - Intergenic
1069933808 10:71901234-71901256 ATGGGAATGGGGAGGGAAGATGG - Intergenic
1070310055 10:75266425-75266447 AGGTGAAAGAGGGAGGAAGCAGG - Intergenic
1070647715 10:78212957-78212979 ATGAGGAAGAGGAAAGAAGAGGG - Intergenic
1071175729 10:82924427-82924449 ATGAGGAAGGGGTAGGAAGTTGG + Intronic
1071324687 10:84501415-84501437 AGGAGAAAGGGGGAGGAACATGG - Intronic
1071785338 10:88893443-88893465 ATGAAAAAAGTGAAGGGAGCTGG + Intronic
1071808832 10:89155602-89155624 CTGAGAAACAGGAAGGAAGAGGG + Intergenic
1072421667 10:95294938-95294960 ATGAGAAGAGGGAAGCAAGGAGG + Intergenic
1072645548 10:97251324-97251346 AGGGGAAAGGGAAAGGAAGGGGG + Intronic
1072899278 10:99393193-99393215 TGGAGGAAGGGGAGGGAAGCTGG - Exonic
1072948692 10:99834001-99834023 AGGACCAAGGGGAAGGGAGCTGG - Intronic
1072979502 10:100087911-100087933 AGGAGAAAGGGGAAGGGAGAGGG + Intergenic
1073121925 10:101127193-101127215 AGGAGGGAGGGGAAGAAAGCAGG - Intronic
1073502271 10:103951170-103951192 CTTAGAGAGGGGAAGGAAGCAGG + Intergenic
1073772709 10:106752769-106752791 AGGAGAATGGGGGAGGAAGTGGG + Intronic
1073821668 10:107271556-107271578 ACTAGAAAGGGCAAAGAAGCAGG - Intergenic
1073873384 10:107892099-107892121 ATGAGAAAGTAGAAGGAAGCTGG - Intergenic
1074247333 10:111708113-111708135 TTGAGAAAGGGAAAGCAAGATGG - Intergenic
1074691135 10:116005087-116005109 AGGAGGAAGGGGAAGGGAGAGGG - Intergenic
1075122676 10:119675813-119675835 GGGGGAAGGGGGAAGGAAGCAGG - Intronic
1075585430 10:123653782-123653804 ATGGGGAAGGGGAAGGGAGAAGG + Intergenic
1075626164 10:123965872-123965894 ATTAGAAAGGGAAAGGGTGCTGG - Intergenic
1075640498 10:124060911-124060933 GGGAGAAAGGGAAAGGAACCAGG + Intronic
1076268829 10:129132814-129132836 TTGAGAAAGAGGCAGGATGCAGG - Intergenic
1076821670 10:132942738-132942760 AGAAGAAAGGGGAGGGAAGGCGG + Intronic
1076870885 10:133193582-133193604 AGGAAAAAGGAGAAGGAAGGAGG + Intronic
1076898974 10:133327840-133327862 AGGAGAAGGTGGAAGGCAGCTGG - Intronic
1076973274 11:150668-150690 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1077143039 11:1033268-1033290 ACGAGAGCAGGGAAGGAAGCTGG - Intronic
1077243613 11:1524977-1524999 CTGGGGAAGGGGAAGGAAGGTGG + Intergenic
1077705425 11:4480707-4480729 AAGATGAAGGGGAAGCAAGCAGG - Intergenic
1077831359 11:5874723-5874745 GTGAGAAAGGAGAAGAGAGCTGG - Intronic
1078025405 11:7690276-7690298 ATGAGAATGTGTAAGGAAGCTGG + Intronic
1078409841 11:11105410-11105432 ATGAGACTGAGGTAGGAAGCAGG + Intergenic
1078441676 11:11373388-11373410 GTGAGAAAGGGAGAGGAATCTGG + Intronic
1078575056 11:12494302-12494324 ATGAGAAAGGGGAAGGAAGCTGG - Intronic
1078657455 11:13255093-13255115 AAGAGAAAGGGAATGGAATCTGG + Intergenic
1078694905 11:13620999-13621021 AGGATGAAGGGGTAGGAAGCTGG - Intergenic
1078729082 11:13959673-13959695 AGGAGAAAGGAGAAAGAAGAAGG + Intergenic
1078757869 11:14228431-14228453 GGGAGGCAGGGGAAGGAAGCAGG + Intronic
1079084955 11:17438689-17438711 AAGACAAAGTGGGAGGAAGCTGG - Intronic
1079189384 11:18265119-18265141 AAGAGAGAGAGGAAGGAAGGAGG + Intergenic
1080290896 11:30670288-30670310 AGGACAAAGGGAAAGGAACCAGG - Intergenic
1080295297 11:30720326-30720348 AAGAGAAAGAAGAAGGAAGAAGG - Intergenic
1080340214 11:31254200-31254222 ATAAAGAAGGGTAAGGAAGCTGG + Intronic
1080377827 11:31734908-31734930 ATGAGAAAGAAGAACAAAGCTGG + Intronic
1080704358 11:34676210-34676232 ATCAGAAAAGGAATGGAAGCAGG - Intergenic
1081114207 11:39177926-39177948 AAGAGAAAGGGAAGGAAAGCGGG + Intergenic
1081177894 11:39951390-39951412 AAGACAAAGGGGAAGCAAGCAGG - Intergenic
1081192272 11:40118723-40118745 ACGAGAATGAGAAAGGAAGCTGG + Intronic
1081540001 11:44027565-44027587 CTGAAAAAGGGGAAAGAAGAAGG - Intergenic
1081598640 11:44476591-44476613 AGGAGACAGTGGGAGGAAGCAGG + Intergenic
1081941340 11:46944794-46944816 ATAGAAAATGGGAAGGAAGCCGG - Intronic
1082190095 11:49232584-49232606 TGAAGGAAGGGGAAGGAAGCAGG - Intergenic
1082262424 11:50087179-50087201 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1082790852 11:57345934-57345956 ATGAGAACAGAGGAGGAAGCGGG - Intronic
1083108578 11:60382777-60382799 AGGAGATAGGGAAGGGAAGCTGG + Intronic
1083131263 11:60624825-60624847 ATGATAAAGGGGAAGTCAGGAGG + Intergenic
1083186770 11:61022219-61022241 AGGAGAAAGGGGAAGCCAGGAGG + Intergenic
1083224631 11:61276992-61277014 AGGAGACAGAGGAAGGAAGGAGG + Intronic
1083259965 11:61517570-61517592 ATGAGGAAGGGCAGGCAAGCTGG + Intronic
1083792110 11:64992562-64992584 ATAAGAAGAGGGAAGGAGGCTGG + Intronic
1083940306 11:65891874-65891896 AAGACAATGGGGCAGGAAGCAGG + Intergenic
1084194776 11:67518238-67518260 AAGGTAAAGGGGGAGGAAGCAGG + Intergenic
1085158001 11:74313645-74313667 CTACGAAAGGGAAAGGAAGCAGG - Intergenic
1085178052 11:74507829-74507851 GTGAGGAAGGTGAAGGAAGTGGG - Intronic
1085430018 11:76439834-76439856 ATCAGAAAGGGGAATAAAGGAGG - Intergenic
1085763915 11:79265757-79265779 ATGAGAGATGGGGAGGAAACAGG + Intronic
1085973135 11:81618261-81618283 CTGAGAAAGGTAAAGGATGCAGG + Intergenic
1086457071 11:86969524-86969546 AGGAGAAAGGGGATGGCAGAGGG - Intergenic
1086676034 11:89608348-89608370 TGAAGGAAGGGGAAGGAAGCAGG + Intergenic
1087792362 11:102420127-102420149 ATGAGGATGGGGAAGGGATCTGG - Intronic
1088011157 11:105002420-105002442 AAGAAAAAGGAGAAGGAAGGGGG - Intronic
1088264349 11:107975244-107975266 AAGGGAAAGAGGGAGGAAGCAGG + Intergenic
1088744461 11:112794032-112794054 AGGAGAAAGGGGAAGAAGGAAGG + Intergenic
1089189665 11:116644679-116644701 AAGAGAAAGGGGGGTGAAGCGGG + Intergenic
1089257303 11:117200627-117200649 AGGAGGAAGGGGAAGGATGGTGG + Intronic
1089322470 11:117635728-117635750 ATGAGAAAGGAGAAGAAATGAGG + Intronic
1089597007 11:119586661-119586683 ATGAGAAAGCTGGAGGGAGCGGG + Intergenic
1089744907 11:120609829-120609851 AGGAGAAAGGGGTAGAAGGCAGG - Intronic
1090252389 11:125260882-125260904 TGGAGAAGTGGGAAGGAAGCTGG + Intronic
1090437050 11:126695744-126695766 CTGAGAGAGGGGAAGGAGGCAGG + Intronic
1090703502 11:129316369-129316391 AGGGCAAAGGGGATGGAAGCTGG - Intergenic
1090898893 11:131007553-131007575 AGCAGAGAGAGGAAGGAAGCAGG - Intergenic
1091013777 11:132030759-132030781 GTGAGAAAGGGAGAAGAAGCAGG + Intronic
1091395529 12:152175-152197 ACCAGAAAGGGGAAGGCAGGAGG + Intronic
1091416841 12:295254-295276 AGGAGAAAGGGGAAGGAAAAAGG + Intronic
1091485318 12:881056-881078 ATGATAAAGGAGAAAGAAACAGG + Intronic
1091650880 12:2308624-2308646 TTGAGAAAGAAGAACGAAGCTGG - Intronic
1091671426 12:2454797-2454819 ACGTGAAAGGGGAAGGAGACGGG - Intronic
1091852557 12:3712081-3712103 ATGAGAATAGGGAAGGCAGAGGG - Intronic
1092008969 12:5093849-5093871 AAGAGAGAGGGGAATGAAGGGGG - Intergenic
1092258701 12:6941055-6941077 ATGAGAAAAGGGCAGAAAGGAGG + Intronic
1092346660 12:7721135-7721157 ATGTGGAAGGGATAGGAAGCGGG + Intergenic
1092509326 12:9137466-9137488 TTGAGAAAGAAGAAGAAAGCTGG - Intergenic
1092815679 12:12310524-12310546 AGAAGAAAGGGGAAGGACACTGG + Intergenic
1092859911 12:12711429-12711451 ATGAGAAAGGGGAAAGAGAGTGG + Intergenic
1092914074 12:13173733-13173755 ATGCGGAAGGGGAAGGAGCCAGG + Intergenic
1092971916 12:13704299-13704321 ATGAGAAAGGGAAAGGATGGAGG + Intronic
1093269138 12:17037167-17037189 AAGAGGAAGGGGAAAGAAGCAGG - Intergenic
1094074040 12:26452740-26452762 TGGAGAAAGGAAAAGGAAGCAGG - Intronic
1094111792 12:26870121-26870143 ATGGGAAACGGGAAGGAAACAGG + Intergenic
1094242295 12:28242526-28242548 ATGGGAAAGGGGAAGCCATCTGG + Intronic
1094260358 12:28490143-28490165 ATGAGAAAGGGGCAGGAAGATGG - Intronic
1094747229 12:33358865-33358887 AAGAGAAAGAGGAAGTGAGCTGG - Intergenic
1095085719 12:38056005-38056027 AGGGGAAAAGGGAAGGAAGGCGG - Intergenic
1095664019 12:44773561-44773583 GTTAGAAAGAGGAAGGAAGAAGG - Intronic
1096152472 12:49323302-49323324 AGGAGAAAAGCGGAGGAAGCTGG + Exonic
1096198277 12:49663187-49663209 ATGAGAAGGGGGTGGGGAGCTGG - Intronic
1096371039 12:51069269-51069291 AAAAGAAAGGAGAAGGAAGCCGG - Intronic
1096466413 12:51849279-51849301 AGGGCAAAGGGGAAGGCAGCCGG + Intergenic
1096524231 12:52201066-52201088 ATGCGAGAGGGATAGGAAGCGGG - Intergenic
1096553401 12:52388958-52388980 AGGTGAAAGGGGAAGGGAGTGGG + Intergenic
1096572924 12:52534009-52534031 AAGAGAAAGGGGCAGGCTGCAGG + Intergenic
1096723611 12:53543318-53543340 ATGAGAAAAAGGCAAGAAGCAGG - Exonic
1096815598 12:54199986-54200008 AGGAGAAAGGGGAAGAAAGAAGG + Intergenic
1097158158 12:57027505-57027527 GTGAGTTAAGGGAAGGAAGCGGG + Intronic
1097219358 12:57438261-57438283 ATGTTAAAGTGGAAGGGAGCAGG + Intronic
1097303768 12:58046641-58046663 AGGAGAAAGGGTAAGGGACCAGG - Intergenic
1097382831 12:58916009-58916031 AAAAGAAAGGGGAAGCAATCTGG + Intronic
1097680970 12:62648446-62648468 AGGACAGAGGGGAAGAAAGCTGG - Exonic
1097695143 12:62768214-62768236 AGGAGAAAGGAAAAGGCAGCAGG + Intronic
1098460808 12:70731096-70731118 AGGAGAGAGAGGAAGGAAGGAGG + Intronic
1098539523 12:71638774-71638796 ATGAGAACAGGGAATAAAGCAGG + Intronic
1098862320 12:75723979-75724001 AAGAGAAAGGTGAAAGAACCCGG + Intergenic
1099167498 12:79324426-79324448 AGGAGAAAAGGGAATGAAGGCGG - Intronic
1099576675 12:84392039-84392061 ATGAAAAAGGGGAAGGAGAGGGG - Intergenic
1099869624 12:88330476-88330498 AAGAGAAAGGGGATGGAGGAGGG + Intergenic
1100127206 12:91441787-91441809 ATGAGAAAAGGGAGAGAAGGAGG - Intergenic
1100127407 12:91445032-91445054 TTGAGAAAGAAGAACGAAGCTGG + Intergenic
1100184497 12:92124788-92124810 ATGAGTTTAGGGAAGGAAGCCGG - Intronic
1100214050 12:92429202-92429224 ATGAGCAAGGAGATGGATGCTGG - Exonic
1100550747 12:95644415-95644437 AGAAGAAGGGGGAAGGAAGGGGG - Intergenic
1100700240 12:97139656-97139678 AAGATGAAGGGGAAGAAAGCAGG - Intergenic
1101020168 12:100545856-100545878 AGAATAAAGGGGGAGGAAGCAGG + Intronic
1101183178 12:102242248-102242270 ATGGGAGAGGGGAAGAAAGAAGG - Intergenic
1101387118 12:104267835-104267857 AAGAGAGAGAGGAAGGAAGGAGG - Intronic
1101452061 12:104788938-104788960 ATGATCAAGGGGCAGAAAGCAGG + Intergenic
1101901339 12:108793073-108793095 ATGACAACGGGGAAGGAACGCGG + Intronic
1102102240 12:110288880-110288902 AAGAGAAAGGGGAGGAAAACTGG - Intronic
1102230383 12:111257682-111257704 AGGAGGAAGGGGAAGGAGGAGGG - Intronic
1102270448 12:111530471-111530493 ATAAGAAAGGGGAAGTAAAATGG + Intronic
1102645290 12:114399805-114399827 AGGAGAAAGGCGAAGGGAGGAGG + Intronic
1102768045 12:115450613-115450635 AGGATAAAGGGGAATGAAGCAGG + Intergenic
1102792963 12:115663073-115663095 ATGGGAGAGAGGGAGGAAGCAGG + Intergenic
1102796667 12:115694993-115695015 ATGGGAAAGTGGAAGGAACATGG - Intergenic
1102812188 12:115833843-115833865 AAGAGAAAAGGGAAGGATTCAGG + Intergenic
1103175043 12:118855614-118855636 AAGGGAAAGGGAAAGGAAGGGGG + Intergenic
1103231140 12:119331437-119331459 AGGATAAAGGGGAAGGAAGAAGG - Intergenic
1103304224 12:119951703-119951725 AATAGGAAGGGGAAGGAAGAAGG + Intergenic
1103304276 12:119951843-119951865 AATAGGAAGGGGAAGGAAGAAGG + Intergenic
1103304299 12:119951907-119951929 AATAGGAAGGGGAAGGAAGAAGG + Intergenic
1103304322 12:119951971-119951993 AATAGGAAGGGGAAGGAAGAAGG + Intergenic
1103793817 12:123490030-123490052 AGGAGAAAGGGGATGGAAAAGGG - Intronic
1104370496 12:128219962-128219984 AAGAGATAGAGAAAGGAAGCTGG + Intergenic
1104654876 12:130567048-130567070 ATGAAAGAGGTGAAGGAAGTTGG + Intronic
1105457135 13:20551424-20551446 ATGAGTAAGAGGAAGGGAGATGG + Intergenic
1106707831 13:32300586-32300608 ATGAATAAGGGGCAGGAAGCAGG - Intergenic
1106770593 13:32957617-32957639 GTGGGGAAAGGGAAGGAAGCAGG + Intergenic
1107519356 13:41163793-41163815 AAGAGAGAGAGGAAGGAAGGAGG + Intergenic
1107579253 13:41764626-41764648 ATGAGAAAGGGGAGTGATACAGG + Intronic
1107888143 13:44891551-44891573 AGGGAAAAGGGAAAGGAAGCCGG + Intergenic
1107966040 13:45599016-45599038 AGGAAAAAGGGAGAGGAAGCAGG - Intronic
1107996052 13:45862184-45862206 GAGAGAAAGGGGAAGGAAAAGGG + Intergenic
1108168621 13:47718548-47718570 AAGAAAAGGGGGAAGAAAGCAGG + Intergenic
1108392088 13:49956501-49956523 AGAAGAAAGAGGAAGGAAGGAGG - Intergenic
1108849040 13:54705614-54705636 ATCAAAAAGGGGAAGGAAAGGGG + Intergenic
1108853319 13:54762569-54762591 ATGAGGAAGAGGAGGGTAGCAGG + Intergenic
1109272394 13:60268838-60268860 GTGAGAAAGGGGAAGGGGCCGGG + Intergenic
1110343347 13:74417638-74417660 ATTAGAGAGGGAAAGGAAGCTGG - Intergenic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1111240419 13:85466237-85466259 AAGACAAAGGGGAAGCAAGCAGG + Intergenic
1111937772 13:94573963-94573985 TTGAGAAAGGGAAAAGAAACTGG - Intergenic
1112010864 13:95292897-95292919 ATGAGTAAGGGGCTGGAAGTGGG + Intronic
1112523503 13:100120338-100120360 ATGAAAAAGAAAAAGGAAGCAGG - Intronic
1112961231 13:105129345-105129367 ATGAGATAAAGGAATGAAGCAGG + Intergenic
1113092686 13:106631929-106631951 ATGAGAAGGGGGAAGGAGCCTGG - Intergenic
1113195613 13:107801828-107801850 AGAGGAAAGGGGAAGGAAGAAGG - Intronic
1113412464 13:110102230-110102252 ATCTGAAAAGGGGAGGAAGCAGG - Intergenic
1113541405 13:111112587-111112609 GTGAGGAAGGGGAGTGAAGCAGG - Intergenic
1114172630 14:20288920-20288942 ATGGGAAAATGGAAGAAAGCTGG + Exonic
1114257298 14:21014304-21014326 AGGAAAAAGAGGAAGGAAGGTGG + Intergenic
1114382656 14:22224397-22224419 ATGGGAATGGGGAAGGGAGAAGG - Intergenic
1114746849 14:25157533-25157555 CTGCTAAAGGGGAAGGAAGGAGG - Intergenic
1115275599 14:31605807-31605829 ACGAGAAAGGAGAAGGGAGGAGG - Intronic
1115498171 14:34027192-34027214 AGGAGGAAGGGGAAGGGAGGGGG + Intronic
1115591859 14:34873686-34873708 AAGAGGAAGGGGGAAGAAGCAGG - Intronic
1115788225 14:36850161-36850183 ATGGGAAAGGGGAAGGAGTGAGG + Intronic
1115949775 14:38708070-38708092 AAGAGGGAGGGGATGGAAGCTGG - Intergenic
1116014794 14:39393447-39393469 GTTAGAAAGGGAAAGGAAGGGGG - Intergenic
1116290181 14:43024426-43024448 GTGGGAAAGGGGAAGGAAATCGG + Intergenic
1116385628 14:44326233-44326255 AGGAGAAATGGGAAGAAAGCTGG + Intergenic
1116568041 14:46477145-46477167 ATCGGAAAGTGGAAGGTAGCAGG - Intergenic
1116806858 14:49502045-49502067 AATAGAAAGGGGAAGGAAGACGG + Intergenic
1116855281 14:49946536-49946558 ATGAAACAGGGGAAGGACGCTGG - Intergenic
1116868064 14:50047371-50047393 GTGAATCAGGGGAAGGAAGCTGG + Intergenic
1117239248 14:53812385-53812407 TTGAAAGAGGGGAAGGAAACAGG + Intergenic
1117405005 14:55393483-55393505 CTGAGAAATGGGAAGGAGTCAGG - Intronic
1117446327 14:55806956-55806978 ATGAGAAGAGGGAAGGGAGACGG + Intergenic
1117827005 14:59714494-59714516 ATGGCAAAGGAGAAGGAACCTGG - Intronic
1118091498 14:62485199-62485221 ATGAGAAAGGGGGAGAGAACTGG + Intergenic
1118610810 14:67538145-67538167 ATGAGAGAGGGGAAGTGAGCTGG - Intronic
1118810268 14:69268031-69268053 AAGAGAAAGGGGAAGGATGAGGG - Intronic
1118879949 14:69817446-69817468 AAGAGAAAGGCGAAGGCAGCAGG - Intergenic
1119067415 14:71542678-71542700 AGGAGAAGGGAGAAGGAAGGAGG - Intronic
1119071103 14:71585136-71585158 ATGAGAAAAGGGAGGGAGGGAGG + Intronic
1119473940 14:74916294-74916316 ATGACACAGGGAAAGGAAGTAGG + Intronic
1119536045 14:75403161-75403183 AGGAGAAAAGGGTAAGAAGCAGG - Intergenic
1119972300 14:78984851-78984873 ATGAGACTGGAGAAGGAGGCAGG + Intronic
1120255019 14:82107459-82107481 AAGAGAGAGGGGAAGGGGGCTGG + Intergenic
1120447663 14:84621296-84621318 ATAAGAAAGGAGAACAAAGCTGG + Intergenic
1120554981 14:85918632-85918654 AAGAGAAAGCGGAAGGATGGAGG + Intergenic
1120999595 14:90442032-90442054 ATTAGAAAGGGGATGGATGCTGG + Intergenic
1121193984 14:92053793-92053815 ATCAGAAAGAGAAAGGAGGCTGG - Exonic
1121447535 14:93988242-93988264 ATGAGAGAGGGGATGGAAGGAGG + Intergenic
1121550100 14:94792841-94792863 AAGAGAAAGAGGAAGGAGGGAGG + Intergenic
1121593262 14:95137156-95137178 AAGAGGAAGGGGAAGGAAAAGGG + Intronic
1121604290 14:95229237-95229259 GTGAGAAGGGGGATGGGAGCAGG - Intronic
1121925522 14:97923860-97923882 AGGACAAAGTGGATGGAAGCAGG - Intergenic
1122353803 14:101111951-101111973 AGGAGGAAGGGGAAGGAAGGAGG - Intergenic
1122435746 14:101695494-101695516 AGGAAAAAGGGGAGGGAGGCTGG + Intergenic
1122489041 14:102101134-102101156 ATGAGAGAGGAGAAAGCAGCAGG - Intronic
1122752172 14:103944859-103944881 AGGAAAAAGGGAAAAGAAGCCGG - Intronic
1123797412 15:23785920-23785942 TTCAGAAAGGGGAAGGAAGGCGG + Intergenic
1124825195 15:33087248-33087270 ATAAGAAAGGAGAAGGTAGCTGG + Intronic
1124975311 15:34524399-34524421 ATAAGACAGAGGAAGGAGGCGGG - Intergenic
1125431516 15:39599488-39599510 AGGAAAAAGGGGAGGGAAGAGGG - Intergenic
1126221003 15:46212994-46213016 AGCAGAAAGTGGAAAGAAGCAGG - Intergenic
1126320325 15:47415516-47415538 AGGAGAAAGGAGACGGGAGCGGG - Intronic
1126683254 15:51224652-51224674 ATGACTAATTGGAAGGAAGCAGG - Intronic
1126715122 15:51507644-51507666 AGGATAGAAGGGAAGGAAGCGGG + Intronic
1127165659 15:56243405-56243427 AGGAGGAGGAGGAAGGAAGCTGG + Intergenic
1127611506 15:60641705-60641727 TTTAGAAATGGAAAGGAAGCTGG - Intronic
1127653181 15:61029340-61029362 ATGAGACTGAGGAGGGAAGCAGG + Intronic
1127903517 15:63358988-63359010 CTGAGAAAGGGCAGGGAAACGGG - Intronic
1128157663 15:65401997-65402019 GAGAGAAAGGGGCAGGGAGCAGG + Intronic
1128363454 15:66979561-66979583 ATGAGAAAGGGGAGGGAGGAAGG - Intergenic
1128539751 15:68518393-68518415 AGAAGAAAGGAGAGGGAAGCAGG - Intergenic
1128565021 15:68695354-68695376 ATGACAAAGAGGAGGGAAGAAGG - Intronic
1128818648 15:70632195-70632217 CTGACAAAGGAAAAGGAAGCTGG - Intergenic
1128845826 15:70893274-70893296 ATGAGACAGGTGAAGGAGGTGGG - Intronic
1128903098 15:71443057-71443079 AAGAGAAAGGGGGAGAAAGAGGG + Intronic
1128997400 15:72306983-72307005 GAGAGGAAGGGTAAGGAAGCGGG + Intronic
1129044981 15:72725982-72726004 AGGGGAAAGGGGAAGGGAGATGG - Intronic
1129071682 15:72956700-72956722 TTGGGAAAGGAGAAGGAAGCAGG - Intergenic
1129332048 15:74832719-74832741 ATGGGGAGGGGGAAGGAAGAAGG - Intergenic
1130631586 15:85574808-85574830 ATGAGGAAGTGCAAGGAAGATGG - Intronic
1130705812 15:86232055-86232077 GTGAGAGAGAGGAAGGAAGCAGG + Intronic
1131244611 15:90780054-90780076 ATGGGAAAGGCGAAACAAGCAGG + Intronic
1131434499 15:92412265-92412287 ATGAGAGGAGGGAAGGAAGGGGG + Intronic
1131583963 15:93673513-93673535 AGGAGGAAGGGGAAGGAAAAGGG - Intergenic
1131591847 15:93758349-93758371 AGGAGGAAGGAGAAGGAAGAAGG + Intergenic
1131793335 15:95988396-95988418 AAGAGGGAGGGGAAGGAAGAGGG + Intergenic
1131872825 15:96778995-96779017 ATGAGAAAGGAAAAGAAAGCAGG + Intergenic
1133570161 16:7033110-7033132 ATGAGACAGGGCAGGGAAGAAGG + Intronic
1133720206 16:8487732-8487754 ATGAGAAATGGGAAGGAGAATGG + Intergenic
1133929362 16:10219762-10219784 ATGAAAAAGGGAAAGGCAGGTGG + Intergenic
1134216429 16:12320221-12320243 ATGAGAAGGGGCCAGGCAGCTGG + Intronic
1134596575 16:15500527-15500549 TTGAGGAAGGGGAAGGTATCAGG + Intronic
1134718955 16:16370583-16370605 TGGAGAAAGGGGAGGGAAGGGGG - Intergenic
1134826575 16:17289330-17289352 CAGAGAAAGGGGAAAAAAGCTGG - Intronic
1134902912 16:17954649-17954671 AGGAGGAAGGGGAAGGGAGGTGG + Intergenic
1134908540 16:18003280-18003302 ATGAGATAGGGGAAAGAAAAAGG - Intergenic
1135271230 16:21071468-21071490 ATGAAAAATGGGGAGGTAGCTGG - Intronic
1135670145 16:24368397-24368419 ATGAGAACAGGAAAGAAAGCTGG + Intergenic
1135692767 16:24556708-24556730 ATGTGAATGAGGAAGAAAGCAGG - Intronic
1135836527 16:25830835-25830857 ATGAGAAAGGGGAGTCCAGCTGG - Intronic
1136010717 16:27361914-27361936 ATTAGAAAGGATATGGAAGCCGG - Intronic
1136364619 16:29804057-29804079 AAGAGAAAGGTGAAAGTAGCTGG + Exonic
1137673883 16:50294323-50294345 ATGGGAAAGGGGAAGGCTCCGGG + Intronic
1137827305 16:51510164-51510186 CTGACAAAGGAGAAGGAAGATGG - Intergenic
1137919699 16:52474882-52474904 GTGAGAAAGGGGAAGGACGATGG - Intronic
1137993413 16:53183407-53183429 GAGAGAAAGGGGAAGGAACAGGG + Intronic
1138101992 16:54259595-54259617 AAGAGAGAAAGGAAGGAAGCAGG + Intronic
1138225116 16:55287585-55287607 AAGAGAAAGGGAAAAGAAGAGGG + Intergenic
1138926387 16:61596576-61596598 ATGAGAAAGTGGAAGGAAGTAGG - Intergenic
1140104433 16:71946805-71946827 ATGAGAGAGGGGGAGGAGGAGGG + Intronic
1140314275 16:73879509-73879531 ATGAGAAATGGGAAGGAGGTAGG + Intergenic
1140791982 16:78400636-78400658 AGGAAAAGGGGGAAGGAAGCAGG + Intronic
1140859253 16:79004993-79005015 ATGAAAAAGGGGAAGGGAGAGGG + Intronic
1141056853 16:80824818-80824840 AAGAGAAGGAGGAAGGAAGGAGG + Intergenic
1141112937 16:81285134-81285156 ATGAGAAATGGGAAGCTGGCTGG - Intronic
1141263753 16:82476900-82476922 ATGAGAAAGAGAAGGGAAGATGG - Intergenic
1141640494 16:85338181-85338203 ATGAGAAAGGAGGATGAAGCAGG - Intergenic
1141867038 16:86757482-86757504 ATGAGAACCAGGAAGGAAACAGG + Intergenic
1142169965 16:88616582-88616604 CTGATAAGGGAGAAGGAAGCAGG - Intronic
1142446977 16:90146858-90146880 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1142448573 16:90159645-90159667 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1142458912 17:75644-75666 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1142460515 17:88473-88495 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1142882510 17:2892869-2892891 AAGAGAAAGGGGAGGGGAGCTGG - Intronic
1143367366 17:6416726-6416748 GGGAGAGAGGGTAAGGAAGCAGG + Intronic
1143586127 17:7851422-7851444 CAGAGGGAGGGGAAGGAAGCAGG - Intronic
1143867905 17:9937465-9937487 CTGAGATAGGGGCAGGAAGGGGG - Intronic
1143892377 17:10112394-10112416 ATGAGAGAGAGGAGGGAAGTAGG + Intronic
1144291665 17:13832577-13832599 GTAAGAAATGGGAAGGAAGAAGG + Intergenic
1145058197 17:19716663-19716685 ATGAGTAAGGGGCAGGAGGAGGG + Intronic
1145092605 17:19998395-19998417 GTGAGCAAGGGGAAAGAAGTGGG + Intergenic
1145415638 17:22711724-22711746 ATGAGAGAGGAGAAGGAATTGGG + Intergenic
1145727158 17:27140806-27140828 AGGAGAAAGGAGGAGGAAGGGGG - Intergenic
1146299436 17:31676707-31676729 AGCAGAAAGGGGCAGGAAGCTGG + Intergenic
1146471884 17:33131356-33131378 ATGAGAGAGGGGAGGGATCCAGG - Intronic
1146589139 17:34113203-34113225 AAGAGAGGGGCGAAGGAAGCTGG + Intronic
1146774956 17:35605665-35605687 AAGAGAAAAGGAAAGTAAGCAGG - Intronic
1146807192 17:35874116-35874138 ATGGGAAAGGGTAAGTAGGCAGG - Intronic
1147043791 17:37737987-37738009 TTCAGAAAGGAGAAGGAGGCAGG - Intronic
1147217512 17:38909221-38909243 ATGAGGATGGGGGAGGAAGCGGG - Intronic
1147276875 17:39325268-39325290 ATGAGAATGGGGTAGAAAGAAGG + Intronic
1148146090 17:45366046-45366068 ATCAGAAGGAGGAAGGATGCTGG + Intergenic
1148278605 17:46329467-46329489 GTGAGAAAGGGGAAGAAACATGG - Intronic
1148300815 17:46547329-46547351 GTGAGAAAGGGGAAGAAACATGG - Intronic
1148563061 17:48617258-48617280 ATGAGAGAGGGGCTAGAAGCGGG + Intronic
1148973461 17:51505516-51505538 ATGGGAAAAGGGGAGGAAGTAGG - Intergenic
1149145915 17:53492198-53492220 AAGGCAAAGCGGAAGGAAGCAGG + Intergenic
1149436874 17:56640535-56640557 AGGAGAGAGGGGGAGGAAACAGG + Intergenic
1149580199 17:57744715-57744737 ATGAGGAAGGGAAAGCAAGGGGG + Exonic
1150401688 17:64861934-64861956 GTGAGAAAGGGGAAGAAACATGG + Intronic
1150410159 17:64935633-64935655 ATTAGAAAGGGGAAGCAAAGGGG - Intergenic
1150465196 17:65386681-65386703 AAGAGAAAGAGGAAGGAGGATGG - Intergenic
1150467509 17:65406109-65406131 ATTGGAAAGGGGCAGGGAGCGGG - Intergenic
1151116990 17:71747553-71747575 ATGAAAAAGAGAAAGGAAGAAGG + Intergenic
1151258772 17:72900454-72900476 AAGAGAAAGAGGAATGAAGGGGG + Intronic
1151269325 17:72981085-72981107 ATCACCAAGGGGAAGGAAACAGG + Intronic
1151319282 17:73342960-73342982 ATTAGAAGGGGCCAGGAAGCCGG + Intronic
1151464440 17:74275427-74275449 ATAAGAAAGAGAAAGAAAGCTGG + Intronic
1151904689 17:77039997-77040019 ACAAGAAAGGGGAAGGCAGAAGG - Intergenic
1152336627 17:79702840-79702862 AGGAGGAAGGGGAGGGAAGGAGG - Intergenic
1152500847 17:80708013-80708035 GGCAGAAACGGGAAGGAAGCTGG - Intronic
1153038338 18:786185-786207 ATGAGAATTTGGCAGGAAGCTGG + Intronic
1153230301 18:2928709-2928731 AAGAGAGAGGGGAGGGAATCAGG + Intronic
1153320418 18:3768500-3768522 TTGAAAAAGGAGAAGGAAGGGGG + Intronic
1153495525 18:5694498-5694520 ACGAGGAAGGGAAAGGAAGAGGG + Intergenic
1153577708 18:6539342-6539364 AGGAGAGAGAGGAGGGAAGCAGG + Intronic
1153806470 18:8712519-8712541 AAGAGAAAGGAGGAGGAGGCGGG - Intronic
1153986750 18:10357553-10357575 ATGGTGAAGGGGAAGGAAGCAGG - Intergenic
1154266724 18:12884584-12884606 ACGAGAAATGGGAAGCAAGAAGG - Intronic
1155442010 18:25871880-25871902 AAGAGAAGGAAGAAGGAAGCGGG + Intergenic
1155806634 18:30178348-30178370 AGGACATAGGGGAAGGAGGCAGG + Intergenic
1156381606 18:36566805-36566827 ATGAGGAAAGGGAAGGAGTCTGG + Intronic
1157019407 18:43761569-43761591 AAAAGGAAGGGGAATGAAGCAGG - Intergenic
1157031514 18:43915272-43915294 GTGAGAAGGGGGAGGGGAGCAGG - Intergenic
1157372598 18:47130180-47130202 ATGACAAAAGGAAAGGAAGAAGG + Intronic
1157406434 18:47425770-47425792 ATGAGAGAGGGGAAGCAGGGAGG - Intergenic
1157602451 18:48902324-48902346 TGGAGAAAGGGGAAGGAGGGCGG - Intergenic
1158139156 18:54238982-54239004 ATGAGTAAGGGGAAGGAATGAGG - Intergenic
1158245437 18:55427204-55427226 ATGGAAAAGGGAAAAGAAGCTGG - Intronic
1158860782 18:61590186-61590208 ATGAAGAAGGGGAGGGAGGCAGG - Intergenic
1158920084 18:62182020-62182042 ATTAAAAAGGAGAAGGCAGCCGG - Intronic
1159119735 18:64154852-64154874 AAGATAGAGGGGAAGGAAGGGGG - Intergenic
1159321636 18:66858497-66858519 TTGAGAAAGAAGAACGAAGCTGG - Intergenic
1159606018 18:70476169-70476191 GTGAGAAAAGGGAGAGAAGCAGG - Intergenic
1159633571 18:70778854-70778876 AGGAGAAAGGGGTTGGAAACTGG - Intergenic
1159965096 18:74587431-74587453 ATGTGAAATGGGCAGGAAGATGG - Intergenic
1159980598 18:74774926-74774948 GTGAGAGAGAGCAAGGAAGCAGG + Intronic
1160133019 18:76246488-76246510 AGGAGAGAATGGAAGGAAGCAGG - Intergenic
1160178294 18:76613439-76613461 CTGAGAAAAGGGATGGAGGCAGG + Intergenic
1160196377 18:76758881-76758903 ATGAGAGAGAGAAAGGAAGTGGG + Intergenic
1160648631 19:208157-208179 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1160650230 19:220973-220995 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1160997188 19:1888245-1888267 ATGGGAGGGGGGAAGGAGGCTGG - Intergenic
1161057317 19:2197215-2197237 ATGAGAAAGGGAAGGAGAGCCGG - Intronic
1161415778 19:4145600-4145622 AGGAGAAGAGGGAAGGGAGCAGG + Intergenic
1162071003 19:8151963-8151985 AAGAGAGGGGAGAAGGAAGCCGG + Intronic
1162577378 19:11506829-11506851 ACAAGAAAGTGGAAGGAAGCCGG - Intronic
1162982728 19:14249371-14249393 ATGGAAGAGGGGAAGGAAACAGG - Intergenic
1163890617 19:20009093-20009115 ATGTGAAAGCGAAAGAAAGCTGG + Intronic
1164784567 19:30919823-30919845 AGGAGAAAGGAGAAGAAAGAAGG + Intergenic
1164882783 19:31749024-31749046 AAGAGAAAGAGGAACGAAGTGGG - Intergenic
1164896654 19:31882859-31882881 GTGAGCAAGGAGAAGGCAGCTGG - Intergenic
1164933095 19:32190320-32190342 AGGAGAAAAGGGAAGGAGCCAGG + Intergenic
1165637573 19:37355102-37355124 CTGAGAAAGGGGAAGGAAGGAGG - Intronic
1165820396 19:38671192-38671214 ATGGGAAAGGGGGAGGAGTCCGG - Intronic
1165850772 19:38849378-38849400 ATGATAAAGGGGAAAAAAACCGG + Intronic
1166119031 19:40673880-40673902 GACAGAAAGGGGCAGGAAGCTGG - Intronic
1166182333 19:41117677-41117699 ATGACAATGGGGAATGAAGGGGG - Intronic
1167526670 19:49988556-49988578 GAGAGAGAGGGGAAGGAAGGGGG - Intronic
1167575361 19:50315266-50315288 ATGAGAAAGGGGGAGACATCGGG + Intronic
1167696332 19:51017467-51017489 GCGTGAAAGTGGAAGGAAGCTGG + Intronic
1167846080 19:52165608-52165630 ATGTGATAGGGAAAGGAACCTGG + Intronic
1167975316 19:53222058-53222080 ATTAGTAAGGTGAAGGAGGCAGG - Intergenic
1168326186 19:55539619-55539641 CTGAGAAAGGGGGACGGAGCTGG + Intergenic
925198456 2:1947015-1947037 CTGATGAAGGAGAAGGAAGCTGG - Intronic
925425271 2:3744192-3744214 ATGAGAGAGGAGAAGGCAGATGG + Intronic
925445363 2:3922647-3922669 AAGAGGAAGGGGAAGGAAAGAGG + Intergenic
926036346 2:9638728-9638750 ATGACTAAGGGGAAGGAGGGCGG - Intergenic
926104903 2:10143972-10143994 AGGAGGAAGGGGAAGAAAGTGGG - Intronic
926812456 2:16767767-16767789 ATGAGAAATGGCATGGAGGCAGG - Intergenic
926856065 2:17257195-17257217 AGGAGAGAGGGGAAGGATGAAGG + Intergenic
928286007 2:29990539-29990561 ATGAGAGGGAGGAAGGAAGAAGG + Intergenic
928945585 2:36769078-36769100 AAGAGAAACAGGAAGGATGCTGG + Intronic
929777817 2:44939437-44939459 ATGAAAAAGGGGAGGGGAGTGGG - Intergenic
929967764 2:46548377-46548399 ATGAGAAAAGGGAAGGAGAAAGG + Intronic
930405890 2:50955017-50955039 ATAAAAAAAGGGAAAGAAGCAGG + Intronic
930673573 2:54176942-54176964 CTGTGAAAGGAGAGGGAAGCTGG - Intronic
930681906 2:54265549-54265571 AGGAGAAAGGGGAAGAATGCAGG + Intronic
930768288 2:55107461-55107483 ATGAGCAAGGGCAAGAAAGTAGG - Intronic
930919856 2:56739405-56739427 AAGAGAGAAGGGAGGGAAGCAGG - Intergenic
930929328 2:56861653-56861675 GTGAGAAAGGGGGTGGAAGAAGG + Intergenic
931025596 2:58110682-58110704 AAGATAAAAGGGGAGGAAGCAGG + Intronic
931037002 2:58254917-58254939 GTGGGAAAAGGGAAGGAAGCCGG - Intergenic
931246778 2:60498678-60498700 ATCAGTAAAGAGAAGGAAGCAGG + Intronic
931362562 2:61590443-61590465 AAGAGAAAGAGGAAAGAAGAAGG + Intergenic
931460674 2:62447846-62447868 AGGAGAAAGATGAAGGAACCAGG - Intergenic
931691470 2:64837990-64838012 AAGGGAAAGGAAAAGGAAGCAGG + Intergenic
931832794 2:66070063-66070085 TGGAGACAGGGGAAGGATGCTGG + Intergenic
931922637 2:67037723-67037745 CTGAGAAAGGGGTGGGAAACAGG + Intergenic
932429593 2:71666127-71666149 ATGGGAAAAGGGAATGAAGGGGG - Intronic
932559128 2:72851722-72851744 ATGAGAAGGAGGGAGGAAGGAGG - Intergenic
932617818 2:73246642-73246664 AAGAGAGAGGGGAAGTAGGCAGG - Intronic
932624526 2:73286771-73286793 AACAGAAAGGGGAAGGAGGAGGG - Intergenic
932882447 2:75516454-75516476 ATGAGTATGGGGCAGGAAGGAGG + Intronic
933791223 2:85885457-85885479 AGGAGACTGGGGAAGGAATCAGG - Intronic
933897128 2:86821824-86821846 AAGAGAAGGGTGGAGGAAGCAGG - Intronic
934874912 2:97908571-97908593 ATGAGCAAGGGGAAAGAGGAGGG + Intronic
935041143 2:99428472-99428494 ATGAGAAAGGCAAAGTTAGCTGG + Intronic
935131301 2:100263119-100263141 AGGAGGGAGGGGAAGGAAGGAGG - Intergenic
935597228 2:104888715-104888737 CTGAGAGTGGGGAAGGAAGTGGG - Intergenic
935787975 2:106566432-106566454 AGAAGAGAGGGGAAGGAAGTAGG + Intergenic
935874822 2:107494869-107494891 AGGAAAAAGGGGAAGGATGGAGG + Intergenic
935903566 2:107818365-107818387 AGAAGAAAGGAGAAGGAAGGAGG - Intergenic
935946850 2:108294382-108294404 AAGAGAGAGGGAAAGAAAGCAGG - Intronic
936485256 2:112919899-112919921 ATGTGAAAGAGGAAGGCAGGAGG - Intergenic
936658158 2:114512289-114512311 ATGTGAAAGGTGAAGGAAATTGG - Intronic
937021509 2:118661110-118661132 AAGAGAAAAGGAAAGGAAGAGGG - Intergenic
937178914 2:119971187-119971209 AAGGCAAAGGGGAAGCAAGCAGG + Intronic
937450099 2:121994772-121994794 ATGATAAAGGGGAAGAAACGTGG - Intergenic
937633493 2:124129537-124129559 AAGACAAAGGGCAAGGAAGAGGG + Intronic
937887962 2:126913235-126913257 ATGAAAAAGGAGAAGGATGATGG - Intergenic
938092159 2:128441072-128441094 AGGGGAAAGGCAAAGGAAGCAGG - Intergenic
938130462 2:128710998-128711020 TTGAGAAAGAGGAAGGGGGCAGG + Intergenic
938416126 2:131105215-131105237 CTGAGAAACGGGACGGAAGGCGG - Exonic
938474545 2:131595605-131595627 GTGGGAAGAGGGAAGGAAGCAGG + Intergenic
939169267 2:138675000-138675022 ATGAAACAGGAGAAGGAAGGTGG - Intronic
939220205 2:139291940-139291962 ATGAGGGTGGCGAAGGAAGCAGG + Intergenic
939427990 2:142065591-142065613 ATGACAAAGGGGAATTAAGGTGG - Intronic
940007052 2:149017361-149017383 CTGAGAGAGAGGGAGGAAGCAGG + Intronic
940160584 2:150708338-150708360 AGGAGAAAGGGGAGGGGAGGAGG + Intergenic
940261582 2:151785428-151785450 TTGAGAAATGGGAAAGAAGGAGG + Intergenic
940557448 2:155248683-155248705 AGGAGAAAGGAGAAGGAAAGAGG + Intergenic
940619719 2:156096388-156096410 ATGAAAAAGGGGGAGGAGTCTGG + Intergenic
940716492 2:157230848-157230870 GTGTGCAAGGAGAAGGAAGCAGG - Intergenic
940822773 2:158375769-158375791 AGGAGAAAGGGCAAGGAATAAGG - Intronic
941451497 2:165665874-165665896 AAGAGAGAGAGGAAGGAAGGAGG + Intronic
941481226 2:166016046-166016068 AAGAGAAAGGGAAAAGGAGCAGG + Intronic
941530217 2:166660616-166660638 ATGAAGATGGAGAAGGAAGCAGG + Intergenic
942117355 2:172741253-172741275 ATGTGAAAAGAGAAGTAAGCAGG - Intronic
942376997 2:175347823-175347845 TTGAGACAGGGGAGGGCAGCTGG + Intergenic
943449377 2:188028764-188028786 CTAGGGAAGGGGAAGGAAGCCGG + Intergenic
943612291 2:190047286-190047308 ATGGGAAAGAAGAAGGAAGAAGG - Intronic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944183913 2:196926887-196926909 AAGAGAAAGAGGGAGAAAGCAGG + Intronic
944278966 2:197872370-197872392 ATGAGAAAGAGGGAGGACACAGG - Intronic
944794378 2:203167833-203167855 ATGAGAGAGGGGAGGAAGGCCGG - Intronic
945175983 2:207043931-207043953 AAGAGAGAGGAGAAGGAAGAAGG + Intergenic
945307073 2:208268759-208268781 AAGAGGAAGGGGAAGGAAAGAGG - Intronic
946032994 2:216719875-216719897 ATGGGGAAGGGGAAAGAAGGAGG - Intergenic
946111671 2:217425127-217425149 ATGAAAAAGGGGAATGAGCCAGG - Intronic
946370948 2:219280881-219280903 ACCTGAAAGGGGAAGGAAGCAGG + Intronic
946623659 2:221588126-221588148 ATAAGAAACAGGAAGGAGGCCGG + Intergenic
946862458 2:224013470-224013492 ACGAGGAAGAGGAGGGAAGCAGG + Intronic
946946851 2:224830232-224830254 ATGAAAAGGGGGAAGGAAGGAGG - Intronic
947368060 2:229416935-229416957 AGGAGCAAGGGGAAAGAAGGAGG + Intronic
947446753 2:230169978-230170000 ATGGAAGAAGGGAAGGAAGCTGG + Intronic
947511765 2:230761733-230761755 ATGAGAAAATGCAAGGAAGCTGG - Intronic
947675371 2:231974240-231974262 AAGGGACAGGGGAGGGAAGCTGG + Intronic
947833387 2:233158029-233158051 AAGAGAGAGGGGAAGGAGGGAGG + Intronic
948413230 2:237781038-237781060 ACAGGAAAGAGGAAGGAAGCTGG + Intronic
948674603 2:239589492-239589514 AGGAGGAAGGAGAAGGAAGTGGG + Intergenic
948912007 2:241009541-241009563 ATGAGAAAGGGCACGGGGGCTGG + Intronic
1168862970 20:1059333-1059355 AAAAGAAAGGGGCAGGAATCAGG + Intergenic
1168904341 20:1391807-1391829 TTGAGAAAGGGGAAGGAGGAGGG + Intronic
1169210941 20:3766029-3766051 ATGAGAATGGGGACTGAAGAAGG - Intronic
1169623254 20:7532024-7532046 GAGAGAAAGGAGAAGGAAACTGG + Intergenic
1169652838 20:7888733-7888755 GGGAGAAAGGGAAAGGAAGGAGG + Intronic
1169773604 20:9228311-9228333 ATGAGAGAGAGTAAGGAAGAAGG + Intronic
1169979074 20:11363409-11363431 AGGAGAGAATGGAAGGAAGCTGG - Intergenic
1170159231 20:13295636-13295658 AAGATAAAGAGGAAGGCAGCAGG + Intronic
1170164143 20:13344704-13344726 ATGAGGAAGGCAAAGGATGCCGG - Intergenic
1170253919 20:14318432-14318454 ATGAGATAGGGGTAGGGAGTGGG + Intronic
1170429112 20:16260569-16260591 AAGAGGCAGGGGAAGGAAGCAGG + Intergenic
1170585175 20:17729012-17729034 AGTAAAAAGGGGAAGGAAACAGG - Intronic
1170829905 20:19830971-19830993 CTGTGGAATGGGAAGGAAGCAGG - Intergenic
1170939388 20:20835783-20835805 AAGAGAAAAGGAAAAGAAGCAGG - Intergenic
1171082638 20:22203249-22203271 ACTAGAAAGGGGAAAGAAGGAGG + Intergenic
1171159652 20:22909606-22909628 ATGGAACAGGGGAAGAAAGCTGG + Intergenic
1171303001 20:24080081-24080103 ATGTGGAAGGGTCAGGAAGCTGG + Intergenic
1171307274 20:24117204-24117226 ATGAGAGAGGGGGAGGAGGAAGG + Intergenic
1171349672 20:24492766-24492788 AAGGCAAAGGGGAAGGAAGATGG - Intronic
1171786968 20:29476197-29476219 AGGACAAAAGGGAAGAAAGCCGG + Intergenic
1172089214 20:32415760-32415782 AAGAGTAAGGGGAAGGAAAAAGG - Intronic
1172211785 20:33204626-33204648 GGGAGAAAGGAGAAAGAAGCAGG - Intergenic
1172874205 20:38154488-38154510 TTGAGCAAGGGGGAGGAGGCAGG - Intronic
1173007999 20:39155921-39155943 AGAAGAGAGGGGAAGGAAGTTGG + Intergenic
1173151081 20:40566816-40566838 ATGAGCAAGGGGGAGGGAGGAGG - Intergenic
1173175445 20:40761682-40761704 ATGTGAGAAGGGAAGGAAGTGGG - Intergenic
1173464555 20:43270709-43270731 AAGAGAAAAAGGAAGGAAGAAGG + Intergenic
1173861629 20:46287622-46287644 ATGAGACAGGAGAAGCAGGCAGG + Intronic
1174030174 20:47617448-47617470 ATGAGAGAGGGGAATAAGGCAGG - Intronic
1174057710 20:47809971-47809993 ACGAGAAAGGGGTAGGGAGAGGG - Intergenic
1174163120 20:48565593-48565615 ATGAGGAAGGCGAGGTAAGCAGG - Intergenic
1174450321 20:50616120-50616142 AGAAGAAAGGGAAAGGAAGTAGG + Intronic
1174873445 20:54204471-54204493 AGGAAAAAGCGGAATGAAGCAGG - Intergenic
1175010968 20:55735625-55735647 AGGAGAAAGAGGAAGGATGGAGG - Intergenic
1175069682 20:56322726-56322748 AGGAGAAACGAGAAGGAGGCAGG + Intergenic
1175140451 20:56857025-56857047 AAGGGAAAGGAGAAGGGAGCGGG + Intergenic
1175298882 20:57928758-57928780 AAGAGAAAGGAGGAGGAAGATGG - Intergenic
1175369497 20:58478403-58478425 AGGGGAAAAGGGAAGGAAGGAGG - Intronic
1176050014 20:63114121-63114143 ATGAGCATGGGGAACGAAACAGG + Intergenic
1176121508 20:63456217-63456239 ACCAGAATGGGGAAGGAAGGCGG - Intronic
1177538420 21:22460080-22460102 AGGAAAAAGGAAAAGGAAGCAGG + Intergenic
1177630636 21:23723209-23723231 AAGAGAAATGGAAAGGAAGCTGG + Intergenic
1177779030 21:25603226-25603248 AGGAGGAAGTGGAAAGAAGCAGG + Intronic
1177821359 21:26034234-26034256 GAGAGAGAGGGGAAGGAAGGAGG - Intronic
1178050185 21:28738435-28738457 AAGATAAAGGGCAAGGAAGGGGG + Intergenic
1178070364 21:28958913-28958935 GAGAGAAAGAGGAAGGAAGAAGG + Intronic
1178289912 21:31358298-31358320 AAAAGAAAGAGGAAGCAAGCAGG - Intronic
1178310646 21:31527211-31527233 TTAAGACAGGGGGAGGAAGCTGG - Intronic
1178327339 21:31656645-31656667 AAGAGAAAGAAGAAGGAAGGAGG - Intergenic
1178758459 21:35376519-35376541 CTGAAAGAGTGGAAGGAAGCCGG - Intronic
1179277598 21:39906509-39906531 AAGAGAAAGGGTGAGGAAGAGGG - Intronic
1180235618 21:46458012-46458034 GAAAGGAAGGGGAAGGAAGCAGG + Intergenic
1180751919 22:18130634-18130656 AAGAGAAAGTGGAAGCAGGCAGG - Intronic
1180877493 22:19181492-19181514 CTGAGAAATGAGGAGGAAGCAGG + Intronic
1181437360 22:22918544-22918566 ATGGGACAGGGGAAGGATGCTGG + Intergenic
1181853917 22:25769021-25769043 CTGAGAATGGGGGAGAAAGCAGG + Exonic
1182157728 22:28091530-28091552 ATGAAAAAGGGAAAGGTAGCAGG + Intronic
1182558882 22:31143502-31143524 AAGATAAAGGGGGAAGAAGCAGG + Intergenic
1182769109 22:32780978-32781000 GTGAGAGAGAGGAAGGAAGGAGG - Intronic
1182797378 22:33000715-33000737 ATCTGAAAGGGGAAAGAAGGGGG + Intronic
1182809775 22:33105875-33105897 ATGACAAAGGGGAAGGAGCCTGG + Intergenic
1183241699 22:36662421-36662443 ATAAGAGAAGAGAAGGAAGCAGG - Intronic
1183546661 22:38457767-38457789 AGGAGGAAGGGGCAGGAAGGAGG + Intergenic
1183564356 22:38602773-38602795 TTAGGAAAGGGGAAGGACGCTGG - Intronic
1183675191 22:39295164-39295186 ATGGGAAAGTGGAAGAAGGCAGG + Intergenic
1183980262 22:41535528-41535550 ATCAAGAAGAGGAAGGAAGCTGG + Intronic
1184189552 22:42885736-42885758 AGGAGAAAGGGGCAGGAGTCAGG - Intronic
1184191075 22:42894915-42894937 ATGGGCAAGGGGAGGGAAGGGGG + Intronic
1184451848 22:44587143-44587165 AAGAGAAGGGAGAAGGAAGGGGG + Intergenic
1184472944 22:44706093-44706115 AAGAGAAAGGGGAGGGAGCCTGG - Intronic
1185304942 22:50109852-50109874 AAGAGAAAGGAAAAGGAGGCTGG + Intronic
949515365 3:4802520-4802542 GTCAGAAATGGGAAGGAAACAGG + Intronic
949661347 3:6283091-6283113 AGGCTAAAGAGGAAGGAAGCTGG + Intergenic
949881236 3:8662579-8662601 ATGAAAAAGGAGAAGGAACAAGG + Intronic
950175948 3:10874485-10874507 ATTAAAAAGGAAAAGGAAGCAGG - Intronic
950708193 3:14796760-14796782 CTGAGAAAGGAGGAGGGAGCTGG - Intergenic
950753908 3:15156064-15156086 AGGAGGAAAGGGAAGGAGGCAGG + Intergenic
951273613 3:20658081-20658103 ATCAGAAAGTAGAAGGAAGCAGG - Intergenic
951289077 3:20853888-20853910 ATGAGAAAGGGGAAAGAAACTGG - Intergenic
951425103 3:22535495-22535517 AGGAGGAAGGGGCAGGAAGCAGG + Intergenic
951622356 3:24617000-24617022 GTGAGGAAAGGGAAGGAATCAGG + Intergenic
951905177 3:27699184-27699206 ATGAGATTGGAGAAGTAAGCAGG - Intergenic
951990489 3:28671175-28671197 TGGAGGAAAGGGAAGGAAGCGGG - Intergenic
952622857 3:35367401-35367423 AGGCCGAAGGGGAAGGAAGCCGG + Intergenic
952920023 3:38277661-38277683 ATGAGAAAGGTGAAGGAGGCCGG - Exonic
953194258 3:40717596-40717618 ATGAGAGAGAGAAAGGCAGCTGG + Intergenic
953350196 3:42209739-42209761 AGGAGAAAGGGAAGGGAAGAAGG - Intronic
953550513 3:43898834-43898856 ATGAGGTAGGAGAGGGAAGCAGG + Intergenic
954407556 3:50353910-50353932 CAGAGAAAGGGGAAGGAAATGGG - Exonic
954411847 3:50374318-50374340 AGGAGAAAGGGGAGGGTAGGGGG + Intronic
955011659 3:55022639-55022661 AGGAGAGAGAGGAAGGAAGGAGG - Intronic
955119410 3:56041615-56041637 ATGAAAGAGGGAAAGGAAGAAGG - Intronic
955226225 3:57062492-57062514 CAGAGAAGAGGGAAGGAAGCAGG + Intronic
955314644 3:57926320-57926342 AGGAGGAAGGGGAAGAAGGCTGG - Intronic
955352372 3:58203294-58203316 CTCAGAAGTGGGAAGGAAGCTGG - Intronic
955436758 3:58908349-58908371 ATGAGAGAAGGGAAGGAAAACGG - Intronic
955452282 3:59082294-59082316 TTGAAAAAGGGGAACAAAGCAGG - Intergenic
955767141 3:62356743-62356765 ATGAGTAAGGAGAAGGATGGAGG + Intergenic
955867925 3:63405132-63405154 TTGAGAAAGGGGAAGGACAGAGG - Intronic
956280171 3:67547519-67547541 ATGAGAAAGGGTCAGGAACCTGG - Intronic
956661866 3:71606857-71606879 ATGAGAACGGAGCAGGGAGCAGG + Intergenic
956768557 3:72505300-72505322 AGGAGAAGGAGGAAGGCAGCAGG + Intergenic
956989372 3:74745454-74745476 ATAGGAAAGAGGAAGGAAGAAGG - Intergenic
957014872 3:75051437-75051459 ATGAGAGAGGGAAAGAAAGAGGG + Intergenic
958878824 3:99645966-99645988 TGGAGTAAGGGGAAGGGAGCTGG + Intronic
959356655 3:105339325-105339347 ATAAGACTGGGGAAGGAAGTTGG - Intergenic
959626699 3:108460106-108460128 ATGATAAAGGGGATGTAAGTGGG + Intronic
959830342 3:110854102-110854124 ATGAGAAAAAGAAAGGAACCAGG - Intergenic
959901159 3:111663093-111663115 AGGGCAAAGGGGAAGTAAGCAGG + Intronic
960285754 3:115826599-115826621 ATGACAAAGGAGAATGAAGCAGG - Intronic
960322572 3:116254435-116254457 AAGAGAAAGGGAAAGGAAGAAGG + Intronic
960347501 3:116552452-116552474 ATGATAAAAGGGAAGGAAAATGG - Intronic
960663213 3:120083407-120083429 AAAAGAAAGGGGCAGGAGGCAGG + Intronic
960913555 3:122674504-122674526 AAGGCAAAGGGGAAGCAAGCAGG + Intergenic
961393799 3:126572080-126572102 ATGAGATAGGGCATGGAGGCCGG - Intronic
961599203 3:128046089-128046111 AGGAGAAAGGGGAGGGAATATGG - Intergenic
961635778 3:128331447-128331469 CTGAGGAAGGGGAGGGAAGAGGG - Intronic
961646489 3:128395413-128395435 AGGAGGAGGAGGAAGGAAGCTGG - Intronic
961786280 3:129348985-129349007 CTGAGAAAGGGGAAGTGAGTAGG + Intergenic
961786606 3:129351089-129351111 ATGAGCAAGGGAATGGAAGTAGG - Intergenic
961811665 3:129525470-129525492 CCCAGAGAGGGGAAGGAAGCAGG + Intergenic
962480450 3:135793699-135793721 GTGAGAACAGGGAAGGAAGAAGG - Intergenic
962914763 3:139890682-139890704 GTGTGAGAGAGGAAGGAAGCAGG - Intergenic
963237324 3:142968470-142968492 CTGGGAGAGGGGATGGAAGCAGG - Intronic
963890649 3:150632584-150632606 ATGAGGAGGGGAAAGGAAGAAGG + Intergenic
964023648 3:152044990-152045012 AAGAGAAAGAGGAAGGTAGATGG + Intergenic
964193139 3:154029656-154029678 TTGAGAAAGGGAAAGGGAGGAGG - Intergenic
964538827 3:157756721-157756743 TTTACAAAGTGGAAGGAAGCAGG + Intergenic
964741157 3:159967576-159967598 ATGATAAAGTGGGAGGAAGGTGG - Intergenic
965301826 3:167014483-167014505 ATGAGAAATGGGAAGGTAGTAGG - Intergenic
965509015 3:169547765-169547787 AAGAGAAAGGGGAGGGCAACTGG + Intronic
965629065 3:170711975-170711997 ATGCAAAAGGCAAAGGAAGCAGG + Intronic
965904229 3:173683275-173683297 AAGAGGAAGAGGAAGGAAGGAGG - Intronic
966259928 3:177964678-177964700 AAGAGAAAAGGAAAGAAAGCAGG + Intergenic
966321200 3:178702901-178702923 ATGATAAAGTTGCAGGAAGCAGG - Intronic
966443546 3:179974806-179974828 AGGACAAAGGGGTAGGAAACAGG - Intronic
966886888 3:184381816-184381838 GTGAGAAAGGGGAAGGAGCAAGG + Intronic
967332817 3:188308953-188308975 AGGAGAAAGGAGAAGGGAGAAGG - Intronic
967452633 3:189644232-189644254 ATGAGAGAGGGGAAGGGACTTGG - Intronic
967452643 3:189644269-189644291 ATGAGAGAGGGGAAGGGACTTGG - Intronic
967626660 3:191693893-191693915 ATCATAAAGGGGAATGGAGCAGG + Intergenic
968131004 3:196192777-196192799 AGGAGCAAGGGGAAGGGAGGAGG + Intergenic
968181910 3:196601681-196601703 AAGGGAAAGGAGGAGGAAGCTGG - Intergenic
968217314 3:196904404-196904426 ATGAGATCAGGGAAGGAGGCAGG + Intronic
968367616 3:198199156-198199178 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
968369218 3:198211958-198211980 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
968844030 4:3029809-3029831 AGGAGCATGGGGAAGGAGGCAGG - Intronic
968937243 4:3617619-3617641 AGGAGGGAGGGGAAGGAAGAAGG - Intergenic
969107425 4:4818353-4818375 ATGAGGAAGGGAAGGGGAGCGGG + Intergenic
969259843 4:6026409-6026431 AAGAGAAATGGGAAGTAAACAGG + Intronic
969278332 4:6152086-6152108 AAGAGACAGGGGAAGGAAGAAGG + Intronic
969297102 4:6276633-6276655 ATATGAGAGGGGAAGGGAGCTGG - Intronic
969551274 4:7869224-7869246 AGGAGGAAGGGGAAGGAGGAAGG + Intronic
970239403 4:13992742-13992764 AAGAGAAATGGGCAGGAACCAGG - Intergenic
970311655 4:14788230-14788252 AGGAGTGAGGGGAAGGAAGGGGG + Intergenic
970324079 4:14904941-14904963 AGGAGGAAGTAGAAGGAAGCAGG - Intergenic
970334387 4:15019714-15019736 ATGAAAAAGGAGAAGGGAGTTGG + Intronic
970639092 4:18043828-18043850 ATGGGAAAGGGTAAGGAATGGGG + Intergenic
970672399 4:18411972-18411994 ATGAGAGGAGGGAAGGAAGGAGG - Intergenic
970838005 4:20434189-20434211 ACGAAAATGGGGAAGGAGGCTGG + Intronic
971055924 4:22912396-22912418 GAGAGAAAGGGGAAGGAGGAAGG - Intergenic
971307546 4:25496794-25496816 ATGAGAAAGGGGAAGGGTGGGGG - Intergenic
971810629 4:31421144-31421166 ATGAGCAAGGGGAACAAAGATGG - Intergenic
971868205 4:32200756-32200778 ATGAGAAAGAAGAAGTAAGCAGG + Intergenic
972127720 4:35790149-35790171 AAAAGAAAGGGGAAGGGAGAAGG + Intergenic
972185881 4:36527778-36527800 ATGAGAAAGAGGAAGGAGTTAGG - Intergenic
972271017 4:37510934-37510956 TTGTGAAAGGGGAGGGAAGAAGG - Intronic
972296909 4:37747902-37747924 AAGGCAAAGGGGAAGGAAGCAGG + Intergenic
972400325 4:38695928-38695950 AAGAGAAAAGGGAAGGAAAGTGG + Intronic
972445984 4:39144387-39144409 ATAAGAAAGGGGGAGGAGGGTGG - Intergenic
972790239 4:42364860-42364882 AAGAGAAAGAGGAAGGAAGGAGG - Intergenic
972794419 4:42401014-42401036 ATGAGAAAGGGGACGTAGACAGG - Exonic
973110976 4:46397494-46397516 ATGAGAAAGAGGGAGGAAAAGGG - Intronic
973319434 4:48794982-48795004 ATGGGAGAGGGGAAGGAAGCAGG - Intergenic
973602899 4:52559636-52559658 TTGAGGAAGGGGAAGGGAGGTGG + Intergenic
973638163 4:52878920-52878942 AGGGGAAAGGGAGAGGAAGCAGG - Intronic
974073382 4:57146283-57146305 GAGAGAAAGGGTAAGGAAGGAGG - Intergenic
974109339 4:57508918-57508940 ATGAGTAGGGAGAAGGAAGTAGG - Intergenic
974188897 4:58476647-58476669 AGAAGAAAGTGGAAGGAAGAAGG + Intergenic
974693715 4:65337364-65337386 AAGAGGAAGGGGAAGGGAGGAGG - Intronic
974707546 4:65541046-65541068 ATGAGAAAGGGGAAGGAGGGAGG - Intronic
974745773 4:66073817-66073839 AAGAGAAAAGAGAAGAAAGCAGG - Intergenic
974752234 4:66155921-66155943 ATAATTAAGGGGAAGGAAGCAGG - Intergenic
974782128 4:66565839-66565861 ATGAGAAAGGGGAAATCAGAAGG + Intergenic
974838438 4:67276920-67276942 ATCAGAAAGGGGAAGGAGAGGGG - Intergenic
975171923 4:71241880-71241902 AGGAGAAAGGAGCAGGAAGCTGG - Intronic
975406883 4:73999886-73999908 AGGAGAGAGGGAGAGGAAGCTGG - Intergenic
976128411 4:81857818-81857840 AGGAGAAATGGGAAGGAATTGGG - Intronic
976259033 4:83128423-83128445 AAGGGAAAGGGGAAGGAAGGAGG - Intronic
976586288 4:86800685-86800707 AGGAGAGAAGGGAAGAAAGCAGG + Intronic
976598665 4:86917624-86917646 AAGAGAAAGAGAAAGGAAGGAGG + Intronic
976802119 4:89004554-89004576 ATTAGAAAGGAGAAGGAAAAGGG - Intronic
977231893 4:94461586-94461608 ATAAGAAAGGTGAAGGAATAAGG - Intronic
977614422 4:99072063-99072085 AAGGGAAAGGGAAAGGAAGCAGG - Exonic
977805131 4:101288526-101288548 AGGAGAAGGGAGAAGGGAGCGGG + Intronic
977822102 4:101485164-101485186 ATGAGAAAGAGGAAGGGAAAAGG + Intronic
978061273 4:104343602-104343624 ATCATAAAGTGGAAAGAAGCTGG - Intergenic
978496610 4:109366327-109366349 ATGGGAATGGGGAAGAAACCAGG - Intergenic
978555829 4:109979425-109979447 AGGAGAGAGGGGAAAGAAGGTGG + Intronic
978752011 4:112260288-112260310 CTGAGAAAAGGGAAGGATGAAGG + Intronic
978873736 4:113612009-113612031 ATAAGAGAGTGGAAGGAAGTAGG - Intronic
979141003 4:117174507-117174529 AGGAGAGAGGGGAGGGAATCAGG + Intergenic
979256031 4:118608868-118608890 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
979257643 4:118621686-118621708 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
979293196 4:119000707-119000729 AGGAGAAAGGGGAAGGGAGGTGG + Intronic
979330704 4:119418876-119418898 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
979332313 4:119431669-119431691 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
979567585 4:122172903-122172925 ATGAAGAAGAGGAAGAAAGCTGG + Intronic
980135895 4:128858196-128858218 ATGAGATAGGGGAATTAAGGAGG + Intronic
980265863 4:130514884-130514906 ATTAGAAAGGGGAAAGAGGCCGG + Intergenic
980437942 4:132803048-132803070 TTGAAAAAAGGGAAGTAAGCAGG - Intergenic
981034792 4:140158152-140158174 ATGAGAAATGAGATGGAGGCTGG + Intergenic
981325683 4:143444761-143444783 ACCAGAGAGGGGAAGGAGGCAGG - Intronic
981488771 4:145317715-145317737 AGAAGAAAAGGGATGGAAGCAGG - Intergenic
981912250 4:149995397-149995419 AGGAGAGAGGGGGAGGAAGGAGG + Intergenic
982303459 4:153903802-153903824 ATGGGAAAAGGGAAGGTGGCTGG + Intergenic
982445922 4:155490607-155490629 GTGAGAAATGGGGAGGTAGCAGG + Intergenic
983297714 4:165887259-165887281 ATGAGAAAGTGGGAGGAGGGAGG + Intronic
983690808 4:170466113-170466135 AGGTGAAAGAGGGAGGAAGCTGG - Intergenic
984172982 4:176383389-176383411 CTGAGAAAGGGAAATGATGCAGG + Intergenic
984439372 4:179747036-179747058 ATTATAAAGGGGTAGGTAGCAGG - Intergenic
985216773 4:187661668-187661690 AAAAGGAAGGGGAAGGAAGAAGG - Intergenic
985751970 5:1685757-1685779 ATGACAAATGGGAAGAAAGATGG + Intergenic
985851626 5:2392626-2392648 AAGAGAAAGAGGAAGGAGGGAGG - Intergenic
986057827 5:4156412-4156434 ATGAGAAAAGGGAATGAAACAGG - Intergenic
986129375 5:4912731-4912753 GAGAGAAAGGAGAAGGAAGAAGG + Intergenic
986522367 5:8633365-8633387 AGGAAGAAGGGGAAGGAAGTGGG - Intergenic
986853551 5:11841599-11841621 GTGAGAAAGAGAAATGAAGCAGG + Intronic
987041251 5:14064903-14064925 AAGAGACAGGGAAAGGAAGGAGG - Intergenic
987332558 5:16869951-16869973 AAAAGAAAAGGAAAGGAAGCAGG + Intronic
987622640 5:20355117-20355139 AAGAGAAAGGGGAAAGGAGCTGG - Intronic
987811419 5:22840960-22840982 AAGAACAAGGGGAAGGATGCAGG + Intronic
989141991 5:38210615-38210637 GTGAGAAAGGAGTAGGAAGGTGG + Intergenic
989239755 5:39190308-39190330 ATGAGAAAGAAGAAGAAAGTGGG + Intronic
989756216 5:44958768-44958790 AGGAGGAAGGAGAAGGAAGGAGG - Intergenic
989992752 5:50787299-50787321 ATGAGAGCAGGGAAGGAACCTGG - Intronic
990268028 5:54099710-54099732 AGGAGGAGGGGGAAGAAAGCAGG + Intronic
990811603 5:59731278-59731300 AAGAGAAATGGAAAGGAAGTAGG - Intronic
991352241 5:65731214-65731236 ATGAGAGAGTGGAAGGCAGTTGG + Intronic
991353802 5:65747411-65747433 ATGAGAATAGAGAAGGTAGCTGG + Intronic
993418886 5:87674875-87674897 AGGAGAAAGGAGAAAGGAGCAGG - Intergenic
993907187 5:93636190-93636212 ACTAGAAAGAGGAAGGAAGTAGG + Intronic
994153126 5:96473039-96473061 AAGAGAAAGGAGAGGGAAACTGG - Intergenic
994786090 5:104165407-104165429 ATAAAAAAGGGAAAGTAAGCAGG - Intergenic
995701116 5:114937075-114937097 CTGAGAAAAGGGAAGAAGGCAGG + Intergenic
996330924 5:122327902-122327924 ATGTGAAATGGGGAGGAAGATGG + Intronic
996760756 5:126983860-126983882 ATGAAAAAGATGAAGGAAGCTGG - Intronic
996823896 5:127660059-127660081 CTGAGGAAGGGCACGGAAGCTGG - Intergenic
997207433 5:132058054-132058076 ATGAGAAAGTTCAAGGCAGCAGG - Intergenic
997384595 5:133462742-133462764 ATGATAGAGTGGAAGGAAGCCGG + Intronic
997465696 5:134086683-134086705 AAGGGGAAGGGGAAGGAAGAAGG - Intergenic
998156832 5:139791939-139791961 AAGAGAAATGGGATGGTAGCTGG + Intergenic
998220449 5:140273830-140273852 GAGACAGAGGGGAAGGAAGCTGG + Intronic
998404707 5:141867767-141867789 ATGGGGAAGGGGAAAGGAGCTGG + Intronic
998411899 5:141917571-141917593 AGAAGAAAAGGGATGGAAGCTGG + Intergenic
998426578 5:142033935-142033957 AGGTGAGAGGGGAAGGAAGGAGG + Intergenic
998545494 5:143023886-143023908 AGGAGAAAGGGGAAAGAAAAAGG - Intronic
998793756 5:145794620-145794642 ATCTGTAAGAGGAAGGAAGCAGG + Intronic
999072795 5:148765349-148765371 ATGAGAAAGGAGAGGGAAGAGGG - Intergenic
999286689 5:150398522-150398544 ATGGGAAGGGGGCAGGAACCAGG - Intronic
999288487 5:150408201-150408223 AGGAGAAAAGGTAAGGAAGTGGG + Intronic
999371232 5:151056565-151056587 ATGAGGAAGAGGAAGGAAATGGG - Intronic
999687084 5:154112727-154112749 AAGAGAAAGGGAGAGGAAGGGGG + Intronic
999945464 5:156590821-156590843 AGGAGAGAGGGGAAGGAATAGGG - Intronic
999949079 5:156629323-156629345 ATAATAAATGGGAAGAAAGCAGG + Intronic
1000048762 5:157544114-157544136 AACAGAAAGGCGAAGGAAGGGGG + Intronic
1000245953 5:159448736-159448758 CTCTGAGAGGGGAAGGAAGCGGG + Intergenic
1001151795 5:169235947-169235969 ATGTGAAAAGGGAAGGGAGTGGG - Intronic
1001224537 5:169932409-169932431 GAGAGAATGGGGAAGGAAGATGG + Intronic
1001265485 5:170271179-170271201 AGAAGAAAGGGGAAGGATGCTGG + Intronic
1001412046 5:171519022-171519044 TGGAGAGAGGGAAAGGAAGCCGG + Intergenic
1001582105 5:172805964-172805986 AAGAGAAAGGAGAAGCAAGGCGG - Intergenic
1002726839 5:181304385-181304407 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1002728496 5:181317543-181317565 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1002943216 6:1735635-1735657 ATGAGAAAAGGCATGGAGGCAGG - Intronic
1002969138 6:1996155-1996177 ATGAGAAAGAGGAAGGAGGAAGG - Intronic
1003352350 6:5329949-5329971 AACAGAAAGGGGAAAGGAGCTGG - Intronic
1003381915 6:5632557-5632579 AGGAGGAAGGGAAAGGAAGAAGG - Intronic
1003932522 6:10939425-10939447 TTGAGAAAGAGGAATAAAGCTGG + Intronic
1003978917 6:11370968-11370990 ATGAGGAAGGGGACGGAGCCTGG + Intronic
1004015424 6:11727896-11727918 AAGAGAGAGGGGAAAGAAGAAGG + Intronic
1004635659 6:17465366-17465388 TTGATAAAGGGGAGGGAAACTGG + Intronic
1004751380 6:18565795-18565817 ATGAAAAAAGGGAGGGAAGGAGG - Intergenic
1005829387 6:29658426-29658448 AAGATACAGGGGAAGGAAGAGGG + Intronic
1005978847 6:30820534-30820556 GTGAATAAGGGCAAGGAAGCAGG - Intergenic
1006072501 6:31507632-31507654 CTGGGACAGGGGATGGAAGCTGG + Intronic
1006419034 6:33921983-33922005 AAGAGAAAGAGGAAGGACCCAGG + Intergenic
1006674840 6:35755062-35755084 ATGACTAAGAGGAAGGGAGCTGG - Intergenic
1006734586 6:36263962-36263984 GTGGGAAAGGGAAGGGAAGCGGG - Intronic
1006790469 6:36697961-36697983 ATGAGGATGGGGGAGGGAGCTGG + Intronic
1006803877 6:36776440-36776462 ATGGGAATGGGGATGGGAGCAGG + Intronic
1006853026 6:37113076-37113098 TGGAGAAAGGGGATGCAAGCTGG - Intergenic
1007072898 6:39049422-39049444 ATGAGAAAGGGAGAGGAGCCGGG - Intronic
1007160840 6:39790824-39790846 ATGAGAGAGGGAATGGAAGGAGG + Intergenic
1007188058 6:39989458-39989480 ATCAGAAAGGGGAGGGTAGGAGG - Intergenic
1007377474 6:41466663-41466685 AAGAGAAGGGGGGAGGAAGGAGG + Intergenic
1007492728 6:42236493-42236515 AGGAGAGAGGGGCAGGATGCTGG + Intronic
1007954276 6:45902188-45902210 ATGAGAAAGTGGATGGGAGTGGG - Exonic
1008046868 6:46860047-46860069 AGGAGAAAGGGGACTGCAGCGGG - Intronic
1008332499 6:50260895-50260917 AAGCGGAAGGGGAAGCAAGCTGG - Intergenic
1008519716 6:52351574-52351596 ATGAGACTGGAGAAGTAAGCCGG - Intergenic
1008760642 6:54847952-54847974 ATGAGAAAGGGAAAGAAGGGAGG - Intronic
1010193324 6:73215072-73215094 AGGAGAGAGGGGAAGGAAAGAGG - Intronic
1010193506 6:73217211-73217233 GTAAGAAAAGGGAAAGAAGCAGG + Intronic
1010322472 6:74528848-74528870 AGGATTAAGGGGGAGGAAGCTGG + Intergenic
1010709091 6:79152022-79152044 TTGGGAGAAGGGAAGGAAGCAGG + Intergenic
1011175911 6:84559958-84559980 AGCGGAAAGGGGAAGGAAGTTGG - Intergenic
1011428103 6:87252864-87252886 ATGAAAACTGGGAAGGAAGTGGG - Intronic
1011502732 6:88008658-88008680 ATGAGAAAACTGAAAGAAGCAGG - Intergenic
1011746953 6:90415310-90415332 ATGAGAATGGCACAGGAAGCAGG - Intergenic
1012150235 6:95741066-95741088 AAGGCAAAGGGGAAGCAAGCTGG + Intergenic
1012903574 6:105037502-105037524 AAAAGAGAGGGGAAGGGAGCGGG - Intronic
1013040306 6:106426466-106426488 ATCAGAAAGGGGAAGAAAGTGGG - Intergenic
1013590850 6:111618669-111618691 ACGAGAAAGGGGAAGGAGAGAGG - Intergenic
1014250011 6:119105464-119105486 AAGGCAAAGGGGAAGCAAGCAGG - Intronic
1014459060 6:121673565-121673587 GGGAGCAAGGGGAAGGAAGGCGG - Intergenic
1015127768 6:129773332-129773354 GAGAGAAAAGGGAAAGAAGCTGG + Intergenic
1015935345 6:138402831-138402853 AAGAGAAATGGGAAGGAGGGTGG - Intergenic
1016598511 6:145828614-145828636 CAGAGAACGGGGAAGGAAGAGGG + Intergenic
1017327426 6:153155428-153155450 AGGAGAATGAGTAAGGAAGCAGG + Intergenic
1017328803 6:153171731-153171753 ATGAGAAAGAAGAAGGAAACAGG + Intergenic
1018095909 6:160386868-160386890 ATGAGAAATAGGAAGGAGCCAGG - Intronic
1018144853 6:160876723-160876745 AGGCTAAAGAGGAAGGAAGCTGG + Intergenic
1018247693 6:161838600-161838622 ATGAGGAAGAGGAAGGTGGCTGG - Intronic
1018298663 6:162376854-162376876 AGGGGAAAGGGGGAGGAAGAGGG + Intronic
1018443952 6:163837995-163838017 ATGGGAAAGGGAGAGGGAGCAGG - Intergenic
1018827034 6:167415960-167415982 ATGAGAGAGTGGAACAAAGCTGG - Intergenic
1018883824 6:167914770-167914792 ATGCTAAACGTGAAGGAAGCGGG - Intronic
1019182424 6:170198971-170198993 CTGAGAATGGGGATGGAGGCAGG + Intergenic
1019272084 7:156013-156035 ATGAGAAATGGGAAGAATCCAGG + Intergenic
1019334970 7:478666-478688 AGGAGGAAGGGGAGGGAAGGAGG + Intergenic
1019410728 7:905480-905502 AGGAGAAAGGAGAAGGGAGAAGG + Intronic
1019410793 7:905803-905825 AGGAGAAAGGAGAAGGGAGAAGG + Intronic
1019472027 7:1226123-1226145 AGGAGGAAGGGGAAGGGAGAAGG + Intergenic
1019532704 7:1511610-1511632 GTGAGGAAGGGGAAGGACTCTGG + Intergenic
1020240406 7:6390042-6390064 AAAAGAAAGGAGAAGGAAGGAGG - Intronic
1020373426 7:7459657-7459679 ATTAGAAATGGGAATGGAGCTGG - Intronic
1020803172 7:12756842-12756864 CTGGGAAAGGAGAAGGAAACTGG + Intergenic
1021745028 7:23731585-23731607 CTGGAAAAGGGGAAGGAAGGAGG - Intronic
1021781615 7:24112600-24112622 ATGAGAAATGGATAGGAAGCAGG - Intergenic
1021869193 7:24986839-24986861 TGGAGAAAGGGAAAGGAAGAAGG - Intergenic
1022445735 7:30469385-30469407 AGTAGGGAGGGGAAGGAAGCCGG - Intronic
1022591585 7:31668988-31669010 TTGAGGAAGGAGAAGGAAGTAGG + Intergenic
1022806685 7:33829572-33829594 AGGAAAAAGGAGAAGGAAACAGG - Intergenic
1022972553 7:35530911-35530933 AGGAGTAAGGAGGAGGAAGCAGG - Intergenic
1023491370 7:40746146-40746168 ACGTGAAAGGGTAATGAAGCAGG + Intronic
1023598438 7:41856695-41856717 ATGAGAAAGGTGGAAGAAGGAGG + Intergenic
1023999629 7:45182040-45182062 ATCAGAAAGGGGTAGGAAACAGG - Intronic
1024071732 7:45791998-45792020 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1024072563 7:45798749-45798771 ATGAGAGAGGGGAGGGAAGGGGG + Intergenic
1024104842 7:46072467-46072489 ATTGGAAAGATGAAGGAAGCTGG - Intergenic
1024229910 7:47355870-47355892 ATGAGGGAGGGGAAGGAAGATGG + Intronic
1024514102 7:50229436-50229458 ATGGGAAAGAGGAAGGGTGCAGG + Intergenic
1024650769 7:51401433-51401455 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1024778218 7:52813875-52813897 TTGAGAAAGAAGAATGAAGCAGG - Intergenic
1025054890 7:55757013-55757035 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1025132963 7:56387239-56387261 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1025184599 7:56847662-56847684 ATGAGAATGGGGTGGGAAGGGGG - Intergenic
1025687330 7:63729306-63729328 ATGAGAATGGGGTGGGAAGGGGG + Intergenic
1025909515 7:65817104-65817126 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1025911028 7:65828827-65828849 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1026150916 7:67787518-67787540 ATGAGTCAGAGGAAGGAACCAGG - Intergenic
1026212660 7:68319553-68319575 ATGAGGAAGGGGCAGGCTGCTGG - Intergenic
1026582725 7:71631666-71631688 AGGAGATAAGGGAAGGAAGGAGG + Intronic
1027386355 7:77663000-77663022 AGGAGAGAGAGGAAGGAAGGAGG + Intergenic
1027484941 7:78749783-78749805 AAGAGAGAGAGGAAGGAGGCAGG + Intronic
1027533581 7:79367140-79367162 ATGGGTAAGTGGAAGGAAGAGGG - Intronic
1027741190 7:82008061-82008083 ATGAAAAAGGGGGAGGACACAGG - Intronic
1027845312 7:83365253-83365275 AAGAGAAATGGGAAAGAAGAGGG - Exonic
1027853891 7:83484326-83484348 ATGACAAGGAGGAAGGTAGCAGG - Intronic
1028428011 7:90712601-90712623 ATGGGAAAGGGCAAGGAATAAGG + Intronic
1028451799 7:90993514-90993536 AAGAAGAAGGGGAAGGAAGGAGG + Intronic
1028456487 7:91043650-91043672 ATGACGAAGGGGAAGGAGGCAGG - Intronic
1028584609 7:92440301-92440323 AAGGGAAAGGGGAAGGAAGGAGG + Intergenic
1028794652 7:94889475-94889497 ATGACAAAGGGAAAGGGAGTTGG + Intergenic
1028977817 7:96933524-96933546 AGGAGGCAAGGGAAGGAAGCTGG + Intergenic
1029550639 7:101235537-101235559 AGGAGAAGGGGGAAGCAAGAGGG - Intronic
1029635168 7:101778708-101778730 AAAAGAAAGAGGAAGGAAGGTGG - Intergenic
1030091660 7:105863549-105863571 AGGACTAAGGGGAAGCAAGCAGG - Intronic
1030099459 7:105932780-105932802 TTCAGAAAGGGGAAGGAACGTGG + Intronic
1030299162 7:107957894-107957916 ATGAGAAAGGGTATGGGAGAAGG - Intronic
1030551370 7:110964771-110964793 AATAGAAAGAGGAAGGAAGGAGG - Intronic
1030786412 7:113668802-113668824 ACTAGAAAGGGGAGGGAAGGAGG + Intergenic
1030811900 7:113982832-113982854 AGGAGAAAGGTGGAGGAAGGTGG + Intronic
1030898831 7:115096558-115096580 CTGAGAATGTGGAAAGAAGCTGG - Intergenic
1030992740 7:116319855-116319877 AAGAGAGAGAGGAAGGAAGGAGG + Intronic
1031672611 7:124568541-124568563 ATGGTAAAGGGGAAAGAACCTGG - Intergenic
1031874593 7:127123872-127123894 AAGGGAAAGGGAAAGGAAGAAGG - Intronic
1032048349 7:128629604-128629626 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1032049950 7:128642427-128642449 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1032071281 7:128808811-128808833 ATGGGAAAGGAGAAGCATGCTGG + Intronic
1032300351 7:130680725-130680747 ATGAGAACTGGGAAGAAAGTGGG - Intronic
1033023725 7:137753190-137753212 ATGAGAAAGGAAAAGCAAGGTGG + Intronic
1033494238 7:141877505-141877527 GTTCTAAAGGGGAAGGAAGCTGG - Intergenic
1033663445 7:143419533-143419555 TTGAGAAAAGGTCAGGAAGCAGG + Intergenic
1034051997 7:147993873-147993895 TTGTGAAGGGGGAAGGAAACAGG - Intronic
1034053480 7:148008460-148008482 ATGAGAAGAGGAAAGGAAGCAGG - Intronic
1034074878 7:148222020-148222042 ATGAAGAAGGGGATGGCAGCTGG - Intronic
1034083557 7:148302700-148302722 ATGGGGAAGGGGAAGTAGGCAGG - Intronic
1034283049 7:149866726-149866748 CTGACAAAGGGGAACGGAGCAGG - Exonic
1034535648 7:151724334-151724356 ATGACAAAGGGGCTGGGAGCTGG - Intronic
1034653411 7:152710497-152710519 AGGAGAAAAGGGAAGGAAAGAGG + Intergenic
1035174012 7:157037706-157037728 AGGAGAAAGGGGAGGGAGCCTGG + Intergenic
1036421691 8:8602087-8602109 CTGACAAAGGGGAAGGAAACAGG - Intergenic
1036465400 8:8992685-8992707 CAGAGAAAAAGGAAGGAAGCAGG + Intergenic
1036546194 8:9771812-9771834 GGGAGAAGGGGGAATGAAGCGGG + Intronic
1036987881 8:13557072-13557094 ATGAGACAGGGGAAAGCTGCTGG + Intergenic
1037548274 8:19944959-19944981 AAGGGGAAGGGGAAGGAAGGAGG - Intronic
1037663929 8:20951497-20951519 AAGAGAGAAGGGAAGGAAGAAGG + Intergenic
1037752550 8:21692347-21692369 AAGAGAAAGGGGAAAGGAGGAGG + Exonic
1037833291 8:22201457-22201479 AAGAGAAAGGAGCAGGACGCAGG - Intronic
1038086130 8:24198306-24198328 ATGAGAAAGAGAATGCAAGCAGG - Intergenic
1038679334 8:29652432-29652454 AGAAGAAAGAGGAAGGAAGGAGG + Intergenic
1038820893 8:30951100-30951122 AAAAGAAAGAGGAAGGAAGGAGG - Intergenic
1038982477 8:32775095-32775117 ATGCGAGAGGGGATGGAAGGAGG - Intergenic
1039081617 8:33739359-33739381 GTGGGGAAAGGGAAGGAAGCAGG + Intergenic
1039164169 8:34658255-34658277 ATGAGAAAGGAGAGATAAGCAGG + Intergenic
1039441094 8:37595805-37595827 ATGAGAAAGGGGAAACTAGATGG + Intergenic
1039676220 8:39671036-39671058 TTTGGAAATGGGAAGGAAGCTGG - Intronic
1039737541 8:40348639-40348661 ATGAGAAAGAGGGAGGAAGGTGG - Intergenic
1039815673 8:41092529-41092551 ATGGGAAAGGGAAGGGAAACTGG + Intergenic
1039846675 8:41330378-41330400 GGGAGAAAGGGAAAGGAAGAGGG + Intergenic
1039954526 8:42196852-42196874 ATGAGAAGAAGGAAGGAAGGGGG + Intronic
1039963800 8:42269652-42269674 AAGAGAAAGGAGAGGGAAGAGGG + Intergenic
1040463998 8:47677881-47677903 ATGCAAAAGGGGAAGTAAGAGGG + Intronic
1040528023 8:48241331-48241353 ATCAAAAAGGGGAAGGAATGGGG + Intergenic
1040577642 8:48667685-48667707 ATTAGTAAGGGGAAGGGGGCTGG - Intergenic
1041321243 8:56615138-56615160 AAGAGGAAGGGGAAGGAGGGAGG - Intergenic
1041340986 8:56845119-56845141 ATGGGAGAGGGGCAGGAGGCAGG + Intergenic
1042082947 8:65075923-65075945 AAGATGAAGGGGAAGAAAGCAGG + Intergenic
1042552355 8:70005220-70005242 AAGAGAGAGAGGAAGGAAGGAGG + Intergenic
1042758658 8:72246803-72246825 AAGAGAAAGGGGCAGGGAGTTGG - Intergenic
1043128640 8:76432827-76432849 ACTCGAAAGGGGGAGGAAGCCGG + Intergenic
1043476496 8:80610778-80610800 ATGAGAAAGGGAGAGGGAGAAGG - Intergenic
1043499541 8:80838804-80838826 AGGAGAAAGGGGAAAGGAACAGG + Intronic
1043811658 8:84750104-84750126 ATAAGAAAGGGGAAAGAACTGGG + Intronic
1044706174 8:95010866-95010888 AAGACAAAGGGGAAGGAAGCAGG + Intronic
1044902768 8:96966367-96966389 ATGAATAAGGGAAAGGAAGTAGG - Intronic
1045085405 8:98677535-98677557 AGGAGGAAGAGGAAGGAAGAAGG + Intronic
1045333865 8:101180733-101180755 AAGATAAAGGGGAAGACAGCAGG - Intronic
1045690081 8:104751386-104751408 AGGAGTAAGGAGAAAGAAGCAGG + Intronic
1045866692 8:106874254-106874276 ATTAAAAAGAGGAAGGAAGGGGG + Intergenic
1045930511 8:107620450-107620472 AGGAGCAAGGGCAAGGATGCGGG - Intergenic
1046001193 8:108422443-108422465 AAGAGAAAAGGAAATGAAGCAGG + Intronic
1046088648 8:109470505-109470527 AAAAGAAAGGGAAAAGAAGCAGG + Intronic
1046126074 8:109910226-109910248 AAGGGAAAGGGGAAGGGAGAGGG - Intergenic
1046368935 8:113274853-113274875 AAGAAAAAAAGGAAGGAAGCAGG + Intronic
1046664501 8:116986000-116986022 ATGAGAAAGTGGAAAGTTGCTGG - Intronic
1046704044 8:117430714-117430736 ATGAGAGATGGCAAGGAAGTTGG + Intergenic
1046774083 8:118145639-118145661 ACGTGAAAGGGTGAGGAAGCGGG + Intergenic
1046918917 8:119706852-119706874 AAGAGAGAGAGGAAGGAAGGAGG - Intergenic
1047701392 8:127452696-127452718 AGGAGAAAGGGGAAGGGAGAGGG + Intergenic
1047830848 8:128628137-128628159 AGGAGGATGGGGAAGGAAGAGGG - Intergenic
1048774605 8:137932059-137932081 ATGTGTAAGGGAAAGGAAGCAGG - Intergenic
1048803432 8:138216486-138216508 TGGAGAAAGGGAAAGGATGCAGG + Intronic
1049214829 8:141402735-141402757 ATGAGAAAGCGGAAGCAGGGGGG - Intronic
1049296245 8:141841237-141841259 AAGAGAAAGGGGAAGCAAGGCGG - Intergenic
1049349122 8:142154652-142154674 ATGGTAAAGTGGAAGGAAGCTGG + Intergenic
1049616867 8:143579324-143579346 ATGACAAAGGGCATGGCAGCAGG + Intergenic
1050353719 9:4763539-4763561 AGGAAAAAGGGGGAGGAGGCAGG + Intergenic
1051010700 9:12409966-12409988 AAGAAAAATGGGAAGGAATCCGG - Intergenic
1051180186 9:14403534-14403556 AAGAGAAATGGGAAAGAAGAGGG - Intergenic
1051193927 9:14542794-14542816 ATGAGAAGGGGAGAGGAAGTGGG - Intergenic
1051328274 9:15997083-15997105 AAGATAAAGGGGAAGAAAGGAGG + Intronic
1051333354 9:16045255-16045277 ATGAGACAGGGAAGGGAAGGAGG + Intronic
1052183860 9:25565421-25565443 ATGAGACATGGAAAGGAAGAAGG - Intergenic
1052415244 9:28169730-28169752 TTGAGAAATGGAAAGGTAGCTGG + Intronic
1052502176 9:29305924-29305946 AGGAGAGAGGGGAAGAAAGCAGG + Intergenic
1053051478 9:34964539-34964561 ATAAGGAAGGGGAAGGAAGCTGG - Intronic
1053350722 9:37411768-37411790 AGGAGCAAGGGGATGGAGGCAGG - Intergenic
1053512294 9:38698593-38698615 ATGAAAAATTGGAAGGAAACTGG - Intergenic
1053754015 9:41284871-41284893 AGGAGAAAGAGGAAGCAGGCAGG - Intergenic
1053900927 9:42794856-42794878 AGGAGAAAGGGGACTGCAGCAGG + Intergenic
1054259533 9:62849233-62849255 AGGAGAAAGAGGAAGCAGGCAGG - Intergenic
1054260719 9:62862687-62862709 AGGAGAAAGGGGACTGCAGCAGG - Intergenic
1054332240 9:63770804-63770826 AGGAGAAAGAGGAAGCAGGCAGG + Intergenic
1054453902 9:65420053-65420075 AGGAGGGAGGGGAAGGAAGAAGG + Intergenic
1054846593 9:69805292-69805314 ATTAGAAAAGGCAAGGAGGCAGG - Intergenic
1055237703 9:74143876-74143898 ATGGGAATGGGGAAGGGAGATGG - Intergenic
1055477598 9:76678380-76678402 AGGAGAAAGGGAAAGGAGGGAGG + Intronic
1055684497 9:78756429-78756451 ATGAGAAAGCTGTATGAAGCTGG + Intergenic
1055730272 9:79273804-79273826 GAGAGAAAGAGGAAGGAAGGAGG + Intergenic
1055744928 9:79433120-79433142 ATGAGAAAGAGGAAGAAAAAAGG - Intergenic
1055791340 9:79926227-79926249 AGGAGAAAGGGGAAGGGAGAAGG + Intergenic
1055869525 9:80857498-80857520 ATGAGAAAGGAGAATGTTGCTGG + Intergenic
1056267665 9:84915505-84915527 ATGGGAAAGGGAAAGGGAGCTGG - Intronic
1056286449 9:85092160-85092182 ATGAGCAAGGGCAGGGAACCAGG - Intergenic
1056678647 9:88697830-88697852 AGAGGAAAGGGGAAGGAAGACGG - Intergenic
1056965187 9:91159459-91159481 AAGAGAAAGAGGAGGGAAGGAGG + Intergenic
1056985555 9:91361487-91361509 GTGAGAAAGGGGAGGGACCCAGG + Intronic
1057012413 9:91616890-91616912 CTCAGAAAGGGGAAGGAAGTTGG + Intronic
1057108604 9:92445313-92445335 AGGCTCAAGGGGAAGGAAGCTGG - Intronic
1057258981 9:93573736-93573758 AAAAGAAAGGGGAAGTCAGCTGG + Intergenic
1057357979 9:94347384-94347406 ATGAAGAAGGGGAAGAAAGTGGG - Intergenic
1057515112 9:95714186-95714208 GAAAGGAAGGGGAAGGAAGCAGG + Intergenic
1057649771 9:96910233-96910255 ATGAAGAAGGGGAAGAAAGTGGG + Intronic
1058561440 9:106233161-106233183 AGGAGAAAGGAGAAGGAAGAAGG - Intergenic
1058793260 9:108472082-108472104 AGGAGAAAGGAGAAGTCAGCAGG - Intergenic
1058814851 9:108673707-108673729 ATGAGGCTGGAGAAGGAAGCTGG + Intergenic
1058880076 9:109278212-109278234 CTGAGAAATGAGAAGGAACCCGG + Intronic
1059067645 9:111102441-111102463 ATGAGAGGTGGGAAGAAAGCAGG + Intergenic
1059072454 9:111152930-111152952 AGGAGGAAGGAGGAGGAAGCAGG + Intergenic
1059287537 9:113188046-113188068 ATGAGCCAGTGGAAGGAAACTGG + Intronic
1059537661 9:115097658-115097680 ATGAGAAAAGGCAAAGAAGTTGG + Intronic
1059593749 9:115693458-115693480 ATAAGAAAAGGGAAGGGAGCCGG - Intergenic
1059757609 9:117308489-117308511 AGGAGAATCTGGAAGGAAGCAGG + Intronic
1059953802 9:119495307-119495329 ATGATGTAGAGGAAGGAAGCAGG + Intergenic
1060557493 9:124516174-124516196 CTGAGGAATGGGAAGGCAGCTGG + Intergenic
1060732346 9:126046714-126046736 AGGAAGAAGGGGAAGGAAGAGGG - Intergenic
1060835351 9:126751556-126751578 AGGAGAAAGGAGGAGGAAGTGGG - Intergenic
1061045500 9:128162878-128162900 AGGAGAGAAGGGAAGGAAGATGG + Intronic
1061244773 9:129395854-129395876 ATGAGAAGGTGGAAGGAGGATGG + Intergenic
1061510026 9:131054764-131054786 AAGAGAGAGGGGAAGGGAGGGGG + Intronic
1062050604 9:134444634-134444656 AAGAGAAGAGGGAAGGAAGGAGG - Intergenic
1062050628 9:134444718-134444740 AGGAGAAGGGGGAAGGAAGGAGG - Intergenic
1062092579 9:134686214-134686236 AGGAGAAGGAGGAAGGAAGAAGG - Intronic
1062410480 9:136421706-136421728 ATAAGAAAGGGAAGGGCAGCCGG - Intronic
1062751957 9:138261861-138261883 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1062753559 9:138274642-138274664 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1203576071 Un_KI270745v1:9421-9443 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1185518381 X:717924-717946 AAGAGAAACTGGAAGGAAGCAGG - Intergenic
1185593065 X:1291424-1291446 AAGAAAAAGAGGAAGGAAGGAGG - Intronic
1185797285 X:2977297-2977319 AAAAGAAAGAGGAAGGAAGAAGG - Intergenic
1186367390 X:8909871-8909893 ATGGGAGGAGGGAAGGAAGCTGG + Intergenic
1186588878 X:10906987-10907009 TTGAGAAAGAAGAAGAAAGCAGG - Intergenic
1186595860 X:10980835-10980857 AGGGCAAAGGGGAAGCAAGCAGG + Intergenic
1186746146 X:12571443-12571465 AGGAGAAAGGGGAAACAGGCAGG - Intronic
1186864149 X:13702247-13702269 ATGAGAAAAGAGGAGGGAGCAGG - Intronic
1187025678 X:15433623-15433645 AGGAGAAAGGAGAAAGAAGGAGG + Intronic
1187025738 X:15433899-15433921 AGGAGGAAGGGGAAAGAAGGAGG + Intronic
1187262814 X:17702915-17702937 ATGGGGAAGGGGTGGGAAGCAGG - Intronic
1187361951 X:18636860-18636882 CTGGGAAAGGGGATGGAAGGTGG - Intronic
1187452674 X:19412588-19412610 AAGAGAAAGAGGAAGGGAGGGGG + Intronic
1187991776 X:24881915-24881937 ATGAGAAAGGGCAGGGGAGTGGG + Intronic
1188981567 X:36731570-36731592 ATAAGAAAGGAGTAGGAAGAAGG - Intergenic
1189116569 X:38349198-38349220 ATGAGACAGGGAAGGGAAGGTGG + Intronic
1189282045 X:39825818-39825840 AAGGGAGAGGGGAAGGAAGGAGG - Intergenic
1189307870 X:40000712-40000734 ATGAGAAGGCAGAAGGGAGCTGG + Intergenic
1189615834 X:42782642-42782664 ATGAGAAAGGGGAAAAGAGTAGG + Intergenic
1189648216 X:43157844-43157866 AGGATAAAGGGGGAGGGAGCAGG + Intergenic
1189817793 X:44841524-44841546 ATGAGCAAAGGTAAGGAAACAGG + Intergenic
1189818416 X:44846794-44846816 ATTAGAAAGGGGAAGCATGAGGG - Intergenic
1190735768 X:53255256-53255278 ATGAGAAAGGAGAAGGAGAGAGG + Intronic
1191705934 X:64094585-64094607 TTGGGAATGGGGAAGAAAGCTGG - Intergenic
1192033615 X:67541762-67541784 AGGAGAAAGAAGAAGAAAGCTGG + Intergenic
1192139249 X:68633559-68633581 AGGAGAAAGGGGAAGGACAAAGG + Intergenic
1192243043 X:69349851-69349873 AGGAGAAGGGGGAAGGAGGGAGG - Intergenic
1192448957 X:71230897-71230919 AAGGGGAAGGGGAAGGAAGAGGG + Intergenic
1192459496 X:71304777-71304799 ATGAAAAGGGAGAAGGAAGAGGG - Intronic
1192797457 X:74435880-74435902 TTGAGAAAGGGGAAGGGACTTGG - Intronic
1193103006 X:77636928-77636950 AGGAGGAAGGAGAAGGAAGAAGG + Intronic
1193810811 X:86048499-86048521 AAGCAAAAGGGGAAGGATGCTGG + Intergenic
1193861274 X:86671582-86671604 AAGGCAAAGGGGAAGGAAGCAGG - Intronic
1194268077 X:91779294-91779316 GGGAGAAAGGGGAAGGAAGGGGG - Intronic
1194378000 X:93159922-93159944 ACCTGAAAGGGGAAGGAAGGAGG + Intergenic
1194417806 X:93635319-93635341 ATTAGAGAGGGAAAGGAAGAGGG + Intergenic
1194450279 X:94037378-94037400 TTGAGAAAGAGGAACAAAGCTGG - Intergenic
1195026494 X:100882821-100882843 ATGGCAAAGGGGAATGAAGGTGG + Intergenic
1195355287 X:104033700-104033722 CTGAGGAAGGGGCAGGAAGGAGG + Intergenic
1195493604 X:105503457-105503479 AAGAGAAAAAAGAAGGAAGCTGG + Intronic
1195700498 X:107701996-107702018 AGGAGGAAGGGGAAGAAAGATGG - Intergenic
1196549462 X:117005389-117005411 ATGAAAGAGGGGAAGGTAGGGGG + Intergenic
1196674988 X:118410264-118410286 AGGAGAAAGGAGAAGAAAGGTGG + Intronic
1196681705 X:118476117-118476139 TTGAGAAAGAGCAAGGAAGCTGG + Intergenic
1196965710 X:121052379-121052401 ATGAGAAAAGGGAAGAAATCTGG + Intergenic
1197160119 X:123313540-123313562 AGGAAAAGGGGGAAGGAAGTGGG - Intronic
1198117242 X:133555980-133556002 ATGAAAAAGGAGGAGGAATCTGG - Intronic
1198783852 X:140266243-140266265 ATGGGAATGGAAAAGGAAGCGGG - Intergenic
1198831560 X:140756493-140756515 ATGGAATAGGGGAAGGGAGCAGG + Intergenic
1199036122 X:143052996-143053018 TTTGGAAAGGGGAAGGAAGAGGG - Intergenic
1199297049 X:146171219-146171241 AGGAGAAAGGAGAAGGAGGAAGG - Intergenic
1199316529 X:146385261-146385283 TGGAGAGAGAGGAAGGAAGCAGG + Intergenic
1200585280 Y:5000215-5000237 GGGAGAAAGGGGAAGGAAGGGGG - Intronic
1200692079 Y:6316457-6316479 ATAAGAAAGAGGAAGGAAAATGG + Intergenic
1200713635 Y:6512482-6512504 ATAAGAAAGAGGAAGGAAAATGG - Intergenic
1201020292 Y:9649559-9649581 ATAAGAAAGAGGAAGGAAAATGG + Intergenic
1201043193 Y:9858270-9858292 ATAAGAAAGAGGAAGGAAAATGG - Intergenic
1201322817 Y:12719280-12719302 ATAAGAAAAGGCAATGAAGCTGG - Intronic