ID: 1078578053

View in Genome Browser
Species Human (GRCh38)
Location 11:12517812-12517834
Sequence CACTGAAGACGTTGAGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 180}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078578053_1078578060 12 Left 1078578053 11:12517812-12517834 CCCTCTGCTCAACGTCTTCAGTG 0: 1
1: 0
2: 0
3: 12
4: 180
Right 1078578060 11:12517847-12517869 ACCCATTATAAGAGCTGAGCTGG 0: 1
1: 0
2: 1
3: 1
4: 61
1078578053_1078578064 17 Left 1078578053 11:12517812-12517834 CCCTCTGCTCAACGTCTTCAGTG 0: 1
1: 0
2: 0
3: 12
4: 180
Right 1078578064 11:12517852-12517874 TTATAAGAGCTGAGCTGGGAAGG 0: 1
1: 0
2: 2
3: 20
4: 221
1078578053_1078578062 13 Left 1078578053 11:12517812-12517834 CCCTCTGCTCAACGTCTTCAGTG 0: 1
1: 0
2: 0
3: 12
4: 180
Right 1078578062 11:12517848-12517870 CCCATTATAAGAGCTGAGCTGGG 0: 1
1: 0
2: 1
3: 3
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078578053 Original CRISPR CACTGAAGACGTTGAGCAGA GGG (reversed) Intronic
901057155 1:6453956-6453978 CACAGAAAACATTGAGCACAGGG + Intronic
906279225 1:44542338-44542360 CACTGAGGACAGTCAGCAGAGGG + Intronic
907506272 1:54920866-54920888 CACTGAAGGCTCTGAGCAGGGGG - Intergenic
907983172 1:59504930-59504952 CACTGCTGACGTTGTGCTGAGGG + Intronic
908641867 1:66232774-66232796 CACTGATGATCTTGACCAGAGGG + Intronic
908756320 1:67472075-67472097 CACTGGAGGGTTTGAGCAGAAGG + Intergenic
909524096 1:76603088-76603110 TACTGAAGACGAAGAGCAGCAGG + Intronic
909772268 1:79438929-79438951 CACTGAAAAACTTGAGCAGATGG - Intergenic
909907139 1:81211054-81211076 CAGTGATGACCTTGAGCAGTAGG - Intergenic
910243970 1:85119543-85119565 CACTGAAGAGTTTGAGCAGGGGG - Intronic
912811478 1:112798430-112798452 CACGGGAGACTTTGAGCAGCTGG + Intergenic
913685747 1:121230416-121230438 CACTGGAGAATTTGAACAGAGGG - Intronic
914037595 1:144018019-144018041 CACTGGAGAATTTGAACAGAGGG - Intergenic
914151859 1:145049913-145049935 CACTGGAGAATTTGAACAGAGGG + Intronic
915242901 1:154536450-154536472 CACTGGAGGCTTTGAGCAGGGGG + Intronic
916471978 1:165132780-165132802 AAATGAAGATGTTGAGCAGTTGG + Intergenic
916558862 1:165915693-165915715 CACTGAGGTCCTTGAGGAGAAGG - Intergenic
917921112 1:179750694-179750716 CACTGAAGTACTTGAGCAGTAGG + Intronic
918113301 1:181476791-181476813 CACTGATGGGGGTGAGCAGAGGG - Intronic
918118547 1:181517422-181517444 CACGGAAGGCTTTGAGCAGGGGG + Intronic
918701018 1:187608063-187608085 CAATGAAGACATTAAGAAGAAGG + Intergenic
920473068 1:206248973-206248995 CACTGGAGAATTTGAACAGAGGG - Intronic
921812550 1:219531165-219531187 CCCTTAAGACGTTGATGAGATGG + Intergenic
923246526 1:232137666-232137688 CACTGAGAACGCTGGGCAGAAGG - Intergenic
1064545447 10:16445725-16445747 CAGAGAAGACATTGGGCAGAAGG - Intronic
1067448771 10:46368695-46368717 CACTGGGGACCTTGAGCAGCAGG + Intergenic
1067588601 10:47492070-47492092 CACTGGGGACCTTGAGCAGCAGG - Intergenic
1067635727 10:48000161-48000183 CACTGGGGACCTTGAGCAGCAGG - Intergenic
1068078107 10:52283392-52283414 GACTGAGGACTTTGAGCACAGGG + Intronic
1068147916 10:53094818-53094840 CACTGAAGAAGATGTACAGATGG - Intergenic
1070132287 10:73664168-73664190 CACTGGGGACCTTGAGCAGCAGG - Intergenic
1070355845 10:75639558-75639580 CCGTGAAGAAGTTGGGCAGAGGG + Intronic
1071609393 10:87019908-87019930 CACTGGGGACCTTGAGCAGCAGG + Intergenic
1076453132 10:130570696-130570718 CACCGAAGACATGGAGCAGGTGG - Intergenic
1077358455 11:2129334-2129356 CACTGAAGACATTGGGGACACGG + Intronic
1078578053 11:12517812-12517834 CACTGAAGACGTTGAGCAGAGGG - Intronic
1078694802 11:13620464-13620486 CATTGAAGAACTTCAGCAGATGG - Intergenic
1079456589 11:20641836-20641858 CACTTAAGACACTGAGGAGAAGG + Intronic
1080819581 11:35792638-35792660 CACTGAAGACATTTGGCAGCTGG - Intronic
1081644113 11:44778021-44778043 CCTTGGAGAGGTTGAGCAGATGG + Intronic
1084947528 11:72646588-72646610 CAGTGAAGATTATGAGCAGAGGG - Intronic
1085319489 11:75565218-75565240 CCCTGAAGCCGTGGAGCAGATGG + Intronic
1088132603 11:106512299-106512321 CACTGAAGACACTGGGCATAAGG + Intergenic
1088740791 11:112765333-112765355 CACTGAAGATGGTGACCAGCAGG + Intergenic
1093898562 12:24604369-24604391 CACTGAAACTGTTGAGCAGAAGG - Intergenic
1093898671 12:24605104-24605126 CACTGAAACTGTTGAGCAAAAGG + Intergenic
1097148032 12:56954985-56955007 CACTGGAGACGTTGACCACACGG + Exonic
1097950069 12:65418093-65418115 CAGTGAAGACGTGGAGAAAAGGG - Intronic
1098594156 12:72251932-72251954 CACTGAAGAGGATGTACAGATGG - Intronic
1099095691 12:78371866-78371888 CAGTGAATACCTTGATCAGATGG - Intergenic
1106093068 13:26616391-26616413 CACTAAAGAAGTTATGCAGATGG - Intronic
1106373388 13:29159700-29159722 CACTGAAGAAGATGTACAGATGG + Intronic
1106674287 13:31941427-31941449 CCCTGAAGAATCTGAGCAGAAGG + Intergenic
1108010778 13:46006522-46006544 GACTGAACACTCTGAGCAGATGG - Intronic
1110871612 13:80458912-80458934 TAATGAAGAAGTTGGGCAGATGG - Intergenic
1111441689 13:88289955-88289977 CATTGAATAGGCTGAGCAGATGG + Intergenic
1113008549 13:105736672-105736694 TTCTGAAGACCTGGAGCAGAAGG - Intergenic
1117054881 14:51901657-51901679 CCCTGACAACGTAGAGCAGAGGG - Intronic
1117535851 14:56702751-56702773 CACTGCAGGAGGTGAGCAGAGGG - Intronic
1117571624 14:57054774-57054796 CACTGATGAAATTGAGAAGATGG + Intergenic
1120534871 14:85682131-85682153 CAGTGAAGACGTTGAAAAAAAGG + Intergenic
1120763566 14:88307811-88307833 CACTGAAGACCCTCAGCAAATGG + Intronic
1121219642 14:92275831-92275853 CAGTGAAGACCTTGAGCGGTGGG - Intergenic
1121949870 14:98162504-98162526 CACTGCAGACAGTGAGGAGAGGG - Intergenic
1122100162 14:99402137-99402159 GACTGAAGACCTTTAGCATAGGG - Intronic
1124011292 15:25840930-25840952 CACTGAAGAAGGTATGCAGATGG - Intronic
1124395279 15:29295252-29295274 CACTGACGACGATGGGCAGCTGG + Intronic
1124475747 15:30032964-30032986 CACTGCAGACGCTGTGCTGAAGG + Intergenic
1126472884 15:49034184-49034206 CACTGAAGAAGTTGGGCTAATGG + Intronic
1127507791 15:59611669-59611691 CACTAAAGAAGATGAGGAGAGGG - Intronic
1128159898 15:65416732-65416754 CACTGAGGAGATTGAGGAGAAGG - Intronic
1128369699 15:67031570-67031592 AACTGAAGAGGTTGACCAGATGG + Intergenic
1128591298 15:68899908-68899930 CACTGAAGACAGTGAAGAGAAGG + Intronic
1128885671 15:71285085-71285107 CTCTGAAGATGTAGAGCGGATGG - Intronic
1129234764 15:74217502-74217524 CACTGATGTCATTGAGCAGCAGG + Intergenic
1129665129 15:77575381-77575403 AAATGAAGACAATGAGCAGAAGG + Intergenic
1132086216 15:98910475-98910497 CACTCAAGAGGTGAAGCAGAGGG - Intronic
1133395965 16:5447797-5447819 CACAGAAGAGGCTGAGCAGTGGG - Intergenic
1133782478 16:8950533-8950555 CACTGAAGACTTTGATCACTTGG + Intronic
1136559134 16:31028361-31028383 CCCAGAAGACGGAGAGCAGAAGG + Intergenic
1137494668 16:48960620-48960642 CAATGTGGACCTTGAGCAGAGGG - Intergenic
1140937615 16:79689262-79689284 CACTGAAGAGGGTGTACAGATGG + Intergenic
1144213819 17:13037157-13037179 CACTGGAGATGAAGAGCAGATGG + Intergenic
1149106703 17:52976033-52976055 CAGTGAAGATGTGGAGCAGTAGG - Intergenic
1150031722 17:61744187-61744209 CACTGAAGACTGTGAGATGATGG + Intronic
1155833216 18:30544160-30544182 CAATGAAGATTTTGAGAAGAAGG - Intergenic
1157853170 18:51077395-51077417 CACTGAAGAGGTTAAGAACAGGG - Intronic
1160593701 18:79960143-79960165 CATTGTAGAATTTGAGCAGAGGG + Intergenic
1168086707 19:54053046-54053068 CACTGATGAAGTTGAGCTGGAGG - Intronic
929019623 2:37538689-37538711 CTCTGAAGTCCTTGAGAAGAAGG + Intergenic
929159275 2:38815411-38815433 CACTTAAGCCTTTGAGCAGTGGG - Intronic
933092869 2:78143959-78143981 CACTGAAGATGTGGAGCAATGGG - Intergenic
933710375 2:85320989-85321011 TACTGGAGAAGTTGAGCAGCGGG + Intronic
935177093 2:100658415-100658437 CACTGAAGAGGATGTGCAGATGG - Intergenic
938748116 2:134300375-134300397 CCCTCAAGACATTCAGCAGAAGG - Intronic
938833154 2:135073425-135073447 CACTGATGGCCTTGAGCTGAGGG - Intronic
939174018 2:138729120-138729142 CACTAAAGCTGTTGAGGAGAAGG - Intronic
939601647 2:144199347-144199369 CACTAAAGAAGTTCAGTAGAAGG - Intronic
939971263 2:148663933-148663955 CACAGCAGGAGTTGAGCAGAGGG - Intronic
940948976 2:159650550-159650572 CACTGAAAAGGTTTAGAAGAGGG - Intergenic
941037591 2:160585040-160585062 CACTCAAGATGCAGAGCAGAGGG - Intergenic
942602946 2:177659796-177659818 CTCCAAAGACGTTGAGCAGCAGG + Intronic
943513475 2:188855431-188855453 AACTGCAGAAGTAGAGCAGAAGG - Intergenic
944481243 2:200159960-200159982 CACTGAAGACCTGGGCCAGATGG - Intergenic
947562617 2:231170601-231170623 CAGTGAAGACATTGAGGAGCTGG + Exonic
948235112 2:236381728-236381750 CACTGAAGAGGATGTACAGATGG - Intronic
1170112699 20:12822820-12822842 CACTTAATACGTTGAACAAAGGG - Intergenic
1172036610 20:32015238-32015260 CACTGAGGAGGCTCAGCAGATGG - Intronic
1175804601 20:61820554-61820576 CACTGCACCCGCTGAGCAGAGGG + Intronic
1176512909 21:7762117-7762139 CACTGTAGAAGATGGGCAGAGGG + Intronic
1178647022 21:34392641-34392663 CACTGTAGAAGATGGGCAGAGGG + Intronic
1179469343 21:41600229-41600251 CACAGAAGGCCTTGAGCACAGGG + Intergenic
1182307500 22:29380846-29380868 GTTGGAAGACGTTGAGCAGAGGG - Intronic
1182815474 22:33159398-33159420 CACTGAAAAAGGTGAGCAGGAGG - Intergenic
949300464 3:2577532-2577554 CAATGAAGGAGTTGAACAGATGG + Intronic
950350693 3:12348619-12348641 CAATGTAGAGGTTGAGAAGAGGG - Intronic
952997083 3:38894946-38894968 CAATGAAGAGGTTGAGCACCTGG + Exonic
953544507 3:43854421-43854443 AACTGAATATGTAGAGCAGAGGG - Intergenic
953781929 3:45878886-45878908 CACTGAAGAAGATATGCAGATGG + Intronic
953966122 3:47308737-47308759 CACTGAGGACGATGAGAGGAGGG - Intronic
955881960 3:63556231-63556253 CACTGAAGAATTTCAGCAGGGGG + Intronic
959596754 3:108137081-108137103 CAGTGCAGACATAGAGCAGAAGG + Intergenic
960811646 3:121632419-121632441 CTATGAGGACGTTGAGGAGATGG - Exonic
966301920 3:178488669-178488691 CCCTGAAGATGTACAGCAGATGG - Intronic
966494850 3:180568342-180568364 CACTGAAGATTTTGAGTAGGGGG - Intergenic
972544291 4:40065477-40065499 CACTGAAAAAAGTGAGCAGAAGG + Intronic
974172282 4:58281732-58281754 TAGTGAAGATGTTGAGAAGAAGG + Intergenic
974657636 4:64845616-64845638 CACTGAATAGGTTTAGCAGGAGG + Intergenic
975018058 4:69449164-69449186 CACTGAGGAGTTTGACCAGAAGG - Intergenic
976581860 4:86746361-86746383 CACTGATGACCTTGTGCAGCAGG + Intronic
978453762 4:108865434-108865456 CACTGAAGAGGTTGTGAAAATGG + Intronic
978902055 4:113963047-113963069 CACGGAAGACCTTGATAAGAAGG - Intronic
980034761 4:127871146-127871168 CACTGCAGAGATTGAGCAGAGGG + Intergenic
980419597 4:132542582-132542604 CCCTGATGACCTTGAGCTGAAGG + Intergenic
981284624 4:143001510-143001532 CACTAAAGAAGTTGGGCGGAGGG + Intergenic
982403516 4:154995403-154995425 CAGTGAAAAGGGTGAGCAGAGGG - Intergenic
982806121 4:159765947-159765969 CACTGAAGAGGGTATGCAGATGG + Intergenic
994078168 5:95676809-95676831 CACTGAAGCAGTTGAATAGAAGG - Intronic
995436643 5:112143879-112143901 CACTGAAGACATAGAAAAGAAGG + Intronic
996993912 5:129671243-129671265 CATTGAAGAAGTTGAACTGATGG + Intronic
998292584 5:140928770-140928792 CACTGATGCAGTTAAGCAGAGGG + Exonic
999437482 5:151574342-151574364 CACTGAACACCTGGGGCAGAGGG - Intergenic
999700561 5:154224136-154224158 CACTGAAGCATTTGAGCAGCGGG + Intronic
1000013833 5:157259637-157259659 CATTGAAAAGGTTGAGGAGAAGG + Intergenic
1000952302 5:167499285-167499307 CTCTGGAGAAGTTGAGCAAAGGG + Intronic
1005257379 6:24017670-24017692 CACTGGAAACGTTCATCAGAGGG + Intergenic
1005699844 6:28389399-28389421 CACTGCAGACTTTTAGCACAAGG - Intronic
1006290459 6:33131629-33131651 CAATGAATAAGTTGAGCACATGG - Intergenic
1008022273 6:46593199-46593221 CATTTAAGAGGTTGTGCAGATGG + Intronic
1008598845 6:53069033-53069055 TACTCAAGAGGTGGAGCAGAAGG + Intronic
1009562775 6:65270417-65270439 CACTCAAAACCATGAGCAGAGGG - Intronic
1011006117 6:82647382-82647404 CACAGAAGACTTTGAGCTGATGG - Intergenic
1014672488 6:124323060-124323082 CACTGAAGAGGATATGCAGATGG - Intronic
1019995232 7:4719813-4719835 CACTGAAGAGGCTCTGCAGATGG - Intronic
1024288441 7:47781178-47781200 CACTGAAGAAGATGTACAGATGG - Intronic
1025837194 7:65105230-65105252 CACTGGAGAGTTTGAACAGAGGG - Intergenic
1025906972 7:65794739-65794761 CACTGGAGAGTTTGAACAGAGGG - Intergenic
1026033363 7:66814289-66814311 CACTGAAGACATGAAGCAAATGG + Intergenic
1028833003 7:95346139-95346161 CCCTGATGACCTTGAGCTGAAGG + Intergenic
1029562031 7:101309016-101309038 CCCTGAGGACCTTGAGCAGGAGG + Intergenic
1031159582 7:118150260-118150282 CACTGGAGAGTTTGGGCAGAAGG + Intergenic
1037107715 8:15129841-15129863 CACAGAGGACGTGGAGCAGAAGG - Intronic
1038695013 8:29798630-29798652 CACAGCAGGAGTTGAGCAGAGGG + Intergenic
1040566607 8:48573213-48573235 AGGTGAAGACGTTGAGCTGAGGG - Intergenic
1043916494 8:85928706-85928728 CACTGAAGACATTAAGCAAAAGG + Intergenic
1044659139 8:94578531-94578553 CCCTGATGACCTTGAGCTGAAGG - Intergenic
1046903538 8:119547734-119547756 CACTCAAGACATTGACCATAAGG + Intergenic
1047332516 8:123904632-123904654 CACTGGAAGTGTTGAGCAGAGGG + Intronic
1048205642 8:132413185-132413207 CACTGAAGGTGTTGGGTAGAAGG - Intronic
1048723766 8:137358464-137358486 CACAGCAGAAGGTGAGCAGAGGG + Intergenic
1049215507 8:141406058-141406080 CACTGGAGGCTTTGAGCGGAGGG + Intronic
1049401154 8:142427932-142427954 CAGTGAAGACGCTGTGCCGATGG - Intergenic
1049873121 8:144997006-144997028 CACTGAAGAGGATGTGTAGATGG - Intergenic
1051657229 9:19394672-19394694 CACTGAAGGAGTTATGCAGAAGG + Intergenic
1052386244 9:27826853-27826875 CACTGAAGAAGATATGCAGATGG - Intergenic
1054821062 9:69520960-69520982 CACTGAAGAGTTTGAGGAGTAGG - Intronic
1056186699 9:84142075-84142097 CACTGAAGGCTTTGTGAAGACGG + Intergenic
1056730751 9:89164270-89164292 CTCTGGAGACCCTGAGCAGAGGG + Intronic
1057075457 9:92136002-92136024 CACAGAAGACCTTGGGGAGAGGG + Intergenic
1058641758 9:107094310-107094332 CACTGAAGAAGATGTACAGATGG + Intergenic
1059330712 9:113533782-113533804 CACTGGAGACAGGGAGCAGAGGG + Intronic
1062634984 9:137485953-137485975 CACAGAAGAGGTTGAGGGGACGG + Intronic
1189695786 X:43660387-43660409 CATTGAAGGCCCTGAGCAGAGGG - Intronic
1190340463 X:49291869-49291891 CACTGAAGAGGGGAAGCAGAGGG - Intronic
1190427741 X:50348428-50348450 CTCAGAAGTGGTTGAGCAGAGGG - Intronic
1191792891 X:64989737-64989759 CACTGAAGAGGTTATACAGATGG + Intronic
1194850026 X:98858348-98858370 CCCTGATAACTTTGAGCAGAAGG + Intergenic
1195400994 X:104460931-104460953 CACTTAAGAGGTTGAGCTCAGGG + Intergenic
1195523275 X:105855132-105855154 CACATAAGATGTTGAACAGAGGG + Intronic
1196939046 X:120757784-120757806 CAGAGAAGACTTTGAGCAAATGG + Intergenic
1200001156 X:153060404-153060426 TACTGAAAACGTTGAAGAGAAGG - Intronic
1200046925 X:153408173-153408195 CACTGAAGAGGATCAGCAGAGGG + Intergenic
1200237207 X:154473388-154473410 CACTGAGGACGTTTGGCAGTAGG - Exonic