ID: 1078580137

View in Genome Browser
Species Human (GRCh38)
Location 11:12533161-12533183
Sequence ATGTGTCCTGAGAAGAGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078580127_1078580137 29 Left 1078580127 11:12533109-12533131 CCTGCTGCTGCTGATGGACAGGA No data
Right 1078580137 11:12533161-12533183 ATGTGTCCTGAGAAGAGCTAGGG No data
1078580133_1078580137 -9 Left 1078580133 11:12533147-12533169 CCAGCCTCTCCACAATGTGTCCT No data
Right 1078580137 11:12533161-12533183 ATGTGTCCTGAGAAGAGCTAGGG No data
1078580130_1078580137 -6 Left 1078580130 11:12533144-12533166 CCCCCAGCCTCTCCACAATGTGT No data
Right 1078580137 11:12533161-12533183 ATGTGTCCTGAGAAGAGCTAGGG No data
1078580129_1078580137 3 Left 1078580129 11:12533135-12533157 CCTGGACTACCCCCAGCCTCTCC No data
Right 1078580137 11:12533161-12533183 ATGTGTCCTGAGAAGAGCTAGGG No data
1078580132_1078580137 -8 Left 1078580132 11:12533146-12533168 CCCAGCCTCTCCACAATGTGTCC No data
Right 1078580137 11:12533161-12533183 ATGTGTCCTGAGAAGAGCTAGGG No data
1078580131_1078580137 -7 Left 1078580131 11:12533145-12533167 CCCCAGCCTCTCCACAATGTGTC No data
Right 1078580137 11:12533161-12533183 ATGTGTCCTGAGAAGAGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078580137 Original CRISPR ATGTGTCCTGAGAAGAGCTA GGG Intergenic
No off target data available for this crispr