ID: 1078578834

View in Genome Browser
Species Human (GRCh38)
Location 11:12523427-12523449
Sequence TCATCCCAAGGCACTGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 259}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078578834_1078578840 11 Left 1078578834 11:12523427-12523449 CCTTCAGCAGTGCCTTGGGATGA 0: 1
1: 0
2: 0
3: 25
4: 259
Right 1078578840 11:12523461-12523483 GTGTCACAAATGGCCACAGAGGG 0: 1
1: 0
2: 2
3: 23
4: 186
1078578834_1078578839 10 Left 1078578834 11:12523427-12523449 CCTTCAGCAGTGCCTTGGGATGA 0: 1
1: 0
2: 0
3: 25
4: 259
Right 1078578839 11:12523460-12523482 GGTGTCACAAATGGCCACAGAGG 0: 1
1: 0
2: 1
3: 11
4: 184
1078578834_1078578838 1 Left 1078578834 11:12523427-12523449 CCTTCAGCAGTGCCTTGGGATGA 0: 1
1: 0
2: 0
3: 25
4: 259
Right 1078578838 11:12523451-12523473 GGAAACTGTGGTGTCACAAATGG 0: 1
1: 0
2: 3
3: 16
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078578834 Original CRISPR TCATCCCAAGGCACTGCTGA AGG (reversed) Intronic