ID: 1078582378

View in Genome Browser
Species Human (GRCh38)
Location 11:12548389-12548411
Sequence TCTCATGTCCCTGAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078582370_1078582378 16 Left 1078582370 11:12548350-12548372 CCAGTTTTCTGCAGACTGTATCA No data
Right 1078582378 11:12548389-12548411 TCTCATGTCCCTGAGGTGGGAGG No data
1078582369_1078582378 19 Left 1078582369 11:12548347-12548369 CCACCAGTTTTCTGCAGACTGTA No data
Right 1078582378 11:12548389-12548411 TCTCATGTCCCTGAGGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078582378 Original CRISPR TCTCATGTCCCTGAGGTGGG AGG Intergenic
No off target data available for this crispr