ID: 1078592659

View in Genome Browser
Species Human (GRCh38)
Location 11:12658365-12658387
Sequence CTCCAAAAACAGTCAAGTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078592656_1078592659 4 Left 1078592656 11:12658338-12658360 CCTCATTTAACCTCAATTACTTC 0: 5
1: 100
2: 342
3: 888
4: 1703
Right 1078592659 11:12658365-12658387 CTCCAAAAACAGTCAAGTTAAGG No data
1078592655_1078592659 12 Left 1078592655 11:12658330-12658352 CCTTATAACCTCATTTAACCTCA No data
Right 1078592659 11:12658365-12658387 CTCCAAAAACAGTCAAGTTAAGG No data
1078592657_1078592659 -6 Left 1078592657 11:12658348-12658370 CCTCAATTACTTCCTCACTCCAA No data
Right 1078592659 11:12658365-12658387 CTCCAAAAACAGTCAAGTTAAGG No data
1078592654_1078592659 24 Left 1078592654 11:12658318-12658340 CCAGGGCTCTATCCTTATAACCT No data
Right 1078592659 11:12658365-12658387 CTCCAAAAACAGTCAAGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078592659 Original CRISPR CTCCAAAAACAGTCAAGTTA AGG Intergenic
No off target data available for this crispr