ID: 1078578834 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:12523427-12523449 |
Sequence | TCATCCCAAGGCACTGCTGA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 285 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 25, 4: 259} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1078578834_1078578840 | 11 | Left | 1078578834 | 11:12523427-12523449 | CCTTCAGCAGTGCCTTGGGATGA | 0: 1 1: 0 2: 0 3: 25 4: 259 |
||
Right | 1078578840 | 11:12523461-12523483 | GTGTCACAAATGGCCACAGAGGG | 0: 1 1: 0 2: 2 3: 23 4: 186 |
||||
1078578834_1078578839 | 10 | Left | 1078578834 | 11:12523427-12523449 | CCTTCAGCAGTGCCTTGGGATGA | 0: 1 1: 0 2: 0 3: 25 4: 259 |
||
Right | 1078578839 | 11:12523460-12523482 | GGTGTCACAAATGGCCACAGAGG | 0: 1 1: 0 2: 1 3: 11 4: 184 |
||||
1078578834_1078578838 | 1 | Left | 1078578834 | 11:12523427-12523449 | CCTTCAGCAGTGCCTTGGGATGA | 0: 1 1: 0 2: 0 3: 25 4: 259 |
||
Right | 1078578838 | 11:12523451-12523473 | GGAAACTGTGGTGTCACAAATGG | 0: 1 1: 0 2: 3 3: 16 4: 174 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1078578834 | Original CRISPR | TCATCCCAAGGCACTGCTGA AGG (reversed) | Intronic | ||