ID: 1078589802

View in Genome Browser
Species Human (GRCh38)
Location 11:12630394-12630416
Sequence CTTAATAGAAAAATGGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078589802_1078589806 26 Left 1078589802 11:12630394-12630416 CCTTTGTCCATTTTTCTATTAAG No data
Right 1078589806 11:12630443-12630465 TTCTGTACACAAGTCATATTAGG No data
1078589802_1078589804 -10 Left 1078589802 11:12630394-12630416 CCTTTGTCCATTTTTCTATTAAG No data
Right 1078589804 11:12630407-12630429 TTCTATTAAGTTATCTGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078589802 Original CRISPR CTTAATAGAAAAATGGACAA AGG (reversed) Intergenic
No off target data available for this crispr