ID: 1078579058

View in Genome Browser
Species Human (GRCh38)
Location 11:12524931-12524953
Sequence CCTGACCCCCGCCTGGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 260}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078579058_1078579071 25 Left 1078579058 11:12524931-12524953 CCTGCGCCCAGGCGGGGGTCAGG 0: 1
1: 0
2: 2
3: 20
4: 260
Right 1078579071 11:12524979-12525001 TTTGAGCTGAGGTCTGCAGGAGG 0: 1
1: 2
2: 4
3: 58
4: 342
1078579058_1078579068 14 Left 1078579058 11:12524931-12524953 CCTGCGCCCAGGCGGGGGTCAGG 0: 1
1: 0
2: 2
3: 20
4: 260
Right 1078579068 11:12524968-12524990 GGAGCCTGTGCTTTGAGCTGAGG 0: 1
1: 0
2: 1
3: 34
4: 283
1078579058_1078579063 -7 Left 1078579058 11:12524931-12524953 CCTGCGCCCAGGCGGGGGTCAGG 0: 1
1: 0
2: 2
3: 20
4: 260
Right 1078579063 11:12524947-12524969 GGTCAGGAAGGCCTCCCTCCAGG 0: 1
1: 1
2: 0
3: 19
4: 288
1078579058_1078579070 22 Left 1078579058 11:12524931-12524953 CCTGCGCCCAGGCGGGGGTCAGG 0: 1
1: 0
2: 2
3: 20
4: 260
Right 1078579070 11:12524976-12524998 TGCTTTGAGCTGAGGTCTGCAGG 0: 1
1: 0
2: 1
3: 26
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078579058 Original CRISPR CCTGACCCCCGCCTGGGCGC AGG (reversed) Intronic
900102138 1:966449-966471 CCGGAGCCCCGCCTGCCCGCGGG + Intergenic
900177887 1:1298744-1298766 CCTCACCCCCACCTGTGCTCCGG - Intronic
900475291 1:2873558-2873580 CCTGTCCCAGGCCTGGGCGGAGG - Intergenic
900915209 1:5632685-5632707 CCTCACCGCCGCCTGGCCACAGG - Intergenic
901529699 1:9845129-9845151 CCTGACCCCCCACTGGTCGCAGG + Intergenic
902361296 1:15943895-15943917 CCTGACCCCTCCCTGGGCACAGG - Exonic
904587226 1:31587078-31587100 CCTGGCGCCCGCCTGCGCCCCGG - Exonic
905375159 1:37514943-37514965 CCTGCCCCTCGGCTGGCCGCCGG + Intergenic
905518125 1:38577416-38577438 CTTGACCCCAGCCTGGGCTGAGG + Intergenic
906678786 1:47711082-47711104 CCAGACCCTAGCCTGGGAGCCGG - Intergenic
907457574 1:54585343-54585365 CCTGACCCAGGCCTGGGGGCAGG + Intronic
910805964 1:91190182-91190204 CCTGACCACCAGCTGGGCACTGG - Intergenic
912335035 1:108854088-108854110 CCAGACCGCCGCCTGGGCTGTGG - Intronic
914845776 1:151282765-151282787 CCTGCACCCCGACTGGGTGCGGG + Intronic
916418949 1:164618338-164618360 CCTTACCCCAGCCTGGGAGAAGG - Intronic
916588270 1:166166532-166166554 CCTGCCCTCCGCCCGGGCGCTGG - Exonic
918148812 1:181780930-181780952 TCTGACCCCGGCTGGGGCGCTGG - Intronic
919445641 1:197701416-197701438 CCTGGCCCCCGAATGGGCCCTGG - Intronic
919786282 1:201260329-201260351 CCTGCCCCCAGGCTGGGCGCAGG - Intergenic
919786283 1:201260329-201260351 CCTGCGCCCAGCCTGGGGGCAGG + Intergenic
921218903 1:212959647-212959669 GCTGCCCCCCGCCTGGGCATCGG - Intronic
921417923 1:214912205-214912227 CCTCCCCCCCGCCAAGGCGCTGG - Intergenic
922730806 1:227947998-227948020 CGTGATCCCCTCCCGGGCGCGGG - Intergenic
923788801 1:237093519-237093541 GCTGACCCTGGCCTGGGCTCAGG + Intronic
1063458518 10:6201596-6201618 CCCGGTCGCCGCCTGGGCGCGGG + Intronic
1064552955 10:16521074-16521096 CCTGATCGCCGCCGGGGCGCTGG - Exonic
1065730409 10:28704989-28705011 CCTCACCCACCCCTGAGCGCTGG - Intergenic
1065738677 10:28776819-28776841 CCTGAACCCTCCCTGGGCTCAGG - Intergenic
1066492575 10:35907715-35907737 CCAGGCCCACGCCTGGGAGCTGG + Intergenic
1066627654 10:37425608-37425630 CCTGACCCCCCTATGGGCCCTGG + Intergenic
1070327579 10:75398760-75398782 ACTGACCACCGCCTCGGCGCTGG - Exonic
1074361211 10:112825298-112825320 CCTGCCCCCAACCTGGGCACAGG + Intergenic
1075616067 10:123891671-123891693 CGTGACCCTGCCCTGGGCGCGGG - Exonic
1076364626 10:129914114-129914136 CCTGGCCCCAGCCTGGCCTCAGG - Intronic
1076612737 10:131736785-131736807 CCTGACTCCCTGCTGGGCCCTGG - Intergenic
1076655057 10:132018558-132018580 CCTGGCTCTGGCCTGGGCGCTGG + Intergenic
1077330929 11:1983526-1983548 CCTGACCCTGCCCTGGGCACAGG - Intronic
1077455342 11:2675024-2675046 CCCGTCCCCCACCTGGGCTCTGG - Intronic
1078062764 11:8059163-8059185 CCTGACCTCCTCCTGGCCGGGGG + Intronic
1078317079 11:10303216-10303238 CCGGCCGCCCGGCTGGGCGCAGG - Intergenic
1078579058 11:12524931-12524953 CCTGACCCCCGCCTGGGCGCAGG - Intronic
1083625416 11:64069629-64069651 CCTGACCCCATCCTGGGCATGGG + Intronic
1083923470 11:65792605-65792627 CCTGGCCCCGGCCTGGCCTCTGG - Intronic
1084003798 11:66313001-66313023 GCTGAGCCCGGGCTGGGCGCAGG + Intergenic
1084040072 11:66537431-66537453 CCTGAGCCCCTCCGGGGCTCTGG + Intronic
1084399085 11:68933277-68933299 CCTTTCTCCCTCCTGGGCGCAGG + Exonic
1085049983 11:73375477-73375499 CCTGACCCCAGCCAGGCCTCTGG + Intergenic
1090832321 11:130428178-130428200 CCTGCCCCCCGGCTGCGGGCCGG + Exonic
1202813909 11_KI270721v1_random:38705-38727 CCTGACCCTGCCCTGGGCACAGG - Intergenic
1093685083 12:22046209-22046231 CCCGATCCCCGCCTGGCAGCTGG - Exonic
1096689150 12:53308804-53308826 CCTGACCCCAGACTGGCTGCTGG - Exonic
1096979694 12:55721361-55721383 CCTGACCCCCTCCGGGGCCGAGG + Exonic
1101597273 12:106178313-106178335 CCTGGCCCCTGCCTGGGTGAGGG - Intergenic
1103344100 12:120237937-120237959 CCTGACCCAACCCAGGGCGCTGG + Intronic
1104215046 12:126726635-126726657 CCGGAGACCGGCCTGGGCGCAGG - Intergenic
1104945916 12:132414850-132414872 CCTCACCCACGCCTGGTCGGGGG - Intergenic
1112506994 13:99981408-99981430 CCTGACCGCGGCGGGGGCGCCGG - Intergenic
1114075844 14:19160770-19160792 CCTGATGCCCATCTGGGCGCTGG + Intergenic
1114525673 14:23365850-23365872 CCCCTCCGCCGCCTGGGCGCAGG - Intergenic
1114555299 14:23558820-23558842 CCTGACCACTGCCTGGGCTAGGG + Exonic
1115753609 14:36513828-36513850 CCTGGCCCCAGCCTGGGAACTGG - Exonic
1118477997 14:66136313-66136335 CATTAACCCCTCCTGGGCGCAGG + Intergenic
1121581843 14:95037605-95037627 GCTGACCCCACCCTGGGCCCTGG - Intergenic
1122077695 14:99246434-99246456 CCTGGCCCCCGCCTGGCCGCCGG - Intronic
1122389378 14:101369867-101369889 CCTCACCACCGCCTGGGAGGTGG - Intergenic
1122409538 14:101518796-101518818 CCTGTCCTCGGCCTGGGCACTGG - Intergenic
1122982298 14:105197187-105197209 CCTGACCCCGCCCTGGGGTCTGG + Intergenic
1123042328 14:105495512-105495534 CCTGACGCCTGCCTGGCCCCTGG + Intronic
1202897860 14_GL000194v1_random:20421-20443 CCTGATGCCCATCTGGGCGCTGG - Intergenic
1124121664 15:26893754-26893776 CGTGCCCACCGCCTGGTCGCCGG - Intronic
1124249346 15:28096939-28096961 CCTGGCCCCGGGCTGGGAGCGGG - Intronic
1124952581 15:34337595-34337617 CCCTACCCCCGCCCCGGCGCAGG + Exonic
1125903640 15:43370971-43370993 CCTGACCCCGGCCCCGGCCCCGG + Intronic
1128364337 15:66986740-66986762 CGTGACCCTCCCCTGGGCCCTGG + Intergenic
1128582271 15:68818515-68818537 CCTGCCCCCTGCCTGGAGGCGGG - Intronic
1129686793 15:77690766-77690788 CCTGACCCCAGCCTGGGCCAAGG - Intronic
1132674775 16:1117080-1117102 CCTCTCCCCTGCCTGGGTGCTGG + Intergenic
1132804363 16:1768871-1768893 CCTGACCCCCGCCCGGCCCGCGG + Exonic
1132934962 16:2475419-2475441 CCCGATCCCCGCCCGGTCGCTGG + Intronic
1133116272 16:3579485-3579507 CCACACCCCAGCCTGGGCCCAGG - Intergenic
1133797721 16:9059843-9059865 CTGGACCCCAGCCTGGGCGACGG - Intergenic
1134482809 16:14633276-14633298 CCTGACCCCCGAAAGGACGCAGG - Intronic
1134683252 16:16141326-16141348 ACTGACTCCTCCCTGGGCGCTGG - Exonic
1136146952 16:28321450-28321472 CCTGATCCCAGCCTGTGCCCAGG - Exonic
1136607801 16:31348301-31348323 CCTGACTCCAGCCTGGTCCCCGG - Intergenic
1136909921 16:34136481-34136503 CTTCACCCACGCCAGGGCGCGGG - Intergenic
1137640518 16:50025036-50025058 CGTTACGCCCGCCTGGCCGCCGG + Exonic
1138530121 16:57630287-57630309 CAGGACCCCTGCCTGGGCTCTGG - Intronic
1138553515 16:57759565-57759587 CCTGACTACTGCCTGGGGGCAGG + Intronic
1138582587 16:57951245-57951267 CCTGACACCTGCCTGGGGGTAGG - Intronic
1139853716 16:69965251-69965273 CCTGATCCCTGCCCGGGCACTGG + Intergenic
1139882694 16:70188164-70188186 CCTGATCCCTGCCCGGGCACTGG + Intergenic
1140369816 16:74407355-74407377 CCTGATCCCTGCCCGGGCACTGG - Intergenic
1141169303 16:81681038-81681060 CCTGACCCCCACCTGCACCCTGG - Intronic
1141280723 16:82627799-82627821 CGTGTCCCCCGCCAGGGCGCAGG + Intronic
1141575157 16:84958943-84958965 CCTGACCCCTTCCTGGGAGGGGG - Intergenic
1142192226 16:88723284-88723306 CCTCAGCACCGCCTGGGCGTTGG + Exonic
1142374165 16:89698164-89698186 CCTGCCCCCCGCCTGCCAGCTGG - Exonic
1142625909 17:1191781-1191803 CCTGACGGCAGCCTGGGCGCAGG - Intronic
1143383460 17:6510513-6510535 CCCCACCCCCGTCTGGGAGCCGG + Intronic
1143452353 17:7043475-7043497 CCGGACCCCCGGATGGGGGCTGG - Exonic
1144586848 17:16492251-16492273 CCCGCCCCCCGCCTCCGCGCCGG + Intergenic
1145269282 17:21396091-21396113 CCTGGCCCCTGCCTGCGCCCGGG - Intronic
1146539805 17:33684471-33684493 CCTGACCCTGGGTTGGGCGCGGG + Intronic
1146608674 17:34285656-34285678 CGTGACCCCCGCATGGGCAAAGG + Exonic
1147179435 17:38674870-38674892 CCTCCCCGCCGCCTGGGCCCGGG - Exonic
1148178022 17:45584697-45584719 CCTCCCCCCGGCCGGGGCGCTGG + Intergenic
1148775017 17:50090340-50090362 CCTGACCCCTGCCTGTTGGCAGG + Intronic
1150407910 17:64918983-64919005 CCTCCCCCCGGCCGGGGCGCTGG + Intronic
1151317781 17:73334726-73334748 CCTGACCACCACCTGAGCACAGG - Exonic
1151381284 17:73727420-73727442 CCTGACGCCCTCCTGGGAACAGG - Intergenic
1151570758 17:74924295-74924317 CCTGACCCCCAGCTCAGCGCCGG + Exonic
1151858270 17:76737955-76737977 CCTGACCGCAGCCGCGGCGCCGG - Exonic
1151940268 17:77287640-77287662 CCTGACCCCACCCTGGGCATGGG + Intronic
1152093333 17:78258653-78258675 CCTGGCACCCGCCCAGGCGCAGG + Intergenic
1152391915 17:80008499-80008521 CCTTCCCCTCGCCTGGGCCCTGG + Intronic
1152808732 17:82371408-82371430 CCTGCCCCCCACCTGCGCGCGGG + Intergenic
1153841814 18:9014699-9014721 CTTGACTCCCACCTGGGTGCTGG - Intergenic
1154279688 18:12991463-12991485 TCTGCCTCCCGCCTAGGCGCAGG - Intronic
1157138776 18:45084772-45084794 CCTGGCCCCCTCCTGGGCCCTGG - Intergenic
1158259091 18:55588072-55588094 CATGAACGCCGCCTCGGCGCCGG - Intronic
1158434989 18:57428958-57428980 ACTGAGCCCGGCCGGGGCGCTGG + Intergenic
1160698070 19:494230-494252 CCTGTCCCCCGCCCGCCCGCTGG - Intronic
1160744354 19:703833-703855 CCTGACCCCTTCCTGGACTCAGG - Intergenic
1160982699 19:1823571-1823593 CCCAACCCCCGCCTGGCTGCAGG - Exonic
1161237633 19:3205714-3205736 CCTGACCCGTCCCTGTGCGCAGG - Intronic
1161824279 19:6551888-6551910 CCTGGCCCCAGCCTGGCCACGGG + Intergenic
1161984770 19:7647226-7647248 CCTGACAGCGGCCTGGGAGCTGG - Exonic
1162399026 19:10433460-10433482 CCTGACCCCTGTGTGGGCACGGG - Intronic
1163572351 19:18089975-18089997 GCTGACCCTGGCCTGGGCCCCGG - Intronic
1165445901 19:35856670-35856692 CCTCAACCCCGGCAGGGCGCAGG + Intronic
1165459512 19:35936458-35936480 CCCGGCCCCCGCCTCGGCCCCGG + Intronic
1166074013 19:40403577-40403599 CCTTAACCCCTCCTGGTCGCCGG + Intronic
1166737516 19:45094844-45094866 CCTGACCCTCTCCAGTGCGCTGG - Intronic
1167016234 19:46842789-46842811 CCTGTCCCCCTCCTGGCTGCTGG + Intronic
1167357803 19:49014811-49014833 CCTGACCACCCCCAGGGCGCTGG - Intronic
925928259 2:8685636-8685658 CCCGACCCCCGCCTCGCCTCCGG + Intergenic
927520002 2:23692955-23692977 CCTGACCCCAGCCCAGGCCCAGG + Intronic
927843154 2:26457823-26457845 TCTGACCCCTGCCTGTGGGCTGG - Exonic
928515342 2:32039581-32039603 CCTCACCCCCACCTGGGCGCGGG + Intronic
929061034 2:37925067-37925089 CTTTTCCCCCGCCTGGGCTCTGG - Intronic
930032537 2:47067373-47067395 CCTGAGCCCCACCTGGGACCAGG + Intronic
932343121 2:70979009-70979031 CCTGGCCCCCGCCTGGCTGGTGG - Intronic
932436545 2:71705313-71705335 CCTCACCCCCGCCAGGGTCCCGG - Intergenic
934985385 2:98881283-98881305 CCTCAGCCCCACCTGGGAGCAGG + Intronic
936087992 2:109482562-109482584 CATGGCCCCGGGCTGGGCGCGGG - Intronic
938277116 2:130037040-130037062 CCTGGCCTCGGGCTGGGCGCGGG - Intergenic
938374823 2:130798335-130798357 CCCGCGCCCCGCCTGTGCGCCGG + Intergenic
938407772 2:131042088-131042110 CCTGTCCCCAGCGTGGGCTCTGG + Intronic
938438267 2:131300349-131300371 CCTGGCCTCGGGCTGGGCGCGGG + Intronic
938491378 2:131762966-131762988 CCTGATGCCCACCTGGGCACGGG + Intronic
938496184 2:131799360-131799382 CCTGATGCCCACCTGGGCACGGG - Intronic
944242425 2:197499570-197499592 CCTGGACCTCGGCTGGGCGCGGG - Intronic
947936531 2:234009480-234009502 CTTGGCCCCAGCCTGGGCCCTGG + Intronic
947992305 2:234497160-234497182 CCTGACCCCCGGCGGCGGGCGGG - Intergenic
948704084 2:239778593-239778615 CCTGGACCCTGCCTGGGCCCAGG + Intronic
948761048 2:240191212-240191234 GCTGAGCACCGCCTTGGCGCTGG + Intergenic
1168877337 20:1180758-1180780 CCTGACCCCTGCCAAGGCCCTGG - Exonic
1169038886 20:2476430-2476452 CCTGACCTCCTCCTGTGCGGAGG - Intronic
1169116407 20:3069162-3069184 CCTGACCGGCTCCTGGGTGCTGG + Intergenic
1169131175 20:3167051-3167073 CCGGACCCCCGCCTGGCCATGGG - Exonic
1171427741 20:25058824-25058846 CGTGACCCCCGCCAGGACGGAGG - Intronic
1172096482 20:32463084-32463106 GCTGACGCCCTCCTGGGCTCTGG + Intronic
1172146599 20:32762277-32762299 TCAGATCCCCGCCCGGGCGCGGG - Intergenic
1173981072 20:47224589-47224611 CCTGACCCCAGCCTGGGGTGTGG + Intronic
1175395845 20:58661035-58661057 CCAGCTCCCCGCCTGGGCACGGG + Intronic
1176016914 20:62938436-62938458 CCTGACTGCCCCCTGGGCACCGG - Intronic
1176135163 20:63519364-63519386 CCTGAGCCCCACCTGGGAGGGGG - Intergenic
1176150732 20:63589452-63589474 CCTGAGCACCGGCTGGGGGCGGG + Exonic
1176617544 21:9036410-9036432 CCTGATGCCCATCTGGGCGCTGG - Intergenic
1179092624 21:38281036-38281058 CCTCAGCCTCGCCTGGGAGCTGG + Intronic
1179802909 21:43819884-43819906 CCTGACCAACGCCTGGGTCCTGG + Intergenic
1179827589 21:43975645-43975667 CGTCGCCCCCTCCTGGGCGCTGG + Intronic
1179887456 21:44320287-44320309 CCTGACCTCTGCCTGGGCTCAGG + Intronic
1179961569 21:44770053-44770075 TCTGTCCCCAGCCTGGGCCCAGG + Exonic
1180101797 21:45590918-45590940 CCTGAGCACCGCCCGGGTGCAGG + Intergenic
1180255521 21:46624704-46624726 CCTGACCCCATCCTGGTCACAGG + Intergenic
1180291544 22:10853934-10853956 CCTGATGCCCATCTGGGCGCTGG + Intergenic
1180494349 22:15883356-15883378 CCTGATGCCCATCTGGGCGCTGG + Intergenic
1181520927 22:23448759-23448781 CCTGGGCCCCGCCTGGGTGTGGG - Intergenic
1181521001 22:23448924-23448946 CCTGAGCCCCGCCTGGCTGTGGG - Intergenic
1181669859 22:24420974-24420996 CCTGACCACCCCCTGGCCTCAGG + Intronic
1181780639 22:25190592-25190614 CCCCAACCCCGCCTGGGCCCAGG + Intronic
1182054599 22:27340126-27340148 CCTGACCCCAGCATGGGAGAAGG + Intergenic
1183628383 22:39018488-39018510 CCTGAGCCCCTCCTGGCCTCAGG + Exonic
1183630984 22:39032417-39032439 CCTGAGCCCCTCCTGGCCTCAGG + Exonic
1183634494 22:39052796-39052818 CCTGAGCCCCTCCTGGCCTCAGG + Exonic
1183929506 22:41227929-41227951 GCTGACCCCCGCCTGCTCCCAGG - Intronic
1184119320 22:42440106-42440128 TCTGACCCCCTTCTGGGCACTGG + Intergenic
1184184801 22:42857331-42857353 CCCGTCCACCGCCGGGGCGCAGG + Exonic
1185278829 22:49961296-49961318 CCTGACCCCCGCGTCTCCGCAGG + Exonic
1185340165 22:50287544-50287566 CATCTCCCCCGCCTGGGCTCTGG - Intronic
1185400338 22:50612329-50612351 GCTGACCCCTGCCTGGGAGGCGG - Intronic
949836309 3:8274165-8274187 CCTCACCCCAGCATGGGTGCAGG + Intergenic
950481749 3:13248383-13248405 CCTGACTCCCACCTGTGCCCAGG + Intergenic
950565567 3:13767847-13767869 CCTGACCCCTGCCTGGGGCCTGG + Intergenic
950578855 3:13850132-13850154 CCTGCCCCGCCCCTGGGCACAGG - Intronic
951013767 3:17706067-17706089 CCCGACCCCAGACTGGGCGGCGG + Intronic
951238079 3:20257964-20257986 CCGGACCCCCTCCTTGGTGCTGG - Intergenic
951981873 3:28575570-28575592 GGTGACCCCCGCCTCCGCGCTGG - Intergenic
955065790 3:55532855-55532877 CCTGACCCAAGGCTGGGTGCTGG + Intronic
961827541 3:129606779-129606801 GCTGACCCGGGCCCGGGCGCCGG - Exonic
962259035 3:133891473-133891495 CCTGACCCGCCTCTGGGGGCTGG - Intronic
962852719 3:139319750-139319772 TCTAACCCCCACCTGGGCACTGG + Intronic
966878522 3:184336826-184336848 GCTGACCCCTGCCTGGGCCTCGG + Intronic
968631768 4:1655568-1655590 CCAGGCCTGCGCCTGGGCGCGGG + Exonic
968965231 4:3766192-3766214 CCTGCGCCCCGGCTGGGCTCCGG + Intergenic
968965230 4:3766192-3766214 CCGGAGCCCAGCCGGGGCGCAGG - Intergenic
969414978 4:7052225-7052247 CCTGCCGCCCGCCTGCGCGGTGG + Intronic
973264541 4:48198226-48198248 CCTGACCATCGCCCTGGCGCCGG - Intronic
975689587 4:76950308-76950330 CCTGAGCGCCCCCTCGGCGCGGG - Intronic
984122138 4:175758814-175758836 GCTGACCGCCTCCTGGGCACTGG - Intronic
985665252 5:1178774-1178796 CTCGAGCCCTGCCTGGGCGCTGG + Intergenic
985683667 5:1270662-1270684 TGTGACCCCCGCGAGGGCGCGGG - Intronic
985850099 5:2382463-2382485 CCTGACCCCAGCCTGCAGGCAGG + Intergenic
985896156 5:2751105-2751127 CCTGAGCCCCGTCTGGGTCCCGG + Intronic
986184387 5:5422605-5422627 CCCGCCCCTCCCCTGGGCGCGGG - Intronic
987193137 5:15500008-15500030 CCAGGCCCCAGCCTGGGCACCGG - Intergenic
989737250 5:44722952-44722974 CTGCACCCCCGCCTGGGTGCTGG + Intergenic
991435978 5:66597081-66597103 CCTGCCCACTGCCTGTGCGCAGG - Intronic
991686897 5:69189720-69189742 GCTGCACGCCGCCTGGGCGCCGG - Exonic
992879183 5:81088208-81088230 GCTGTCCCCAGCCTGGGGGCTGG + Intronic
994379703 5:99056814-99056836 CCTGCCCCCGACCTGGACGCTGG - Intergenic
997292434 5:132747552-132747574 CGGGACGCCCGCCTGGGCTCTGG - Exonic
1001653191 5:173329568-173329590 CCTGTCCCCGGCCCCGGCGCGGG - Intergenic
1002296292 5:178232906-178232928 TCCGAGCCCCGCCTGGGCGCCGG - Intergenic
1002465794 5:179407795-179407817 CCTGAGCCCCGCCTGGGGCCAGG + Intergenic
1002897090 6:1385560-1385582 CCTGCCTTCCGCCTGGGCCCGGG - Intergenic
1006052559 6:31355712-31355734 CCAGACACCAGCCTGGACGCAGG + Intronic
1007521460 6:42453709-42453731 CCCCACCCCCACCCGGGCGCTGG + Intergenic
1007633430 6:43285044-43285066 CCTGGCCGCGGCCTGGGCCCAGG + Exonic
1013034014 6:106362446-106362468 CCTGATCCCCTCCTGTGTGCTGG - Intergenic
1015966912 6:138703284-138703306 CTTGACCTCCTCCTGGGCTCAGG - Intergenic
1017311760 6:152983617-152983639 CTTGACCCACGCCTCTGCGCAGG + Intergenic
1018825056 6:167402481-167402503 CCTGAGCCCAGCCTGGGGTCTGG + Intergenic
1018825055 6:167402481-167402503 CCAGACCCCAGGCTGGGCTCAGG - Intergenic
1019442469 7:1054423-1054445 CCTGAACCCCACCTGGAGGCCGG + Intronic
1019523239 7:1469778-1469800 CCAGACCCTCCCCTGGGAGCTGG + Intergenic
1019590366 7:1827620-1827642 CCTGAGCCCCGCCCGGGTGTGGG + Intronic
1019687707 7:2390906-2390928 CCTGACCCCCACCTGGAGGGGGG + Intergenic
1019689706 7:2403740-2403762 CGGGACCCCCGCCCGGGCCCTGG - Intronic
1019710475 7:2516091-2516113 CCTGGCCCCAGCCTGGGGGTTGG + Intronic
1024981199 7:55159010-55159032 TCTGACCCCAGGCTGGGGGCTGG - Intronic
1026931312 7:74224377-74224399 CCTGACCCCACCCTGGAGGCTGG - Intronic
1028850742 7:95534551-95534573 CCTGACACCAGCCTGGGAGCCGG + Intronic
1029546161 7:101211716-101211738 CCTCACCCCCACCTGTCCGCAGG - Exonic
1032035477 7:128518200-128518222 CCTCATCCCTGCCTGGGCTCTGG + Intergenic
1032783531 7:135183293-135183315 CCTGACCCCTGCCTGGGGCAGGG - Intergenic
1033595313 7:142854881-142854903 CCGGGGCCCCGCCTGTGCGCCGG - Intergenic
1034490799 7:151392215-151392237 CATGACCCAGGCCTGGGCGCAGG - Intronic
1034979100 7:155464925-155464947 CCTTCGCCCCGCCTGGGAGCAGG + Intergenic
1035553010 8:544644-544666 CCTCACCTGCGCCTGGGCGGCGG + Exonic
1035747573 8:1973562-1973584 CCTGCCCCGCGCCTGCCCGCCGG - Intergenic
1036782240 8:11657809-11657831 CGTGACTTCAGCCTGGGCGCTGG + Intergenic
1039469921 8:37807066-37807088 CCTGAACCCAGCCTGGAAGCTGG - Intronic
1039896362 8:41719419-41719441 CCTGACCTCGGCCTGGTCACCGG + Intronic
1044999641 8:97868837-97868859 TCTGATGCCCGCCTGGGCTCAGG + Intronic
1048469102 8:134691333-134691355 CCTGAGCCCCGCCTGAGCATGGG - Intronic
1049164575 8:141118049-141118071 CCTGAGCCCCATCTGGGCGTTGG + Intronic
1049536656 8:143185766-143185788 CCTGAGCACCGAGTGGGCGCTGG - Intergenic
1049599273 8:143499457-143499479 ACTGAACACCGGCTGGGCGCAGG - Intronic
1049620831 8:143597729-143597751 CCCGCCCCGCGCCTGCGCGCTGG - Intronic
1053288599 9:36865460-36865482 CCTGAGTCCCTCCTGGGTGCTGG - Intronic
1053299990 9:36942124-36942146 CCTGACCCTCTCCTTGGCTCAGG + Intronic
1054255065 9:62802626-62802648 CCTGAGCCAGGCCTGGCCGCCGG - Intergenic
1057079304 9:92160326-92160348 CCTGACCTCCAGGTGGGCGCAGG + Intergenic
1057305974 9:93912253-93912275 CCTGACCACCTCCTGGCCCCCGG + Intergenic
1059277646 9:113109340-113109362 CCTGATCCCCCTCTGGGCGAGGG - Intergenic
1059278605 9:113115211-113115233 CCTGATCCCCCTCTGGGCGAGGG + Intergenic
1060297031 9:122349908-122349930 CCTGACCCCCGCAGGTGCTCAGG + Intergenic
1061251495 9:129428926-129428948 CCTGGCCCCAGGCTGGGTGCTGG + Intergenic
1061619932 9:131805232-131805254 GCTCACCCCCACCTGGCCGCCGG - Intergenic
1061961767 9:133992347-133992369 CCTGAGCCCCGCGCGCGCGCGGG - Intronic
1062162502 9:135087921-135087943 CCTGAAGGCCGCCTGGGCGCGGG + Exonic
1062282085 9:135756685-135756707 GCTGACCCCCGCCAGGGCCGAGG - Intronic
1062352716 9:136147167-136147189 CCTGAGCCACTCCTGTGCGCCGG - Intergenic
1062362176 9:136193335-136193357 CCGGACCCCCGCCAGGCCGGGGG - Intergenic
1189736168 X:44072094-44072116 CCTGGCCCCACCCTGGGGGCTGG - Intergenic
1190177449 X:48162601-48162623 CCTCAGCCCAGCCTGGGCCCAGG - Intergenic
1190556784 X:51643873-51643895 CCAGTCCCCCACCTGGGAGCTGG - Intergenic
1190878207 X:54474663-54474685 CCTGCCCTCCCCCTGGGCGTGGG + Intronic
1192219552 X:69188134-69188156 CCAGACCTCAGCCTGGGAGCTGG + Intergenic
1200138702 X:153886770-153886792 CCTGCCGCCCACCTGGGCTCTGG - Intronic