ID: 1078594291

View in Genome Browser
Species Human (GRCh38)
Location 11:12673979-12674001
Sequence AGTCCGGGACGCGGAAGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078594291_1078594296 -10 Left 1078594291 11:12673979-12674001 CCCGCGCTTCCGCGTCCCGGACT No data
Right 1078594296 11:12673992-12674014 GTCCCGGACTAGGGAAACTGAGG No data
1078594291_1078594299 -5 Left 1078594291 11:12673979-12674001 CCCGCGCTTCCGCGTCCCGGACT No data
Right 1078594299 11:12673997-12674019 GGACTAGGGAAACTGAGGCACGG No data
1078594291_1078594300 -1 Left 1078594291 11:12673979-12674001 CCCGCGCTTCCGCGTCCCGGACT No data
Right 1078594300 11:12674001-12674023 TAGGGAAACTGAGGCACGGTAGG No data
1078594291_1078594301 25 Left 1078594291 11:12673979-12674001 CCCGCGCTTCCGCGTCCCGGACT No data
Right 1078594301 11:12674027-12674049 GTCGCGCGCAACTCCCGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078594291 Original CRISPR AGTCCGGGACGCGGAAGCGC GGG (reversed) Intergenic