ID: 1078601742

View in Genome Browser
Species Human (GRCh38)
Location 11:12738236-12738258
Sequence CTGCCTTAAAGCATGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 260}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078601742 Original CRISPR CTGCCTTAAAGCATGGAAAA TGG Intronic
904217755 1:28937010-28937032 CTGCCTTTAGGAATGTAAAATGG - Intronic
905453628 1:38072985-38073007 CTGCCTTACAGCTTGGAGAGGGG + Intergenic
905531183 1:38680085-38680107 CTGACTTTAAGCATGGAAGAAGG + Intergenic
905633811 1:39535540-39535562 CTGCCGTTAAGAATGCAAAATGG + Intergenic
905791059 1:40789844-40789866 CTGCCTGGGAGCAGGGAAAAAGG + Intronic
906669560 1:47644757-47644779 CTGCCTCTAAGCCTGGATAAAGG - Intergenic
906842508 1:49155011-49155033 CTGTTTTAAAGAATGGTAAATGG - Intronic
907511270 1:54962504-54962526 TTACTTTAAACCATGGAAAAAGG - Intergenic
909161502 1:72156997-72157019 CTGCCTTCCAGCCTGGATAACGG - Intronic
909863015 1:80632777-80632799 CTGCCTTATAGCAAGGACAGAGG - Intergenic
910004973 1:82385469-82385491 CTGCCTTCTACCATGGGAAATGG + Intergenic
910809646 1:91223127-91223149 TTACTTTAAACCATGGAAAAAGG - Intergenic
910934037 1:92472399-92472421 CTGACTTAATGAATGGGAAAAGG + Intergenic
911635524 1:100231251-100231273 ATCCCTTAAAGTTTGGAAAAGGG - Intronic
912385842 1:109270820-109270842 CAGGCATGAAGCATGGAAAAGGG - Intronic
914942973 1:152038761-152038783 ATGCTTTCAAGCAGGGAAAATGG - Intronic
916048661 1:161019725-161019747 CTGGATCAAAGAATGGAAAAAGG + Intronic
916662165 1:166932647-166932669 CTGCCTTGAAGAATGGGAGAAGG + Intronic
918926468 1:190792845-190792867 CTGCCTTACTGCAAGGACAAAGG + Intergenic
919015990 1:192037297-192037319 TTACCTTAAAGCATATAAAAAGG - Intergenic
919591756 1:199512091-199512113 ATGCCCTAAAGCATGAGAAAAGG - Intergenic
922169012 1:223139560-223139582 CTGCCAAACAGCATGGACAAAGG + Intronic
922820292 1:228480068-228480090 TTTCCTTTAAGCAAGGAAAATGG - Intergenic
1062997787 10:1883105-1883127 CTGAATTAAAGCATTGACAATGG + Intergenic
1063795730 10:9512254-9512276 CTGCCTGAGAGCCTGGAAAGGGG + Intergenic
1064711224 10:18127945-18127967 ATTCCGTAAAGCATGGAAAAAGG - Intergenic
1064986848 10:21218975-21218997 CTGCCTAAAAGCAGGGCATAAGG - Intergenic
1065364365 10:24920935-24920957 CTGCCTCAAAGCATCTAAAATGG + Intronic
1065993939 10:31038831-31038853 CTGCCTTAATGGATTAAAAATGG - Intergenic
1067921599 10:50464315-50464337 CTGACTTTAAAGATGGAAAAGGG + Intronic
1068521204 10:58079705-58079727 CTGCCATATAACATGGTAAATGG - Intergenic
1069845729 10:71369894-71369916 CTGCCTTAAAAGATTGAGAAGGG + Intergenic
1070640658 10:78166540-78166562 CTGCCTTCAGGGATGGGAAATGG - Intergenic
1071057086 10:81524497-81524519 GTGGCTTAAGGCATGGGAAAAGG - Intergenic
1071326494 10:84523793-84523815 CTGCCTTAGAGCAGGCAAGATGG + Intergenic
1071909113 10:90211003-90211025 CTGCTCTAGAGGATGGAAAAGGG - Intergenic
1072306192 10:94109657-94109679 CTTCCTTAATAAATGGAAAATGG + Intronic
1075990384 10:126833280-126833302 CTGCCTCACAGCATGGCAGAAGG - Intergenic
1076214889 10:128685651-128685673 GGGCCTTACAGCAGGGAAAATGG - Intergenic
1076674198 10:132139916-132139938 CTGCCTTCAAGAATCGAAGAGGG - Intronic
1078194638 11:9125318-9125340 CTGCGTAGAAGCAGGGAAAAGGG + Intronic
1078601742 11:12738236-12738258 CTGCCTTAAAGCATGGAAAATGG + Intronic
1082831350 11:57620136-57620158 GTGCCTGACAGCATGGCAAATGG - Intergenic
1083025770 11:59549540-59549562 CTGCCTGAAACCAAGGAACAAGG + Intergenic
1083043484 11:59710896-59710918 CTGCCTAAAGGCATGGATATAGG + Intergenic
1086629797 11:89003502-89003524 GATTCTTAAAGCATGGAAAAAGG + Intronic
1088103818 11:106183612-106183634 TTACTTTAAACCATGGAAAAAGG - Intergenic
1088983186 11:114882290-114882312 CTACTTTGAAGGATGGAAAATGG - Intergenic
1090516066 11:127428399-127428421 CCACTTTAAAGTATGGAAAAGGG - Intergenic
1092232427 12:6783552-6783574 ATGTCTGAAAGCATGGAACAGGG - Intergenic
1092599657 12:10045621-10045643 CTACCTTAATGCAAGGAAAGGGG + Intronic
1092814646 12:12302159-12302181 ATGCCTCCAAGAATGGAAAAGGG + Intergenic
1093348929 12:18072495-18072517 CTGCCTTATCGCAAGGACAAAGG + Intergenic
1093763816 12:22939673-22939695 CTGCCTTATAACATGGCAGACGG - Intergenic
1095039997 12:37430727-37430749 CGGTCTTAAAATATGGAAAATGG - Intergenic
1096760161 12:53835017-53835039 AAGCCTTAAAGCAAGGCAAATGG - Intergenic
1096845445 12:54404061-54404083 CTGCCTTAAAAAGGGGAAAATGG - Intronic
1098228960 12:68353415-68353437 TTGGCTTAAAGCAGGGAAGAGGG - Intergenic
1100749990 12:97687844-97687866 CTGCACTACAGCCTGGAAAATGG + Intergenic
1101101325 12:101396455-101396477 CTGCCTTGAAGGACCGAAAATGG - Exonic
1103671024 12:122615504-122615526 CTGCCATAAAGAATGGATACTGG - Exonic
1104631185 12:130403667-130403689 CTCCTCTAAAGCATAGAAAAAGG + Intronic
1105402858 13:20110930-20110952 CTGCCTTCAAGCAGGGACAGTGG + Intergenic
1105586140 13:21744697-21744719 CTTCCTTGACTCATGGAAAATGG + Intergenic
1106624389 13:31405613-31405635 TTACTTTAAACCATGGAAAACGG - Intergenic
1107598118 13:41985119-41985141 CTTACTTATAGCATGGAGAATGG + Intergenic
1107666691 13:42697877-42697899 CTGACTTAGAGTATGGAGAATGG + Intergenic
1108303676 13:49108290-49108312 CAGCCTTAAAGCATTGAGAAGGG + Intronic
1109939561 13:69344045-69344067 CTGCATCACAGCATGGAAAAAGG + Intergenic
1110861837 13:80352981-80353003 CTCAATTAAAACATGGAAAAAGG - Intergenic
1111206744 13:85020582-85020604 CTGCCTTATCGCAAGGAAAGAGG - Intergenic
1111263799 13:85779507-85779529 CTTCCTTAAATCATACAAAAGGG - Intergenic
1111524921 13:89456109-89456131 CAGCCAGAAAGTATGGAAAAGGG + Intergenic
1111594606 13:90395647-90395669 TTACTTTAAACCATGGAAAAAGG - Intergenic
1112221149 13:97492401-97492423 CTACCTTATTGCATGCAAAAAGG + Intergenic
1112705298 13:102061210-102061232 CTGCCTTAAAGCAAGGACAGAGG - Intronic
1113125761 13:106977217-106977239 CTGCCTTAGAGAATGATAAAAGG + Intergenic
1114368478 14:22057252-22057274 CTGCATTAAAATATGGACAAAGG + Intergenic
1114919710 14:27311428-27311450 TTACCTTAAACCATGGAAAAAGG - Intergenic
1115808304 14:37076815-37076837 CTGAGTTAGAGCATGGAACATGG + Intronic
1117764728 14:59069823-59069845 CTGCCTTGAAGAAAGGAACATGG - Intergenic
1118920649 14:70146689-70146711 CTGGCTTACAGCATGGAAGCTGG - Intronic
1119054826 14:71408625-71408647 CTTCCTGAAAGCAAGGAAAGGGG - Intronic
1120139850 14:80916747-80916769 CTCCCTTAAAGCAGAGACAATGG - Intronic
1120465068 14:84845888-84845910 CTGGCTAAAAGTATGGAATAGGG + Intergenic
1120616040 14:86706114-86706136 ATGCATAAAAGCATGAAAAATGG - Intergenic
1121268136 14:92617935-92617957 TTACTTTAAACCATGGAAAAAGG + Intronic
1121578430 14:95007812-95007834 CTGCCTTAATGCGAGGACAAAGG - Intergenic
1121696907 14:95921055-95921077 CTGCCTTCAAGCTGGGACAATGG - Intergenic
1124020674 15:25919807-25919829 CTGAAACAAAGCATGGAAAAAGG - Intergenic
1125630808 15:41145547-41145569 TTACATTAAACCATGGAAAAAGG + Intergenic
1128047073 15:64628132-64628154 ATGCCTTAAACCATGGAATCAGG + Intronic
1128191100 15:65698262-65698284 CTGTCTCAAAGAATGGAAAAAGG + Intronic
1129260283 15:74363017-74363039 TTACTTTAAACCATGGAAAAAGG - Intronic
1130787738 15:87118810-87118832 CTGCCATAATGCATGAAAGATGG - Intergenic
1131172321 15:90187233-90187255 CTTCCCTAAAGCAGGGAAATGGG + Intronic
1131859664 15:96639110-96639132 CTGCCCTAAGGGAAGGAAAATGG - Intergenic
1131963536 15:97813641-97813663 CTCCCTTAAAGTAGGGAAAATGG - Intergenic
1133557977 16:6923693-6923715 CTGCTTTAAAGGCTAGAAAATGG - Intronic
1134224259 16:12379421-12379443 CTTCCCTAAAGAAAGGAAAATGG - Intronic
1136036257 16:27542798-27542820 CTGCCTTATAGCATGGTGGAAGG - Intronic
1136572574 16:31105472-31105494 CTGCCTTCAAGCAGGGCAGAGGG - Intergenic
1140689584 16:77468867-77468889 TTGCCTTAGAGAATGGGAAATGG - Intergenic
1142143039 16:88480987-88481009 CAGTTTTAAAGCATGAAAAAAGG + Intronic
1145180396 17:20744692-20744714 CTGCCATAAAGTATAGGAAAGGG + Intergenic
1145967578 17:28931147-28931169 CTGCCCTAAAGTATGGATAGGGG + Intronic
1148089326 17:45013408-45013430 CTGCTTTAAAGGCTGTAAAAAGG - Intergenic
1149840001 17:59953710-59953732 CTGCCATAAAGTATAGGAAAGGG + Intronic
1150009738 17:61492791-61492813 ATGACTTGAAGCATGCAAAATGG + Intergenic
1154021887 18:10670610-10670632 TTGCCTTAAATCATGGAAATGGG + Intronic
1155287349 18:24303837-24303859 ATGCCTTAAAGAAAAGAAAAAGG + Intronic
1155374549 18:25141454-25141476 CTTCCTTAGAGCACAGAAAATGG + Intronic
1155803422 18:30137259-30137281 TTACTTTAAACCATGGAAAAAGG + Intergenic
1156708968 18:39918702-39918724 CTGGCTTAAAGGAGGGAAAAAGG + Intergenic
1157013300 18:43678819-43678841 TTACTTTAAACCATGGAAAAGGG + Intergenic
1157594260 18:48854296-48854318 CAGCCTTAAAGGATGGAGAGAGG + Intronic
1159373257 18:67557299-67557321 ATGCCTGAAAGTATGGTAAAAGG + Intergenic
1159721649 18:71898884-71898906 CTGCCTTATCGCAAGGACAAAGG + Intergenic
1160008342 18:75085172-75085194 CTGCCTTATGGCTTGAAAAATGG - Intergenic
1160038539 18:75322445-75322467 GTGCCTTCATGCATGGAGAAGGG - Intergenic
1160262926 18:77312403-77312425 TTACTTTAAACCATGGAAAAAGG + Intergenic
1162184626 19:8895270-8895292 CATTCTTAAAGCATGGAAACAGG + Intronic
1164938651 19:32233967-32233989 CTGCCTCAGAAGATGGAAAAAGG + Intergenic
1165583702 19:36893463-36893485 TTGCCTTAAAGCATAGAACTGGG - Intronic
1165829094 19:38721774-38721796 CTGCCTCAAGGCCTGGAATAGGG + Intronic
1166041959 19:40208976-40208998 CTGCATTAAGGAATGAAAAATGG + Intronic
925403141 2:3590334-3590356 CTGCCTTCAAGCAGGGCAGAGGG + Intergenic
926409801 2:12591106-12591128 GTCCCTTAAAGAAAGGAAAAAGG - Intergenic
926450726 2:13000765-13000787 CAGCTTCCAAGCATGGAAAAAGG + Intergenic
928186879 2:29118316-29118338 CTGTGTTAAAGCATGGACCAAGG + Intronic
929436663 2:41933859-41933881 CTTCCCTAAAGCAAGGAAGAGGG - Intergenic
929650529 2:43676319-43676341 CTGTCCTAACGCCTGGAAAATGG - Intronic
931511559 2:63001490-63001512 CTGCTTTAAAGCAGGGAATAGGG + Intronic
933976727 2:87518113-87518135 CTTCCTCAATGCATAGAAAAGGG - Intergenic
935899493 2:107775478-107775500 CTCCCTTGAAGCATTGCAAACGG - Intergenic
936238258 2:110764939-110764961 CTGACTTAAAGAATGGCTAAAGG - Intronic
936317088 2:111432691-111432713 CTTCCTCAATGCATAGAAAAGGG + Intergenic
937402618 2:121598018-121598040 CTGCCTTAAAACTTGCAGAAAGG - Intronic
938135581 2:128753856-128753878 CTGCCTCCAAGCAAGGGAAAAGG - Intergenic
938919616 2:135983034-135983056 CTTTATTAAAGCATGCAAAAAGG + Intronic
939840500 2:147182191-147182213 CTGCATTAAAACAGGTAAAAAGG + Intergenic
940317156 2:152336992-152337014 CTGCCTTCAGGCCTTGAAAAAGG + Intronic
940515188 2:154675583-154675605 CTTCCTTATAGAATGGAAGATGG - Intergenic
942390769 2:175490722-175490744 CTGACTGAAAGCATGTAAATGGG + Intergenic
942573715 2:177340114-177340136 ATGCTTTGAAGAATGGAAAATGG - Intronic
945507057 2:210654737-210654759 TTTCCTTAAAGCAAGTAAAATGG - Intronic
945943119 2:215969519-215969541 CTGCCTTACAATATGGAAACGGG - Intronic
1170736109 20:19015394-19015416 CTGCCTTCAAGCAAGGGAAGAGG + Intergenic
1172292276 20:33784530-33784552 CTGCCTTAATTCATGAACAAGGG + Intronic
1175393445 20:58642324-58642346 GTGCCTTGAAGGATGGAAAAGGG - Intergenic
1177534070 21:22401728-22401750 TTACTTTAAACCATGGAAAAAGG - Intergenic
1178228341 21:30751244-30751266 CTGCATCAAAACATGGCAAAAGG - Intergenic
1178772597 21:35519625-35519647 CAGCCTTGAAGCATGGAGTAGGG + Intronic
1179114778 21:38480275-38480297 CTGCCAGAAACCATGGAAAGTGG + Intronic
1181933099 22:26418508-26418530 TTGGCTTCAAGCATGGCAAAAGG - Intergenic
1183140770 22:35936647-35936669 CAGCTTTAAACCATGGCAAAGGG + Intronic
1183980576 22:41537497-41537519 CAGCCTCAAAGCATGGCAATTGG + Intronic
1184135827 22:42549344-42549366 CTGCCCTAAAAAGTGGAAAAAGG - Intergenic
1184198373 22:42947458-42947480 CTGCCTCCAAGCATGGGAAGAGG - Intronic
1184460202 22:44633529-44633551 CTGGATGAATGCATGGAAAATGG + Intergenic
949573151 3:5312575-5312597 GTGCCCTAAAGCAAGGAGAAAGG + Intergenic
952855524 3:37767361-37767383 CTGCCTTAAGGGATGGGGAAAGG + Intronic
953614294 3:44476279-44476301 CTGACAAAAAGCATGAAAAATGG - Intronic
955433429 3:58873434-58873456 CTGCCTTACAGCATCCAGAATGG - Intronic
957712617 3:83882306-83882328 GTGCCATAAAGCATAGACAAAGG + Intergenic
960111172 3:113846507-113846529 CAGACTTAAAGCAAGAAAAATGG + Intronic
961796931 3:129415814-129415836 CTCCCTTAATTCCTGGAAAATGG + Intronic
962477009 3:135763612-135763634 CTTCCTTCATGCCTGGAAAAGGG + Intergenic
963260850 3:143189431-143189453 GGACCTTAAAGCCTGGAAAAAGG + Intergenic
964849906 3:161084454-161084476 CTGAATTACAGGATGGAAAAAGG - Exonic
966727609 3:183121231-183121253 CTGCCTTGTAACATGGTAAAAGG - Intergenic
967149593 3:186636491-186636513 CTGCCTTATAGCATCAAAAGTGG - Intronic
971213441 4:24641707-24641729 TTTACTTAAACCATGGAAAAAGG + Intergenic
971876218 4:32312038-32312060 TTGCCTTAAAAAATGTAAAATGG - Intergenic
972941595 4:44201961-44201983 CTGCTTTAAAGAATGGCCAAAGG + Intronic
973861167 4:55066385-55066407 CTGTCTTAAATCACAGAAAATGG + Intergenic
974166816 4:58214743-58214765 CTGCCTTATAGCAAGGACAGAGG + Intergenic
976960789 4:90969658-90969680 ATGCCTTAAAAAATGGTAAAGGG + Intronic
977678294 4:99771461-99771483 CTGCCTTAAAGTAGGAAAACTGG - Intergenic
978310116 4:107378517-107378539 CTGCCTTACAGCAAGGACAGAGG + Intergenic
978460223 4:108943065-108943087 ATTTCTTAAAGCATGGAATAGGG + Intronic
978706098 4:111713572-111713594 CTGCATTCAGGGATGGAAAAGGG + Intergenic
978813406 4:112876135-112876157 CTGAATAAAAGCATTGAAAACGG - Intronic
979299410 4:119069584-119069606 TTGCCTAACAACATGGAAAAGGG - Intergenic
980219825 4:129900786-129900808 CTGCCTTCCAGAAGGGAAAAAGG + Intergenic
980302022 4:131007943-131007965 TTACTTTAAACCATGGAAAAAGG + Intergenic
980812488 4:137900624-137900646 CTGCCTCAATGCATAGGAAATGG - Intergenic
981097000 4:140792291-140792313 CTGTTTTAAAGTATGAAAAAGGG + Intergenic
981135097 4:141201765-141201787 CTTCCTTATAGTTTGGAAAATGG + Intronic
983679246 4:170333184-170333206 ATGGCACAAAGCATGGAAAATGG + Intergenic
985866589 5:2519135-2519157 CTGGCATTAAGCATGGAAGAGGG + Intergenic
987333296 5:16875758-16875780 CTGCCTCAAATTATGGAAACTGG + Intronic
987736279 5:21847525-21847547 CTGCCTTAGAGGAAGGAAGAAGG - Intronic
988331691 5:29849985-29850007 CTGCCTTATTGCAAGGATAAGGG + Intergenic
988392415 5:30652566-30652588 AAAACTTAAAGCATGGAAAAAGG + Intergenic
988436998 5:31188015-31188037 CAGGCTTAAAGTATAGAAAATGG - Intergenic
988724414 5:33911677-33911699 CTGCCTCACAGCATGGCAACTGG - Intergenic
990320986 5:54629544-54629566 CTGCCTTAAAGCTTCAAACAGGG - Intergenic
990518586 5:56554821-56554843 CTCCCTCAGGGCATGGAAAAAGG - Intronic
990797435 5:59560314-59560336 ATGTCTTATAGCATGTAAAAAGG + Intronic
992317289 5:75569638-75569660 CTGCCTTAAAGTATGTTGAAAGG - Intronic
993927955 5:93895153-93895175 CTGAATTAAAGCATGAAAACTGG - Intronic
994337323 5:98582852-98582874 TTGCCTTAAAGCACAGAAGAGGG - Intergenic
995430113 5:112065076-112065098 CTGCATAAAAGCAAGAAAAATGG - Intergenic
999259610 5:150229784-150229806 TTGCATAAAAGCATGGAAATAGG - Intronic
999350378 5:150864612-150864634 CTGCTTTACAGAATGGCAAATGG + Intronic
999567598 5:152882601-152882623 CTGCCTTAAAGCATTGATTTGGG + Intergenic
1005029362 6:21494499-21494521 CTGCCTTACAGCAAGGAAAGAGG - Intergenic
1005324889 6:24690370-24690392 CTGCCTTGAACCTGGGAAAAGGG - Intronic
1005498685 6:26411544-26411566 CTTCCTTTCAGAATGGAAAAAGG + Exonic
1005503443 6:26450096-26450118 CTTCCTTTCAGAATGGAAAATGG + Exonic
1005639411 6:27781842-27781864 TTTCTTTAAACCATGGAAAAAGG - Intergenic
1005652428 6:27896463-27896485 CGGGATGAAAGCATGGAAAATGG - Intergenic
1006847641 6:37073946-37073968 CTGCCTAAGAGCACAGAAAAAGG + Intergenic
1008288133 6:49679596-49679618 CTGACCTAAGGCATGGAATATGG - Intergenic
1008626137 6:53318504-53318526 CTTTTTTAAAGCATAGAAAAAGG - Intronic
1008929407 6:56922602-56922624 TTGCCTTAGAGCAAGCAAAATGG + Intronic
1009196581 6:60693881-60693903 CTTCCTTAAAGCCTGGAATGTGG + Intergenic
1011806868 6:91081927-91081949 CTTGCTAAATGCATGGAAAATGG + Intergenic
1012794692 6:103744200-103744222 CTGCCTTGAAGCCAGGAATAAGG + Intergenic
1013047397 6:106500492-106500514 CTGATTTAAAAAATGGAAAAAGG - Intergenic
1013717589 6:112981221-112981243 CTGCCTGAAAACTTGGAAAAAGG + Intergenic
1016143410 6:140641793-140641815 CAGCCTTATAGAATGTAAAATGG - Intergenic
1017394769 6:153985018-153985040 CTGGCTGAAAGCATGGAAGCTGG + Intergenic
1017409089 6:154150159-154150181 CTCCTTGAAAGCCTGGAAAATGG - Intronic
1018206995 6:161445487-161445509 CTTCCTTCAAGCTTGGAGAAAGG - Intronic
1021891456 7:25189742-25189764 TTACTTTAAACCATGGAAAAAGG + Intergenic
1022190411 7:28012300-28012322 CTGGCTTACAGCATGGTAACAGG + Intronic
1022855411 7:34309369-34309391 CTGCCTTACAGAAAGGCAAAGGG - Intergenic
1022883442 7:34616013-34616035 ATGACTTAAAAAATGGAAAAAGG + Intergenic
1023307781 7:38849376-38849398 CTGCTTTATAGCAAGGACAAAGG + Intronic
1026396191 7:69956897-69956919 CTGCATTACAGCCTGGACAATGG - Intronic
1027707637 7:81554327-81554349 TTACTTTAAACCATGGAAAAAGG - Intergenic
1029611579 7:101629430-101629452 CTGCCTTATTGCAAGGACAAAGG + Intergenic
1030199986 7:106892739-106892761 CTGCCCTAGAGGATAGAAAAGGG + Intronic
1031465592 7:122106727-122106749 CTTCCTTACAGCATATAAAATGG + Intronic
1032326323 7:130932287-130932309 CTGCCTTAAAGCATAGCTAGAGG + Intergenic
1032836004 7:135674299-135674321 TTGCTTTAAAGCAAGCAAAATGG + Exonic
1033315343 7:140292486-140292508 CTGATTTAAAGCATGGACCACGG + Intergenic
1033850004 7:145483403-145483425 TTACTTTAAACCATGGAAAAAGG + Intergenic
1033858484 7:145595102-145595124 TTGCCTTATAGCATGGAGGAAGG + Intergenic
1034215505 7:149402648-149402670 TTGCCTAACAACATGGAAAAGGG - Intergenic
1034224329 7:149471111-149471133 GAGCCTTAAAGGTTGGAAAAGGG + Intergenic
1036219536 8:6909755-6909777 TGGCCCTAAAGCCTGGAAAAGGG - Intergenic
1038851753 8:31285490-31285512 CTGGCTTAAGGCATGGAGAATGG - Intergenic
1039400986 8:37269050-37269072 CTGCCTCAGAGCAAGGGAAAGGG - Intergenic
1040574091 8:48635709-48635731 CTGGCTTAAAACAAGAAAAATGG + Intergenic
1043341463 8:79245013-79245035 AGGCCTTAAACCATGGTAAATGG + Intergenic
1044310454 8:90686507-90686529 TTACTTTAAAACATGGAAAAAGG - Intronic
1044367919 8:91371806-91371828 CTGCCCTCCACCATGGAAAACGG - Intronic
1044536157 8:93358450-93358472 CTGCCTCAAAGGATTGTAAAGGG - Intergenic
1044997646 8:97852325-97852347 CTGCCTAACAACATGGAAAAGGG + Exonic
1045200991 8:99981042-99981064 TTGCCCTTGAGCATGGAAAAAGG - Intronic
1046524565 8:115367846-115367868 CTGCCTTAGAGAATGGAAGAGGG + Intergenic
1046665241 8:116995194-116995216 TTGCTTCAAAGCAAGGAAAATGG - Intronic
1047526252 8:125636832-125636854 GTGTCTTAAAGCAAGGAAAATGG - Intergenic
1048102862 8:131373791-131373813 CTCCATTAAAACATGGGAAAAGG - Intergenic
1050369345 9:4904432-4904454 CTGCCAAAAAACCTGGAAAAGGG + Intergenic
1051961433 9:22768984-22769006 CTGACTTTAAACATGGCAAAAGG - Intergenic
1052313859 9:27096404-27096426 CTGCCTTATAGCAACGCAAATGG + Intergenic
1053358370 9:37465672-37465694 TTGCCTTACAACATGTAAAACGG + Intergenic
1055702307 9:78958571-78958593 CTGCATTTAAACAAGGAAAATGG - Intergenic
1055786075 9:79870078-79870100 CCGCCTTTAAGCCAGGAAAAGGG + Intergenic
1056454879 9:86750773-86750795 TTGCATTAACGTATGGAAAATGG - Intergenic
1056969635 9:91191624-91191646 GTGCCTTCAAGCAGGGGAAACGG - Intergenic
1060035127 9:120248768-120248790 CTGTCTTATAGAAAGGAAAATGG - Intergenic
1061175499 9:128993634-128993656 CTGCCACAGAGCATGCAAAAAGG - Exonic
1061693084 9:132350849-132350871 CTTCCTGAAAGCAGAGAAAAAGG + Intronic
1186768477 X:12794339-12794361 CTTCCTTACAGCATGGAAGCTGG + Intronic
1187680348 X:21761057-21761079 TAGCCTTAAAGTATGGAAAATGG + Intergenic
1188974110 X:36653002-36653024 CTGCCATAAACCCTGAAAAAAGG - Intergenic
1189004755 X:36984017-36984039 AGGCCTCAAGGCATGGAAAAGGG + Intergenic
1189556065 X:42146787-42146809 CTGCCTTAAAGACTGAAGAATGG + Intergenic
1189859403 X:45257751-45257773 CTGCCTCAAACCATGAAAAAGGG + Intergenic
1192795927 X:74423696-74423718 CTGCATCAAAGCAGGGAAAAAGG - Intronic
1193507937 X:82365577-82365599 TTACTTTAAACCATGGAAAAAGG + Intergenic
1193935973 X:87622317-87622339 CTGCATTAGAGCATGAAAAATGG - Exonic
1196569559 X:117249433-117249455 CTGTGTTAATGCTTGGAAAAAGG + Intergenic
1196973464 X:121134192-121134214 TTACTTTAAACCATGGAAAAAGG + Intergenic
1197655519 X:129112458-129112480 CTTCCTTACACCATTGAAAAAGG - Intergenic
1198148355 X:133882007-133882029 CTGCCTTGAAGCAACGGAAAAGG - Intronic
1198495007 X:137183534-137183556 TTGCCTTAAAGCCTCAAAAATGG - Intergenic
1199817028 X:151407505-151407527 CTACCTTAAAACATGTATAAGGG - Exonic
1201337562 Y:12896841-12896863 CTGCATTAAAGCAGAGGAAAAGG + Intergenic