ID: 1078601475

View in Genome Browser
Species Human (GRCh38)
Location 11:12735315-12735337
Sequence CTGAATAAGCATTAGGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 192}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078601468_1078601475 16 Left 1078601468 11:12735276-12735298 CCTCCAGTTCCTTTTTGGTTCAT 0: 1
1: 0
2: 2
3: 15
4: 401
Right 1078601475 11:12735315-12735337 CTGAATAAGCATTAGGGGAAGGG 0: 1
1: 0
2: 0
3: 15
4: 192
1078601470_1078601475 7 Left 1078601470 11:12735285-12735307 CCTTTTTGGTTCATTCACTCTGA 0: 1
1: 0
2: 1
3: 23
4: 255
Right 1078601475 11:12735315-12735337 CTGAATAAGCATTAGGGGAAGGG 0: 1
1: 0
2: 0
3: 15
4: 192
1078601466_1078601475 26 Left 1078601466 11:12735266-12735288 CCTCTTATGTCCTCCAGTTCCTT 0: 1
1: 0
2: 0
3: 25
4: 311
Right 1078601475 11:12735315-12735337 CTGAATAAGCATTAGGGGAAGGG 0: 1
1: 0
2: 0
3: 15
4: 192
1078601469_1078601475 13 Left 1078601469 11:12735279-12735301 CCAGTTCCTTTTTGGTTCATTCA 0: 1
1: 0
2: 3
3: 29
4: 321
Right 1078601475 11:12735315-12735337 CTGAATAAGCATTAGGGGAAGGG 0: 1
1: 0
2: 0
3: 15
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078601475 Original CRISPR CTGAATAAGCATTAGGGGAA GGG Intronic
902645283 1:17793593-17793615 CTGGAAAAGCTGTAGGGGAAGGG - Intronic
903283171 1:22261739-22261761 CTCCATAAGCACTAGGGGCAGGG - Intergenic
906338535 1:44956747-44956769 CTGAATAAGCATTTGGAAAAAGG + Intronic
906745518 1:48219530-48219552 CTGAGAAAGCTTTATGGGAAGGG - Intergenic
908571361 1:65414014-65414036 CTGAATAGGAGTTAAGGGAATGG + Exonic
910084421 1:83382408-83382430 CTGAATAAGCATTTGTGGTTTGG - Intergenic
911659748 1:100487960-100487982 CTTAATAAGTATTATGTGAATGG + Intronic
913396611 1:118378425-118378447 ATGAAACAGCACTAGGGGAATGG - Intergenic
913448678 1:118976677-118976699 CTGAGTGAGCATCTGGGGAAGGG - Intronic
913585573 1:120272276-120272298 CTGGATAAGAGTGAGGGGAAGGG - Intergenic
913622611 1:120626091-120626113 CTGGATAAGAGTGAGGGGAAGGG + Intergenic
914567579 1:148884135-148884157 CTGGATAAGAGTGAGGGGAAGGG - Intronic
914605243 1:149246110-149246132 CTGGATAAGAGTGAGGGGAAGGG + Intergenic
914789803 1:150867762-150867784 ATGAGAGAGCATTAGGGGAATGG - Intronic
914830574 1:151168102-151168124 CTGTAAAAGCAGTAAGGGAAAGG - Intronic
915264119 1:154703281-154703303 CAAAATAAACATTAGGGAAATGG - Exonic
916038274 1:160940769-160940791 TTGAAAAAGGATTAGGCGAATGG - Intergenic
916824114 1:168427990-168428012 CAGAATAAGCATTTGCTGAAGGG - Intergenic
917690688 1:177465214-177465236 CTCAATAAACATTAGTTGAATGG - Intergenic
918218971 1:182418430-182418452 CTGAATAAGTATTAGTAAAAAGG + Intergenic
919180549 1:194076026-194076048 CAGAATAAGAATTTGGGTAAAGG - Intergenic
920602532 1:207343423-207343445 CTGAATGACCATTAGGTCAAGGG - Intronic
921307828 1:213814631-213814653 CTGAATAACCATTCAGTGAATGG - Intergenic
924868053 1:248007444-248007466 CTTAATGACCATAAGGGGAAAGG - Intronic
1068100140 10:52542393-52542415 CTGGATAAAGATTTGGGGAATGG + Intergenic
1070271882 10:74964500-74964522 CTGAAGAAACATTTAGGGAATGG - Intronic
1071323898 10:84492505-84492527 TTGAATAAGAATTATGAGAATGG + Intronic
1075535825 10:123271346-123271368 CTGAATAAACAAAAGGTGAAGGG + Intergenic
1076282149 10:129256914-129256936 ATGAATAACAATTTGGGGAAAGG + Intergenic
1078601475 11:12735315-12735337 CTGAATAAGCATTAGGGGAAGGG + Intronic
1079425402 11:20337122-20337144 CAGAAAAAGCATGAGGGTAAGGG + Intergenic
1080279978 11:30545686-30545708 CAGATTAAGCAATAGGGCAAAGG + Intronic
1084842842 11:71870790-71870812 CTCACTAATCATTAGGGAAATGG + Intronic
1085730555 11:78994872-78994894 CAGAATAGGCATCCGGGGAATGG - Intronic
1085821022 11:79793899-79793921 CTGAATCAGCATTGGGGTAATGG + Intergenic
1086274840 11:85114288-85114310 CAGAATAAACACTAGGGGAAAGG + Intronic
1086347805 11:85915151-85915173 CTGAGTCAGCTTTAGGGGGAAGG - Intronic
1087214438 11:95480202-95480224 CTGCCTAAGCCTTAGGAGAAGGG - Intergenic
1088458812 11:110061080-110061102 TTGAGTAAGCAAGAGGGGAATGG + Intergenic
1088894287 11:114066140-114066162 CTGAACGAGCAACAGGGGAATGG - Intronic
1090469908 11:126971184-126971206 CTGAATAAACATTATGAAAAGGG + Intronic
1090851948 11:130578626-130578648 CTTAAGAAATATTAGGGGAAGGG - Intergenic
1093995654 12:25639559-25639581 ATCATTAATCATTAGGGGAATGG + Intronic
1094026404 12:25963973-25963995 CTAAATAAGCACCAGGGTAAGGG - Intronic
1095606388 12:44072701-44072723 CTCAATAAACATTTGTGGAATGG - Intronic
1097147254 12:56950406-56950428 CACAGAAAGCATTAGGGGAAAGG - Intergenic
1097151123 12:56980729-56980751 CAGAGAAAGCATTAGGAGAAAGG - Intergenic
1097365052 12:58702558-58702580 TTGAAAAAACATTAGGTGAATGG + Intronic
1097726588 12:63081872-63081894 CTGAATAAGCATTAGATGTTTGG + Intergenic
1097732438 12:63144586-63144608 CTGAAAAAGTATTCCGGGAAGGG - Exonic
1099180948 12:79472348-79472370 CCTAATATGCATTGGGGGAAAGG + Intergenic
1100342074 12:93688857-93688879 CTGAAGAAGAATTAGGGTGATGG - Intronic
1104021866 12:124997605-124997627 CTGAATAAGCATTTAGTAAATGG + Intronic
1106649660 13:31676651-31676673 CTGAATCAGGATCAGGTGAAAGG - Intergenic
1110412057 13:75215286-75215308 CTTTATAAGCACTTGGGGAAAGG + Intergenic
1111385089 13:87515101-87515123 CTGCAAAAGCATTTGGGCAAGGG + Intergenic
1111777321 13:92681038-92681060 CTGGATCAGCAACAGGGGAAAGG - Intronic
1111961542 13:94816132-94816154 ATGAATAAGAATTAGGAGGAGGG + Intergenic
1114299717 14:21364347-21364369 CTGAAGAACCAGTGGGGGAAGGG + Intronic
1115229989 14:31150137-31150159 CTGGTCAATCATTAGGGGAAGGG - Exonic
1117327827 14:54685037-54685059 CTGAAAAAGATTTAGGTGAATGG + Intronic
1117972057 14:61261439-61261461 CTGAATAATCTTTTTGGGAATGG - Intronic
1120880420 14:89411491-89411513 CTGAATATGAACTAGGAGAAGGG - Intronic
1121628414 14:95404475-95404497 GTGAACAGGCATTAGTGGAAAGG - Intergenic
1125057072 15:35373178-35373200 GTACATAAGCATTAAGGGAAGGG - Intronic
1125442434 15:39717411-39717433 ATGCAAAAGCATTAGGGGAAGGG - Intronic
1125530343 15:40409097-40409119 ATGTAAAAGCATTAGGGGAAAGG + Intronic
1126811123 15:52405257-52405279 CAGAATAAGCTTTAGTGGGATGG - Intronic
1131522237 15:93125412-93125434 CTGAATGGGCAGTAAGGGAAAGG + Intergenic
1131825159 15:96315285-96315307 CTAAAGAAGCATCAGGGGATGGG + Intergenic
1133540906 16:6752743-6752765 GTGAAGAAGCAGTAAGGGAAAGG - Intronic
1133695098 16:8255618-8255640 ATGAGTAAGAATTAGGGGAGGGG - Intergenic
1135487261 16:22877106-22877128 TTCAATAAGCTTTTGGGGAACGG - Intronic
1138144385 16:54595645-54595667 CTGACTAAGCATTAAGGGGAGGG - Intergenic
1139726393 16:68902965-68902987 CTTAATAAATATTAGTGGAATGG + Intronic
1142503094 17:344921-344943 AGGAATCAGCATGAGGGGAAAGG + Intronic
1143700066 17:8652045-8652067 CTGCAATTGCATTAGGGGAAAGG + Intergenic
1147269577 17:39258950-39258972 CTGAAAGAGAATAAGGGGAAAGG + Intergenic
1148165865 17:45483574-45483596 CTGGCTGAGCATCAGGGGAAAGG + Intronic
1148727077 17:49800946-49800968 GAGAATAAGCATTATGGGTAAGG + Intronic
1148835598 17:50464141-50464163 CTGAATGAGCTGTAGGTGAAAGG + Intronic
1149308388 17:55371204-55371226 CTGAATAGGCATTAGAGGTGGGG - Intergenic
1150344635 17:64394675-64394697 ATGAAAAAGCATTAGTGCAATGG + Intronic
1153432442 18:5032598-5032620 CTCACTAATCATTAGGGAAATGG - Intergenic
1156697954 18:39790642-39790664 CAGAACAAGGATTAGGGGTAGGG + Intergenic
1159307416 18:66662260-66662282 CTAATTAATCATTAGGGGAAAGG + Intergenic
1159743002 18:72196504-72196526 CTGAATAAGGAAAAGGGGGAGGG + Intergenic
1159745358 18:72227987-72228009 TTGCATAAGCATTAGTGCAAAGG + Intergenic
1163772061 19:19197230-19197252 CTGAAGGAGCATTTGCGGAAAGG + Exonic
1163884039 19:19950360-19950382 CTGAGTAGGCAGTAGAGGAAAGG - Intergenic
1165024569 19:32950261-32950283 CTTAAAAAGCATTAGGGGCCAGG + Intronic
927944120 2:27124289-27124311 GTGGACAAGCATTTGGGGAAAGG + Intronic
928461228 2:31474707-31474729 GTAAATAAATATTAGGGGAAGGG - Intergenic
930686890 2:54319096-54319118 CTGCCCTAGCATTAGGGGAATGG - Intergenic
933555388 2:83824299-83824321 CTTAAGAAGCATAAGGGGAAAGG - Intergenic
934033482 2:88068071-88068093 CTCAAAAATCATCAGGGGAAGGG + Intronic
935556937 2:104520123-104520145 CTGAATGAGCATTAGGAAACAGG + Intergenic
935892899 2:107699318-107699340 CTGCATATGCATTGGGGGAGAGG - Intergenic
940082028 2:149813754-149813776 CTGTATAAGGAATAGGTGAAAGG + Intergenic
940186507 2:150990880-150990902 GTGAATGCTCATTAGGGGAAAGG + Intergenic
943128964 2:183833216-183833238 CTGAATAAGCATTATGGACAGGG - Intergenic
943540408 2:189206600-189206622 CTGAATAACCACCAGAGGAAAGG + Intergenic
944089031 2:195883956-195883978 CTGAAGAAACATTAGTGAAAGGG + Intronic
945965528 2:216182433-216182455 CCAAATGAGCAGTAGGGGAAAGG - Intronic
1169777003 20:9265892-9265914 CTGAAGAAGCATCTTGGGAATGG + Intronic
1170949227 20:20921051-20921073 CAGAATAAGCTATAGAGGAAAGG + Intergenic
1171124775 20:22592005-22592027 TTAAATAAGCATTAAGGGAATGG - Intergenic
1179156993 21:38859363-38859385 CGGAATAAGAATTGGGGGAGAGG + Intergenic
1181827966 22:25535005-25535027 ATCACTAATCATTAGGGGAATGG - Intergenic
1182841207 22:33391419-33391441 CAGGGGAAGCATTAGGGGAAGGG + Intronic
950083967 3:10243584-10243606 CTGAATAATCATTAGGTACATGG - Exonic
951144154 3:19206383-19206405 CTGCAAAAGCATAAGGGGAAAGG + Intronic
951366305 3:21787451-21787473 CTGGATAAGGAGTAGGGGCACGG - Intronic
951557076 3:23931666-23931688 CCCAATAAGTATTAGTGGAAGGG + Intronic
953072277 3:39532786-39532808 CTGACCAAGCATCAGTGGAAAGG + Intergenic
953235376 3:41101985-41102007 CAAAATAAGTATTAGGGGTAGGG - Intergenic
953857562 3:46511766-46511788 CTGAATAAGAATTTAGGAAAGGG - Intergenic
954605061 3:51903091-51903113 TGCAATCAGCATTAGGGGAAAGG + Intronic
954913545 3:54129800-54129822 CTTAATAAGTATTACGGTAATGG - Intronic
955251970 3:57292274-57292296 CTGAATAAGCTTTAAGTCAATGG - Intronic
956177130 3:66483648-66483670 CAGAATAACCACAAGGGGAAGGG + Intronic
956417800 3:69051795-69051817 CTGAAGCAGCATTAGGGAACGGG + Intronic
961196519 3:125006316-125006338 CTGATTGAGCCTGAGGGGAACGG + Intronic
961299740 3:125915376-125915398 CTTAATAAGTATTTGGTGAACGG + Intergenic
961673952 3:128553754-128553776 CTGAGTAAGCAAGAGAGGAAGGG + Intergenic
962058955 3:131904836-131904858 CTTAATAAGAATTTTGGGAATGG - Intronic
962487714 3:135861165-135861187 CTGAAGAAGCATTTGGGAGATGG - Intergenic
963356265 3:144212182-144212204 CTGAAGAGGGTTTAGGGGAAAGG + Intergenic
964977493 3:162638082-162638104 CTGAATAACAAGTATGGGAATGG - Intergenic
969301526 4:6300124-6300146 CAGAGCAAGCATTAGGGAAAGGG - Intronic
970746026 4:19297052-19297074 CAGAGTAAGCAATAGTGGAATGG + Intergenic
973740241 4:53912485-53912507 CTGAATAAGAATTACGGCTAGGG - Intronic
976466555 4:85376108-85376130 GTGAATGAGGTTTAGGGGAATGG - Intergenic
978810989 4:112849713-112849735 CTGTATAAGGATTAGAAGAAGGG - Intronic
980008303 4:127566353-127566375 CTCAATAAGCATTTGTTGAATGG + Intergenic
980440454 4:132837338-132837360 CTTTATAAGCAATAGTGGAAAGG + Intergenic
982080161 4:151781806-151781828 ATGAATTAGCATTAGGAAAAAGG + Intergenic
982260823 4:153492907-153492929 CTTGATAAGGAGTAGGGGAAAGG + Intronic
982285479 4:153729227-153729249 CAGAATGAACATAAGGGGAACGG + Intronic
984075685 4:175175980-175176002 TTGAATAAGCATTACTGGAAAGG - Intergenic
985427065 4:189841348-189841370 CTGCATAAACACCAGGGGAAAGG - Intergenic
985910193 5:2873395-2873417 CTGAATATGCATAATGGGAGTGG - Intergenic
987953623 5:24708009-24708031 CTGAATATGGATTATGGAAATGG + Intergenic
992352128 5:75940682-75940704 ATGAAAGAGAATTAGGGGAAAGG + Intergenic
993017701 5:82554356-82554378 ATCACTAATCATTAGGGGAATGG - Intergenic
993181059 5:84553087-84553109 CTGAATAAACATTTAGGTAATGG + Intergenic
993909697 5:93666242-93666264 CTGAATAAGATGTAGGTGAAAGG - Intronic
994367248 5:98929438-98929460 CTGAATAAGCCTAAGGGGCCGGG + Intergenic
994367777 5:98934845-98934867 CTGTATAAGAATTAGGTGGAAGG + Intergenic
995118746 5:108512913-108512935 CTGAGTAGCCATTTGGGGAAAGG + Intergenic
996626749 5:125579461-125579483 GTAAATAAGAATTATGGGAAAGG + Intergenic
998384901 5:141751450-141751472 ATTAATAACCATTAGGTGAATGG + Intergenic
998823847 5:146081521-146081543 CAGAAGAAGCAAAAGGGGAAAGG + Exonic
999375272 5:151082066-151082088 CTCAAAAAGAATTAGGGGAAAGG + Intronic
1000222896 5:159231221-159231243 CTGAATGAGGAGTTGGGGAAAGG - Intergenic
1000760319 5:165215694-165215716 CTGAAACAGAATTAGTGGAATGG - Intergenic
1001559282 5:172658846-172658868 CTGAAAAAGAATTGGGGGTAGGG - Intronic
1001776000 5:174329431-174329453 CTGAGTATGAATGAGGGGAACGG + Intergenic
1002653075 5:180718211-180718233 CTGAATCAGCATTAACAGAAAGG + Intergenic
1004074010 6:12328881-12328903 CTGAGTAAGAAATAGGGGAGTGG - Intergenic
1005112756 6:22301972-22301994 TTGAAGAAGCCTTATGGGAAAGG + Intergenic
1008826052 6:55695775-55695797 CTGAATAAGCATGCCTGGAATGG - Intergenic
1009986923 6:70792601-70792623 CTGAATAAGCATTAGATATAAGG + Intronic
1010455858 6:76053506-76053528 CTGAGGAAATATTAGGGGAAAGG + Intronic
1014882492 6:126740809-126740831 CAGAATCAGCATTAGGAAAAAGG - Intergenic
1014889182 6:126821503-126821525 CTGAAAATTCCTTAGGGGAATGG - Intergenic
1015842047 6:137487605-137487627 CTGAATAACCAGGAGGAGAAAGG + Intergenic
1015906460 6:138122336-138122358 CTGAACCAGCATTATGGAAAGGG + Intergenic
1018718950 6:166557504-166557526 CTCAATTAGGATTATGGGAAGGG - Intronic
1020372874 7:7453609-7453631 CTCAATAAGCATTTGTGGAGTGG + Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1024939387 7:54746347-54746369 CTGGAACAGCATAAGGGGAAAGG - Intergenic
1025910507 7:65824928-65824950 CTGATGAAGCAATAGGGAAATGG - Intergenic
1026095726 7:67345085-67345107 CTGCATGTGCATTAGGAGAATGG + Intergenic
1026235633 7:68524696-68524718 CTGCATAAGCGTTACAGGAAAGG + Intergenic
1027301244 7:76838534-76838556 CTGAATAAGCATTTGTGGTTTGG - Intergenic
1030067714 7:105673202-105673224 ATGAATAAGCGTATGGGGAAGGG - Intronic
1031202261 7:118703265-118703287 CTGAGTAAGCAATAAAGGAAGGG - Intergenic
1032891657 7:136201174-136201196 GTGAATAAGGTTTAGGGGCAGGG - Intergenic
1034920254 7:155073643-155073665 CTGAATAAACATCAGGGGAGAGG - Intronic
1039593784 8:38772212-38772234 TTGATTAAGGTTTAGGGGAAAGG + Intronic
1039721976 8:40174133-40174155 CTCAACAAGCATTAAGGGGATGG + Intergenic
1044181437 8:89200419-89200441 CTCAATAAGTATTTGTGGAAGGG - Intergenic
1044535394 8:93351809-93351831 TTGAATAAGTATTATGGGAGTGG - Intergenic
1045337583 8:101222909-101222931 CTGAATAAGCATTTAAGGGAGGG + Intergenic
1045499113 8:102731653-102731675 CTCAATAAGTATTTGTGGAAGGG + Intergenic
1047470533 8:125167307-125167329 CAGAATAAGCAGTTAGGGAAGGG + Intronic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1049730747 8:144176882-144176904 CTGCAGAAGCCTTAAGGGAAAGG + Intronic
1051284399 9:15481390-15481412 CTGAATAAGAATTATAGGTAGGG + Intronic
1052257106 9:26470463-26470485 CTGAATAAGCAATAATAGAATGG - Intergenic
1052980075 9:34441693-34441715 CTGTAAAAACATTAGGTGAAAGG + Intronic
1186169454 X:6861416-6861438 TTTAGAAAGCATTAGGGGAAAGG - Intergenic
1186938353 X:14475945-14475967 TTTATTACGCATTAGGGGAAAGG - Intergenic
1188277098 X:28213907-28213929 ATAAATAAGCATTAAGTGAAAGG - Intergenic
1189143920 X:38636633-38636655 CAGAATCAGCATGAGGGGTAGGG + Intronic
1189208150 X:39259509-39259531 TTGAATAAGCAATAGAGGATGGG - Intergenic
1192800096 X:74457537-74457559 CTGATCTAGCATGAGGGGAAAGG - Intronic
1194242407 X:91468441-91468463 AAAAATAAGCAATAGGGGAAAGG - Intergenic
1194657765 X:96594236-96594258 CTGAATAGACATTTCGGGAATGG + Intergenic
1195663254 X:107403316-107403338 GTGAAAAAGTATTTGGGGAAGGG - Intergenic
1197143653 X:123145806-123145828 CTGAATATGGATTGGGGGAAGGG - Intergenic
1198675066 X:139122698-139122720 ATGAAGAAGTCTTAGGGGAAAGG - Intronic
1199008868 X:142735330-142735352 CTTATTAATCATCAGGGGAAAGG + Intergenic
1199949686 X:152698393-152698415 CTGAAGTGGCATTGGGGGAAGGG - Intergenic
1199959988 X:152770068-152770090 CTGAAGTGGCATTGGGGGAAGGG + Intergenic
1200341832 X:155405420-155405442 CACAATAAACATTAGGGTAAGGG + Intergenic
1201559788 Y:15303708-15303730 TTTAGAAAGCATTAGGGGAAAGG - Intergenic