ID: 1078586905

View in Genome Browser
Species Human (GRCh38)
Location 11:12599617-12599639
Sequence CTCCGCGCTCGTGGAGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078586905_1078586917 26 Left 1078586905 11:12599617-12599639 CCTTCTGCTCCACGAGCGCGGAG No data
Right 1078586917 11:12599666-12599688 GCTTCTCCGCAGCGGCCGCCAGG No data
1078586905_1078586916 18 Left 1078586905 11:12599617-12599639 CCTTCTGCTCCACGAGCGCGGAG No data
Right 1078586916 11:12599658-12599680 TACTGGGTGCTTCTCCGCAGCGG No data
1078586905_1078586919 28 Left 1078586905 11:12599617-12599639 CCTTCTGCTCCACGAGCGCGGAG No data
Right 1078586919 11:12599668-12599690 TTCTCCGCAGCGGCCGCCAGGGG No data
1078586905_1078586911 2 Left 1078586905 11:12599617-12599639 CCTTCTGCTCCACGAGCGCGGAG No data
Right 1078586911 11:12599642-12599664 TCCCTGGCCCAGTTGGTACTGGG No data
1078586905_1078586920 29 Left 1078586905 11:12599617-12599639 CCTTCTGCTCCACGAGCGCGGAG No data
Right 1078586920 11:12599669-12599691 TCTCCGCAGCGGCCGCCAGGGGG No data
1078586905_1078586910 1 Left 1078586905 11:12599617-12599639 CCTTCTGCTCCACGAGCGCGGAG No data
Right 1078586910 11:12599641-12599663 CTCCCTGGCCCAGTTGGTACTGG No data
1078586905_1078586918 27 Left 1078586905 11:12599617-12599639 CCTTCTGCTCCACGAGCGCGGAG No data
Right 1078586918 11:12599667-12599689 CTTCTCCGCAGCGGCCGCCAGGG No data
1078586905_1078586909 -5 Left 1078586905 11:12599617-12599639 CCTTCTGCTCCACGAGCGCGGAG No data
Right 1078586909 11:12599635-12599657 CGGAGGCTCCCTGGCCCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078586905 Original CRISPR CTCCGCGCTCGTGGAGCAGA AGG (reversed) Intergenic