ID: 1078602583

View in Genome Browser
Species Human (GRCh38)
Location 11:12746882-12746904
Sequence TGGGATGCCACAGACCAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 303}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078602583 Original CRISPR TGGGATGCCACAGACCAGGC GGG Intronic
900127554 1:1075307-1075329 TGGGACTCCACACACCAGCCTGG + Intergenic
900301296 1:1978810-1978832 AGGGAAGCCTCAGAGCAGGCCGG + Intronic
900321074 1:2084414-2084436 GGGGGTCCCAGAGACCAGGCAGG - Intronic
900704070 1:4067975-4067997 TGGGATGCCACGGGCTGGGCGGG - Intergenic
900956969 1:5892170-5892192 CTAGATGCCACAGTCCAGGCAGG - Intronic
901481525 1:9528511-9528533 TGGGAGGCCAAGGACCAGCCTGG + Intergenic
902240932 1:15088856-15088878 AGGAATGCCAGAGGCCAGGCTGG - Intronic
902504065 1:16928153-16928175 TGGCCTGCTACAGCCCAGGCAGG - Intronic
903170294 1:21548230-21548252 AGGGCTGCCACAGAGCAGCCAGG + Intronic
903184155 1:21619967-21619989 TGGGGAGCCACAGAGCTGGCTGG - Intronic
903312631 1:22471834-22471856 TGGGATACCACACACCACGTAGG + Intronic
904260880 1:29287008-29287030 TGGGATGCAGCAGCCCTGGCAGG + Intronic
904380164 1:30105180-30105202 AGGGAAGGCAAAGACCAGGCTGG - Intergenic
905892202 1:41524546-41524568 TGGGGAGCCACAGGCCAGTCTGG + Intronic
905979473 1:42210834-42210856 GGGGTTGCCACACTCCAGGCTGG - Intronic
906144997 1:43554723-43554745 TAGGAAGCCACAAACAAGGCGGG + Intronic
906778168 1:48548575-48548597 AGGGAGGCCGCAGGCCAGGCGGG - Intronic
907285478 1:53376937-53376959 GGGGATGCCACAGAGGAAGCCGG - Intergenic
907995313 1:59625435-59625457 TGAGATGCCCCAGACCTGTCAGG - Intronic
909227603 1:73045176-73045198 GGGGCTGCCACAATCCAGGCTGG - Intergenic
909492220 1:76238397-76238419 GGAGATGCCAAATACCAGGCAGG + Intronic
910982485 1:92972933-92972955 AGGCATGCCACAAGCCAGGCAGG + Intergenic
913155371 1:116092108-116092130 GGGGCTGCCACATTCCAGGCTGG + Intergenic
918042960 1:180924320-180924342 TGGGTGGCCACAGAGGAGGCAGG - Intronic
919972902 1:202592209-202592231 TGGGATGCCAGATACCAGGCTGG + Exonic
920035059 1:203060232-203060254 CAGGCTGCCACATACCAGGCAGG - Exonic
923910065 1:238431432-238431454 GGGGCTGCCACACTCCAGGCTGG - Intergenic
1063519510 10:6728162-6728184 TGGAAGCCCACAGTCCAGGCAGG - Intergenic
1063607163 10:7532909-7532931 TGGGATGCCACTGTACAGTCGGG + Intergenic
1064148146 10:12841626-12841648 TGAGATGCCACAGACAAGGTGGG - Intergenic
1064249432 10:13695710-13695732 TTGGGTTCCACAGGCCAGGCAGG - Intronic
1065429400 10:25638402-25638424 TGAGATGCCACAGGCCAGGACGG + Intergenic
1066112241 10:32207649-32207671 TGGGCTGCCACAAAGGAGGCTGG - Intergenic
1066188240 10:33031354-33031376 AGGGATGCCACAGAACAGGCAGG + Intergenic
1067739421 10:48883193-48883215 TGGGATGCAACATGCCAAGCAGG + Intronic
1068505198 10:57891593-57891615 TGGCAGGAAACAGACCAGGCAGG - Intergenic
1071880982 10:89898003-89898025 GGGGCTGCCACACTCCAGGCTGG + Intergenic
1072722904 10:97791879-97791901 TGGGAGTCCTCAGACCAGGAAGG - Intergenic
1075870822 10:125771911-125771933 TGGGATGCCACAGCACGGGTTGG + Intronic
1076112422 10:127871425-127871447 CGGGCTGCCACATTCCAGGCTGG + Intergenic
1076312025 10:129515290-129515312 TGGGAGCCCACAGTCCAGCCAGG + Intronic
1076692719 10:132231914-132231936 TGGGAAGCCTGAGACCTGGCAGG - Intronic
1077343215 11:2035235-2035257 TGGGATGCCTCTGAGCTGGCTGG - Intergenic
1077464716 11:2728229-2728251 TGGGAAGCCACAGAGAAGTCAGG - Intronic
1077517399 11:3010232-3010254 TGGCATGCCACAGCCCCGGGAGG - Intronic
1078068462 11:8093313-8093335 TGTGAGGCAACAGACCAGCCTGG + Intronic
1078602583 11:12746882-12746904 TGGGATGCCACAGACCAGGCGGG + Intronic
1079951480 11:26810319-26810341 TAGGATGCCAGAGACCTGGGAGG + Intergenic
1084191757 11:67502581-67502603 TGGGCTCCCACATCCCAGGCTGG - Exonic
1084690370 11:70721670-70721692 TGGCATGCCACAGGCAGGGCTGG + Intronic
1085379207 11:76097440-76097462 TAGTATGCCACAGTCCAGACAGG + Intronic
1085410685 11:76288672-76288694 TGGGATGACAGTGTCCAGGCTGG - Intergenic
1085530577 11:77189846-77189868 GGGGAGGCCACAGACGTGGCTGG + Intronic
1089358275 11:117869996-117870018 TGGGGCCCCACGGACCAGGCTGG - Intronic
1089358723 11:117872668-117872690 TGGGCCCCCACGGACCAGGCTGG - Intronic
1089363877 11:117909347-117909369 TGGGGGCCCACAGCCCAGGCTGG - Intronic
1089841999 11:121426630-121426652 CTGAAGGCCACAGACCAGGCAGG - Intergenic
1089883812 11:121800432-121800454 TGTGATGCCACATTCCAGGGAGG + Intergenic
1202826201 11_KI270721v1_random:90424-90446 TGGGATGCCTCTGAGCTGGCTGG - Intergenic
1091403543 12:195423-195445 TGGCATCCCACAGGCCGGGCAGG - Intronic
1092171660 12:6377151-6377173 GAGGAAGCCACAGACCAGGTTGG - Intronic
1092521675 12:9281556-9281578 TGGGCTGGCAGAGAACAGGCTGG + Intergenic
1092523440 12:9295155-9295177 TGAGAGGACACAGGCCAGGCCGG - Intergenic
1092543856 12:9436744-9436766 TGAGAGGACACAGGCCAGGCCGG + Intergenic
1092965373 12:13636310-13636332 AGGGAGGACACAGACCATGCTGG + Intronic
1093145856 12:15566334-15566356 ATAGATGCCACAGACCTGGCTGG - Intronic
1093308090 12:17544239-17544261 TGAGAGGCCTCAGAACAGGCCGG - Intergenic
1093634718 12:21451495-21451517 TGAGATGACACAGACAAAGCTGG - Intronic
1094509089 12:31085307-31085329 TGAGAGGACACAGGCCAGGCCGG - Intronic
1096973441 12:55685024-55685046 AGGGCAGCCACAGGCCAGGCTGG + Exonic
1100111684 12:91251981-91252003 TGGGATGCAACATATCAAGCTGG - Intergenic
1101080198 12:101173799-101173821 TGTGATGCCACAGACCAAGAAGG - Intronic
1101881559 12:108629323-108629345 TGGGATGGCAGGGACCAGGCTGG - Intronic
1103188592 12:118981711-118981733 TGGGACGCCCCAGCCCGGGCAGG - Exonic
1103922095 12:124404401-124404423 AGGGACGCCACAGCCCAGGTGGG - Intronic
1103950425 12:124548076-124548098 TGGGGTGCCCCAGGCCGGGCAGG + Intronic
1106086388 13:26546128-26546150 TGGGATCACAAAGACAAGGCAGG + Intergenic
1108818789 13:54320999-54321021 GGGGCTGCCACAAGCCAGGCTGG - Intergenic
1108887151 13:55200265-55200287 TGAGATGCCACTGCCCAGCCTGG - Intergenic
1108999952 13:56787116-56787138 TTGGCTGCCACAGATCATGCTGG - Intergenic
1111360372 13:87168097-87168119 TGGGCAGCCACAGGCCAGCCTGG + Intergenic
1113001345 13:105641617-105641639 TGGGAGACCACAGGGCAGGCAGG - Intergenic
1113808234 13:113122267-113122289 TGGCCTCCCACAGGCCAGGCTGG - Intergenic
1114667464 14:24387895-24387917 TGGGAAACCCCAAACCAGGCAGG - Intergenic
1115927887 14:38457291-38457313 TGGGAGGCCACAGGGCAGGTGGG - Intergenic
1116860146 14:49988608-49988630 AGGGCTGCCAGAGACCTGGCTGG + Intronic
1117495081 14:56294643-56294665 ATGGATGCCACTGCCCAGGCAGG - Intronic
1117610040 14:57473747-57473769 TGGGAAGCCACTGATAAGGCAGG - Intronic
1118051838 14:62037835-62037857 TGGGGGGCCACAAAGCAGGCAGG - Intronic
1119621642 14:76136123-76136145 AAGGATGTCACAGACCAGGCAGG + Intergenic
1119725659 14:76920519-76920541 TGCGATGCCACTGAGCTGGCTGG + Intergenic
1122386437 14:101351374-101351396 TGGGCAGCCCCAGACAAGGCAGG + Intergenic
1122404390 14:101491302-101491324 TGGGATGCCACTAAGCAGGTGGG + Intergenic
1123487551 15:20755546-20755568 TGGATCCCCACAGACCAGGCAGG + Intergenic
1123544043 15:21324604-21324626 TGGATCCCCACAGACCAGGCAGG + Intergenic
1129193848 15:73952859-73952881 TGGGATGCCACAGCCAGGGCAGG - Intergenic
1129198029 15:73982623-73982645 TGCGGTGCCACAGGACAGGCTGG + Exonic
1129252395 15:74316139-74316161 TGAAATGCCTGAGACCAGGCGGG + Intronic
1131143059 15:89993350-89993372 TGTGATGCCAGCTACCAGGCTGG + Intergenic
1131845528 15:96486946-96486968 TGGTATAGGACAGACCAGGCTGG - Intergenic
1132236107 15:100222834-100222856 TCGAATGCTACGGACCAGGCAGG + Intronic
1202952385 15_KI270727v1_random:51878-51900 TGGATCCCCACAGACCAGGCAGG + Intergenic
1132878937 16:2152794-2152816 TGGGAGGCAGCAGACCAGGCTGG - Intronic
1133295495 16:4750008-4750030 TGGGAGGCCACAGCCTCGGCAGG + Exonic
1135070725 16:19349195-19349217 TGGGCTCTCCCAGACCAGGCAGG - Intergenic
1137372723 16:47923412-47923434 TTGGATGCCAAATACCAGCCTGG - Intergenic
1138188628 16:54996368-54996390 TGGCATGACACAGACCAAGGGGG + Intergenic
1138368010 16:56499152-56499174 TGTGGTTCCACAGGCCAGGCAGG + Intronic
1141202029 16:81905490-81905512 TGGGATTCCATTGACCAGGTGGG + Exonic
1141625371 16:85258699-85258721 TGGGCGGTCACTGACCAGGCGGG - Intergenic
1142187925 16:88703313-88703335 TGAGCTGCCAGAGACCAGGCCGG + Intronic
1143852693 17:9824561-9824583 TGGGATGGCAGAGAGCAGGATGG - Intronic
1146124219 17:30219176-30219198 TGGGAGTCGACAGAACAGGCAGG + Intronic
1146937206 17:36819313-36819335 GAGAATGCCACAGAGCAGGCAGG + Intergenic
1148075974 17:44935369-44935391 TGGGAAGACACACACCATGCTGG - Exonic
1148123068 17:45223545-45223567 AGGGACGCCTCACACCAGGCTGG + Intronic
1148341800 17:46877697-46877719 GGGGGTGTCACAGACCAGGCAGG - Intronic
1148344613 17:46894979-46895001 TGGGATGCCCCAGAGCGGACAGG - Intergenic
1149995534 17:61404354-61404376 CGGGGTGCCACCGACCACGCTGG + Intronic
1151596956 17:75084011-75084033 GGGGATGTCACAGACAAGGAGGG + Intergenic
1151732687 17:75920664-75920686 TGGGAAGCCGGAGACCATGCTGG - Intronic
1152586514 17:81191808-81191830 TGGGATGTCACCGAGCAGCCAGG - Intronic
1152594930 17:81233395-81233417 TGAGATGCCAGAGCCCATGCAGG + Intronic
1152838841 17:82553356-82553378 CTGGAGGCCACAGCCCAGGCAGG + Intronic
1156890388 18:42184134-42184156 TGGGTAGCCACAGACAAGGTAGG - Intergenic
1157751251 18:50180250-50180272 TGGGAAGCCACAGCCCAGTGCGG - Intronic
1158113263 18:53965281-53965303 GGGGATGCCTCAGACAAAGCTGG - Intergenic
1160977420 19:1800185-1800207 GGGGATGGCACACAGCAGGCGGG - Intronic
1161582204 19:5087098-5087120 TGGGATGGAGCAGCCCAGGCCGG + Intronic
1162100290 19:8334920-8334942 TGGGACGCCCCAGACCCGGGAGG - Exonic
1162960103 19:14120543-14120565 TGGGAGGCCGCAGCCCAGGGAGG + Exonic
1163382396 19:16977748-16977770 TGGGCTCCTACAGAGCAGGCTGG + Intronic
1164126780 19:22325639-22325661 TCGGAGGGCAAAGACCAGGCAGG - Intergenic
1164172562 19:22738165-22738187 TCGGAGGGCAAAGACCAGGCAGG + Intergenic
1164464644 19:28476954-28476976 GGCGATGCCACAGCCCTGGCAGG + Intergenic
1165367952 19:35381168-35381190 TTGGAGGCCACAGGCAAGGCAGG + Intergenic
1166169819 19:41019747-41019769 TGGGATTCCACAGACAAGCTTGG + Intergenic
1167606818 19:50485663-50485685 TGGGAGGCCAAAGAGGAGGCTGG - Exonic
925294289 2:2767419-2767441 AGGGAGGCCACAGACCCTGCGGG + Intergenic
926054732 2:9767951-9767973 GGGGGAGCCACAGACCAGGGAGG - Intergenic
927941086 2:27103178-27103200 TGTGATGCCAGAGAGCTGGCAGG + Intronic
928480167 2:31675362-31675384 GGGGCTGCCACACTCCAGGCTGG + Intergenic
928936419 2:36683672-36683694 GGGGCTGCCACAGATCAGGACGG + Intergenic
932647029 2:73513191-73513213 TGGAATGCCAAAGCCCAAGCAGG - Intronic
933773155 2:85756205-85756227 GTGGCTGTCACAGACCAGGCTGG + Intronic
935736194 2:106108398-106108420 TGGAAGGCCTCAGACCATGCTGG - Intronic
936351638 2:111717118-111717140 CCAGATGCCAGAGACCAGGCTGG + Intergenic
936879414 2:117232210-117232232 TGGGCTGCCACACTCCAGGCTGG + Intergenic
936900951 2:117481462-117481484 GGGGGTGCCACACTCCAGGCTGG + Intergenic
937231517 2:120400749-120400771 GGGGATGCACCAGGCCAGGCAGG - Intergenic
938079530 2:128362359-128362381 TGGGAGGGCTCAGTCCAGGCAGG + Intergenic
938342429 2:130544452-130544474 AGGTATGCCACCGGCCAGGCTGG - Intronic
938347403 2:130576257-130576279 AGGTATGCCACCGGCCAGGCTGG + Intronic
938502363 2:131836679-131836701 TAGGATGGGACAGACCAGCCTGG + Intergenic
939216088 2:139240093-139240115 TAGGATGCCACAGAAAAGGAGGG + Intergenic
940303365 2:152199104-152199126 TGGGATGCCTGAGACCCGTCAGG + Intergenic
942313097 2:174673606-174673628 AAGAACGCCACAGACCAGGCAGG - Intronic
944329204 2:198445477-198445499 TGGGATACCCCAGCCCAGGGTGG + Intronic
945860493 2:215115886-215115908 TGGGATGTCAGAGACCAAGTGGG + Intronic
945989286 2:216380251-216380273 GGTGATGCTACAGAGCAGGCTGG - Intergenic
946024229 2:216662139-216662161 TGGGATGCCAGCTGCCAGGCCGG + Intronic
946524614 2:220505073-220505095 TGGGATGGGACAGAGCAGGTGGG + Intergenic
947589854 2:231379434-231379456 TGGGATGCCCGAGGCCAGGGAGG - Intergenic
947766817 2:232643243-232643265 TGGGATGCCAGAGGCCAGCTTGG - Intronic
948566396 2:238889990-238890012 TGTGAAGGCACAGGCCAGGCTGG - Intronic
948659430 2:239498032-239498054 TGGGATGCCACAGGAGAGGTCGG - Intergenic
948988550 2:241540524-241540546 TGGGAGTCCACACCCCAGGCAGG + Intergenic
1169287873 20:4324750-4324772 TGGGATGCGACAGACACTGCTGG + Intergenic
1172038883 20:32029877-32029899 TGGGATGGCATGGACCAAGCAGG - Intronic
1172105469 20:32514718-32514740 TCGGATGCCACATGTCAGGCAGG + Intronic
1173255911 20:41394287-41394309 AGTGATGCCCCAGACCAGGCAGG + Intergenic
1174413818 20:50353724-50353746 AGGGAGGTCCCAGACCAGGCAGG + Intergenic
1174558506 20:51413209-51413231 GGGGACTCCACAGGCCAGGCCGG - Intronic
1175088021 20:56477323-56477345 CGGAAGGCCGCAGACCAGGCTGG - Intronic
1175191441 20:57214646-57214668 TGGGATGCTCAAGAACAGGCAGG - Intronic
1175787597 20:61721863-61721885 AGGGATGCCACACAGCGGGCCGG - Intronic
1176166923 20:63679254-63679276 TGGGATTCCCCCGACCAGGTCGG - Intronic
1176345914 21:5746465-5746487 TGGGATTCCAGAGGCCAGTCAGG + Intergenic
1176352728 21:5867049-5867071 TGGGATTCCAGAGGCCAGTCAGG + Intergenic
1176498913 21:7577990-7578012 TGGGATTCCAGAGGCCAGTCAGG - Intergenic
1176540235 21:8144535-8144557 TGGGATTCCAGAGGCCAGTCAGG + Intergenic
1176559186 21:8327580-8327602 TGGGATTCCAGAGGCCAGTCAGG + Intergenic
1178827592 21:36029652-36029674 TGGGATGTCACAGAGGAAGCAGG - Intergenic
1179540473 21:42080173-42080195 TGGGATGCCACACAGCAGGTTGG + Intronic
1180352094 22:11814129-11814151 GTGGATGCCACAGCCCATGCTGG - Intergenic
1180353390 22:11821425-11821447 GTGGATGCCACAGCCCATGCTGG + Intergenic
1180384849 22:12170932-12170954 GTGGATGCCACAGCCCATGCTGG - Intergenic
1180386114 22:12177937-12177959 GTGGATGCCACAGCCCATGCTGG + Intergenic
1180772478 22:18400652-18400674 TGGGCTTCCAAAGACAAGGCTGG + Intergenic
1180904294 22:19397757-19397779 TGGCATGCCACAGATCAGGAGGG - Intronic
1181033375 22:20158606-20158628 TGGGAAGTCAGGGACCAGGCGGG + Intergenic
1181341300 22:22182147-22182169 TGGGGAGCCTCAGGCCAGGCTGG + Intergenic
1182380593 22:29883752-29883774 TGGACCGCCACAGACCCGGCAGG - Intronic
1182680921 22:32079269-32079291 TGGCATGCCAAAGGCCAGGCTGG - Intronic
1203234318 22_KI270731v1_random:141640-141662 TGGGCTTCCAAAGACAAGGCTGG + Intergenic
1203245179 22_KI270733v1_random:60902-60924 TGGGATTCCAGAGGCCAGTCAGG + Intergenic
950679559 3:14575644-14575666 TGGAATCCCACAGCCGAGGCTGG + Intergenic
951405820 3:22296238-22296260 TGGGATTCTACAGTTCAGGCAGG + Intronic
952192906 3:31042807-31042829 TGGGATTCAAATGACCAGGCGGG + Intergenic
952404464 3:32993028-32993050 TGTGCTACCACAGACCAGTCAGG + Intergenic
953791113 3:45949081-45949103 TGGTATGCCACACACCTGGAAGG - Intronic
954077951 3:48194975-48194997 GAGGCTGCCACAGGCCAGGCTGG - Intergenic
954219576 3:49144807-49144829 TGAGATGCTGCAGAACAGGCAGG + Intergenic
955548469 3:60057328-60057350 TCTGAAGCAACAGACCAGGCAGG - Intronic
958963011 3:100528333-100528355 TGGGCTGCCACTGCCCAGGTTGG - Intronic
958970528 3:100605744-100605766 TGAGATGCCAGAGCCCAGGCAGG - Intergenic
959132149 3:102369358-102369380 TGGGATGCCACAGAGGGGGCAGG + Intronic
961486570 3:127221417-127221439 TGGGATGCCAGACTCCAGCCAGG - Intergenic
961796489 3:129412600-129412622 TGGTATGCCATGGACCAGGTGGG - Intronic
962841681 3:139238424-139238446 GGAGCTGCCACAGAGCAGGCTGG - Intronic
963854895 3:150243352-150243374 TGTGATGCCACCCAGCAGGCAGG + Intergenic
963936422 3:151058641-151058663 TGGGAGGCCACAGCCAATGCTGG + Intergenic
964347805 3:155771831-155771853 TGGGATGACACAGTACATGCTGG + Intronic
964525212 3:157609996-157610018 TGGCATGCCAGAGACCAGAGTGG - Intronic
964546553 3:157840108-157840130 TAGAATGCCAGAGACAAGGCTGG + Intergenic
965496482 3:169404721-169404743 TGGGGAGCCAAATACCAGGCCGG - Intronic
965794746 3:172428121-172428143 TGTCATGCCCCAGACCAGCCTGG + Intergenic
965975268 3:174613335-174613357 AGGGATGACACAGGCCTGGCTGG - Intronic
967446588 3:189574122-189574144 TGGAATCCCACAGACTAGGATGG - Intergenic
968123843 3:196144217-196144239 TGGGAGGCCGGAGACCAGGGAGG - Intergenic
969180292 4:5435418-5435440 TGGGACGACACAGAAAAGGCTGG - Intronic
969367219 4:6703471-6703493 TGGGAGGTCAGAGCCCAGGCAGG - Intergenic
969439503 4:7208866-7208888 TGGCGTCACACAGACCAGGCTGG - Intronic
969465731 4:7355273-7355295 TGGGATGCCATAAACCCGGAAGG - Intronic
969627827 4:8316652-8316674 TGGGAGGCCTCATCCCAGGCGGG - Intergenic
969682769 4:8652410-8652432 TGGGAAGCCACTGGCCATGCTGG - Intergenic
969855297 4:9994283-9994305 TGGGATGTCAAGGACAAGGCAGG + Intronic
971721913 4:30255842-30255864 TGGGCTGTCACACTCCAGGCTGG + Intergenic
972783088 4:42302581-42302603 ATGGAAGCCAAAGACCAGGCAGG + Intergenic
973550393 4:52029259-52029281 TGGGATGCCACTGACTAGATTGG + Intronic
974856323 4:67465795-67465817 GGGGCTGCCACACTCCAGGCTGG - Intergenic
976341235 4:83947366-83947388 TGGAATACCAATGACCAGGCTGG - Intergenic
977670840 4:99693239-99693261 TGGGAAGGAACAGAACAGGCAGG - Intergenic
979664275 4:123293522-123293544 GGGGCTGCCACAATCCAGGCTGG + Intronic
980958588 4:139453375-139453397 TGGGCTGCCGGAGAGCAGGCTGG - Intronic
981139713 4:141254172-141254194 TGGGCTGCCACATTCCAGGCTGG + Intergenic
982653951 4:158122448-158122470 TGGGAGACCACAGACCTGGGAGG + Intergenic
985576556 5:675913-675935 TGGGAAGCCACAGAGGAGGTTGG + Intronic
987121636 5:14773391-14773413 GTGGATGCCTCAGCCCAGGCTGG - Intronic
987450325 5:18075876-18075898 TTGGATTCCACAGACCACACAGG + Intergenic
989365762 5:40653410-40653432 GGGGCTGCCACACTCCAGGCTGG - Intergenic
990118918 5:52424970-52424992 AGGGATAGCACAGAACAGGCTGG + Intergenic
991963136 5:72065470-72065492 TTGGATGACAGAGCCCAGGCTGG - Intergenic
994208523 5:97062264-97062286 GGGGGTGACACAGACCTGGCAGG + Intergenic
994496340 5:100517857-100517879 GGGGCTGCCACACTCCAGGCTGG - Intergenic
995024617 5:107405230-107405252 TGTGATGCCTCAGCCCTGGCCGG + Intronic
995186966 5:109281643-109281665 AGGGCTGCCACACTCCAGGCTGG - Intergenic
995774162 5:115707645-115707667 AGGGAGTCCACAGACCTGGCTGG + Intergenic
998006606 5:138661385-138661407 TGGGAGGCCACAGACTGGGCTGG + Intronic
998454251 5:142258710-142258732 AGGGATGCCACAGACCAGGGAGG + Intergenic
1000172314 5:158714116-158714138 TGGGATGCCACACAACAACCAGG - Exonic
1001751051 5:174131727-174131749 TGGGAAGCCACAGGCCTGGGAGG + Intronic
1003012932 6:2443075-2443097 TGTGCTGCCACACTCCAGGCTGG - Intergenic
1003254786 6:4465525-4465547 GGGGATGCCACAGAGCAGCAAGG - Intergenic
1003483808 6:6557107-6557129 TGGGAAGCTGCAGACCAGCCAGG + Intergenic
1005861961 6:29908572-29908594 TGGGGTGCCAGGGACCAGGAGGG + Intergenic
1006075348 6:31529069-31529091 TGGGGTGCCAAGGACCAGGAGGG - Exonic
1006147677 6:31969113-31969135 AGGAATGCCACAGCCCTGGCAGG - Intronic
1007219080 6:40264398-40264420 TGGGCTTGCACAGACCAGGTTGG + Intergenic
1008705813 6:54157556-54157578 GGGGATGCCACAAAACATGCAGG - Intronic
1011518296 6:88176516-88176538 TTTGATGACACAGAGCAGGCTGG - Intergenic
1012829587 6:104187828-104187850 AGGGCTGCCACATTCCAGGCTGG - Intergenic
1013495052 6:110689802-110689824 GGGGCTGCCACACTCCAGGCTGG - Intronic
1014348049 6:120300587-120300609 TGGGAAGCCAAAGACCAGCAAGG - Intergenic
1016498304 6:144689586-144689608 TGGACTGCCACAGTCCAGGCTGG + Intronic
1016532252 6:145071739-145071761 TGGGGTGGGACAGAGCAGGCTGG + Intergenic
1017816840 6:158022269-158022291 GGGATTGGCACAGACCAGGCTGG + Intronic
1018062501 6:160102002-160102024 GGGGCGGCCACAGACCAGGGTGG - Intronic
1018688020 6:166318681-166318703 TGGAATGCCACAGAAGAAGCAGG - Intergenic
1019184186 6:170211559-170211581 TTGGAAGCCAGAGACCAGGTTGG + Intergenic
1019267026 7:123436-123458 TGAGATGCCTCAGACCTGGGTGG + Intergenic
1020261952 7:6535812-6535834 TTGGATGCCATAGGCCAGGGCGG + Intronic
1021101960 7:16594503-16594525 TGGAAATCCACAGAACAGGCTGG + Intergenic
1021822990 7:24516533-24516555 AGGGAAGCCAAAGACCATGCAGG - Intergenic
1023530935 7:41153491-41153513 AGGGATGCCATAGACCAGACAGG + Intergenic
1023938342 7:44755297-44755319 TGGGCACCCACAGACCTGGCAGG - Intronic
1024119758 7:46225031-46225053 TGGGATTCCACAGCCCAGTGTGG + Intergenic
1025256718 7:57388847-57388869 AGGGAGGTCCCAGACCAGGCAGG - Intergenic
1026133260 7:67637323-67637345 AGAGAAGCCACAGAGCAGGCTGG - Intergenic
1029210596 7:98905195-98905217 GAGGATGCAACAGGCCAGGCAGG - Intronic
1029319770 7:99748511-99748533 TGGGGTGTCACAGTGCAGGCAGG - Intergenic
1029691816 7:102187530-102187552 TGGCATGGCACAGACCAAGAAGG - Intronic
1032335531 7:131021365-131021387 TTGGAGGCCAAGGACCAGGCAGG + Intergenic
1034202659 7:149292231-149292253 CTGGCTGCCACACACCAGGCTGG - Intronic
1034437996 7:151072226-151072248 GGGGATGCTCCAGACCAGCCTGG - Intronic
1034892498 7:154853613-154853635 TGGGATGGCAGAGGCCAGGCCGG - Intronic
1036272666 8:7321660-7321682 GGGGATGCCGCACACCAGGCTGG - Intergenic
1036348682 8:7988684-7988706 GGGGATGCCGCACACCAGGCTGG + Intergenic
1036434367 8:8719793-8719815 TGGGATGCCACATGTCAAGCTGG + Intergenic
1036843949 8:12149156-12149178 GGGGCTGCCGCACACCAGGCTGG + Intergenic
1041785063 8:61622660-61622682 AGGGAGGCCAAAGAGCAGGCAGG - Intronic
1045026192 8:98089291-98089313 AGGGATGCCACAGACCAATCAGG + Exonic
1045103148 8:98865575-98865597 TGGGAGGACAAAGACCAGCCTGG - Intronic
1045252194 8:100491519-100491541 TGGGCTGTCACAGCACAGGCAGG + Intergenic
1046241841 8:111506893-111506915 TGGGATTCCAAAGGCCTGGCGGG - Intergenic
1047770272 8:128025133-128025155 TGGGCTGGCGCAGGCCAGGCAGG + Intergenic
1049536949 8:143186806-143186828 TGGGAGGGCACAGACCAGCTGGG - Intergenic
1049573584 8:143380551-143380573 TGGGATGTCACACACCATGTGGG - Intronic
1051434130 9:17013011-17013033 AGGGATGCAAAAGACAAGGCTGG - Intergenic
1052751929 9:32500804-32500826 TTGGATGCCCTAGACCATGCAGG - Exonic
1053106776 9:35416296-35416318 GGGGCTGCCACACTCCAGGCTGG - Intergenic
1055335398 9:75228469-75228491 TGAGATGCCAAAAACCAGTCTGG + Intergenic
1056151525 9:83794958-83794980 TGGGATTTTACAGGCCAGGCTGG - Intronic
1056556695 9:87695417-87695439 TGGGCGGCCACAGTCCTGGCAGG + Intronic
1058272174 9:102986220-102986242 GGGGCTGCCACACCCCAGGCTGG - Intergenic
1059326121 9:113504970-113504992 TGGGAGGGCAGTGACCAGGCTGG + Intronic
1061009454 9:127946440-127946462 TGGGGTGTCACAGGCCAGCCTGG - Intronic
1062697198 9:137881454-137881476 TGGGCTGCCACAGAGCTGCCAGG - Intronic
1203461513 Un_GL000220v1:43971-43993 TGGGATTCCAGAGGCCAGTCAGG + Intergenic
1185445953 X:258143-258165 GGGGATTCCACAGACCATCCCGG + Intergenic
1187464933 X:19518708-19518730 TGAGAACACACAGACCAGGCTGG + Intergenic
1188263280 X:28041691-28041713 TGGGGTGCCAGTGTCCAGGCAGG + Intergenic
1189295467 X:39914667-39914689 TGGGCTGCCACACACCTTGCTGG - Intergenic
1189731312 X:44023711-44023733 AGGGATGCAGCAGACAAGGCTGG + Intergenic
1190177034 X:48158809-48158831 TGGGATGCCACAGAGAGAGCTGG - Intergenic
1193528798 X:82627646-82627668 TGGAAAGACACAGGCCAGGCTGG + Intergenic
1195349077 X:103979982-103980004 TGGGCTGCAGCAGCCCAGGCTGG - Intergenic
1195352649 X:104009487-104009509 TGGGCTGCAGCAGCCCAGGCTGG + Intergenic
1195356445 X:104044075-104044097 TGGGCTGCAGCAGCCCAGGCTGG - Intergenic
1195358366 X:104058857-104058879 TGGGCTGCAGCAGCCCAGGCTGG + Intergenic
1195728669 X:107943223-107943245 TGAGATGTCAGAGAGCAGGCAGG - Intergenic
1197009717 X:121545867-121545889 GGGGCTGCCACACTCCAGGCTGG - Intergenic
1198228542 X:134668923-134668945 TGGGTGGCAACAGAGCAGGCAGG + Intronic
1199065929 X:143418131-143418153 AGGGCTGCCACATTCCAGGCTGG + Intergenic
1200116595 X:153772280-153772302 TGGGAGGCCACTGACCTGGTAGG - Exonic
1200120685 X:153788897-153788919 GTGGATGGCACAGCCCAGGCAGG - Intronic
1200708117 Y:6460146-6460168 TGTAATGCCACAGACCAAGAAGG + Intergenic
1200930025 Y:8688571-8688593 AGGGATTCCACAGAAAAGGCAGG + Intergenic
1200936658 Y:8744273-8744295 TTGGATCCCACAGAGCAGACAGG + Intergenic
1201025995 Y:9704562-9704584 TGTAATGCCACAGACCAAGAAGG - Intergenic
1201343535 Y:12958492-12958514 TGGGCTGCCACACTCCAGCCTGG + Intergenic