ID: 1078581536

View in Genome Browser
Species Human (GRCh38)
Location 11:12542945-12542967
Sequence CTCAGGTGTGTTGGGGAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078581536_1078581544 2 Left 1078581536 11:12542945-12542967 CCCCATTCCCCAACACACCTGAG No data
Right 1078581544 11:12542970-12542992 TCTGCCTTGGTCTCCTTGCCTGG No data
1078581536_1078581548 21 Left 1078581536 11:12542945-12542967 CCCCATTCCCCAACACACCTGAG No data
Right 1078581548 11:12542989-12543011 CTGGCACTCTTGTTTCCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078581536 Original CRISPR CTCAGGTGTGTTGGGGAATG GGG (reversed) Intergenic
No off target data available for this crispr