ID: 1078603828

View in Genome Browser
Species Human (GRCh38)
Location 11:12757551-12757573
Sequence TTCGTTATTTACACTGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 2, 1: 0, 2: 1, 3: 14, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078603823_1078603828 18 Left 1078603823 11:12757510-12757532 CCAATAATTGTGATTAAGAAATT 0: 1
1: 0
2: 1
3: 55
4: 451
Right 1078603828 11:12757551-12757573 TTCGTTATTTACACTGTGCCTGG 0: 2
1: 0
2: 1
3: 14
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078603828 Original CRISPR TTCGTTATTTACACTGTGCC TGG Intronic
906850694 1:49246844-49246866 TTTGTTTTTTTCACTGTCCCTGG - Intronic
908339737 1:63164448-63164470 TTCAATATTTACTATGTGCCAGG - Intergenic
908631243 1:66110512-66110534 TTTGGTATTTACTATGTGCCAGG - Intronic
910066475 1:83158487-83158509 TTTTGTATTTACACTGTGCATGG - Intergenic
911346835 1:96707051-96707073 TTGGTTATTTATTTTGTGCCAGG - Intergenic
914900937 1:151710684-151710706 TTCGCAATTTACCCTGTGCACGG + Intronic
918987093 1:191645804-191645826 TTCTTTGTTTACTATGTGCCAGG + Intergenic
919494577 1:198248567-198248589 TTTGATATTTACCATGTGCCAGG - Intronic
920538758 1:206761185-206761207 TTAAGTATTTACTCTGTGCCGGG + Intergenic
920574333 1:207046860-207046882 TGAGTAATTTATACTGTGCCAGG - Exonic
921828806 1:219703749-219703771 TTAGTTAGTTACAATGTACCAGG - Intronic
922095195 1:222437267-222437289 TTCTTTCTTTACACAGTGCCTGG - Intergenic
1065061768 10:21909539-21909561 TGCATTATTTACTTTGTGCCGGG - Intronic
1065685812 10:28283434-28283456 TTGGTTCTTTACAGTATGCCAGG - Intronic
1069480648 10:68778686-68778708 TTAATTATTTAGACTGTTCCAGG - Intronic
1070275691 10:75004486-75004508 TGCTTTAAATACACTGTGCCAGG + Intronic
1070528287 10:77313716-77313738 TTCATTACTTACCATGTGCCAGG - Intronic
1070994775 10:80767782-80767804 TATGTCATTTACTCTGTGCCAGG - Intergenic
1072048086 10:91677105-91677127 TTTATTATTTACTCTGTGCCAGG + Intergenic
1072172168 10:92875110-92875132 ATCTTTATTTAGGCTGTGCCTGG - Intronic
1073335778 10:102707555-102707577 TTTGTTATTCACATTGTACCAGG + Intronic
1073693451 10:105837329-105837351 TTCTGTATTTACTATGTGCCAGG - Intergenic
1073770062 10:106726198-106726220 TTTTTTTTTTACACTGTGACAGG + Intronic
1074086153 10:110210075-110210097 CTCGTTGTTTACCCCGTGCCGGG + Intronic
1078603828 11:12757551-12757573 TTCGTTATTTACACTGTGCCTGG + Intronic
1080710074 11:34738190-34738212 TTGTTTATTTACACTGTGAGGGG - Intergenic
1080809018 11:35683937-35683959 TTTTTTATTTACCATGTGCCAGG + Intronic
1082991067 11:59207497-59207519 TTCCTTTCTAACACTGTGCCCGG + Exonic
1087585933 11:100121672-100121694 TTCAGTATTTACCATGTGCCAGG + Intronic
1088236581 11:107731566-107731588 TTCATTATATACCCAGTGCCTGG + Intergenic
1089543504 11:119205706-119205728 TTGTTTATTTACACTGTGGGAGG - Intergenic
1089991389 11:122864407-122864429 TTGGGCATTTACTCTGTGCCTGG - Intronic
1094150426 12:27276520-27276542 TTTGTTATTTAAATTGTGCAAGG + Intronic
1095201838 12:39393771-39393793 TTGGACATTTACAATGTGCCTGG + Intronic
1096421393 12:51461336-51461358 TTGAATATTTACTCTGTGCCAGG + Intronic
1097288462 12:57895241-57895263 TTTGTTATTTAGGGTGTGCCTGG - Intergenic
1097589236 12:61553272-61553294 TTAGTTATTTACAGTGTTTCAGG - Intergenic
1098973834 12:76881357-76881379 TTCAGTATTTACCATGTGCCAGG - Intergenic
1100021983 12:90080260-90080282 TTGGGTACTTATACTGTGCCAGG - Intergenic
1102418081 12:112781729-112781751 TTTGGTATTTATTCTGTGCCAGG + Intronic
1102559153 12:113749726-113749748 TTCATCACTTACTCTGTGCCAGG + Intergenic
1102809101 12:115808653-115808675 TTCATTGTTTACAGTGTACCAGG - Intergenic
1103064192 12:117883364-117883386 TTCGTCATCTACTATGTGCCAGG - Intronic
1103204076 12:119114620-119114642 TTAGTCATTTACCATGTGCCAGG - Intronic
1103865621 12:124049652-124049674 TTAGCTATTGACTCTGTGCCAGG - Intronic
1107383234 13:39878763-39878785 TTAGTGTTTAACACTGTGCCTGG - Intergenic
1110125370 13:71935612-71935634 TTGTGTATTTACCCTGTGCCAGG - Intergenic
1112241163 13:97682990-97683012 TTTGGTGTTTACACAGTGCCAGG - Intergenic
1118893739 14:69929311-69929333 TTGAGTATTTACAGTGTGCCAGG + Intronic
1119040602 14:71270960-71270982 TTCCTTATTTTCAGTGTGGCAGG + Intergenic
1119958932 14:78832893-78832915 TTTGTATTTTACACAGTGCCTGG - Intronic
1120371143 14:83637855-83637877 TTGGTTATTTAAATTGTGCTAGG - Intergenic
1120380462 14:83772110-83772132 TTTGTATTTTAAACTGTGCCTGG - Intergenic
1120700709 14:87696031-87696053 TTAGCTATTTACACAATGCCTGG - Intergenic
1120721603 14:87895055-87895077 TGCTTAATTTACACTCTGCCCGG + Intronic
1127328879 15:57919889-57919911 TTCCTTATTTACTGTGTACCAGG + Intergenic
1127920274 15:63488899-63488921 TTCGTCATTTACACTTTACATGG + Intergenic
1128706317 15:69839756-69839778 ACCAGTATTTACACTGTGCCAGG + Intergenic
1130149680 15:81301923-81301945 TTCATTATTTCCACTGTGCATGG + Intronic
1139120350 16:64009017-64009039 TTCGTTATTTACACTGTGCCAGG + Intergenic
1140342711 16:74180843-74180865 CTTGTTATGTAAACTGTGCCAGG + Intergenic
1143821606 17:9568915-9568937 AGCGTTATTTACCATGTGCCAGG + Intronic
1145793856 17:27644432-27644454 TTGTTCATTTGCACTGTGCCTGG + Intronic
1146198220 17:30831352-30831374 TTCTTTTTTTTCACTGTCCCAGG - Intergenic
1148906674 17:50916853-50916875 TTCTTTATTTCCTCTGGGCCTGG + Intergenic
1150758343 17:67936755-67936777 TTCATCATTGACTCTGTGCCAGG + Intronic
1151620989 17:75244860-75244882 TTGCTTAATTACACTGTCCCCGG - Intronic
1155062822 18:22243675-22243697 TTATTTATTTACCCTGTGCTTGG - Intergenic
1155421021 18:25655904-25655926 TTGATTATTTACCATGTGCCAGG - Intergenic
1160568125 18:79799127-79799149 TCCATTATTTACAATCTGCCCGG - Intergenic
1163137988 19:15326985-15327007 TTGGTTTTTTACATTGTGCATGG - Intronic
1164821818 19:31256632-31256654 TTGGTTATCTACCATGTGCCAGG + Intergenic
1165993874 19:39831440-39831462 TTGGGTATTTACTATGTGCCAGG + Intronic
1167411211 19:49344965-49344987 TTAGTTGCTAACACTGTGCCAGG + Intronic
925558188 2:5155087-5155109 TTTCTTATTTAGACTGTGCAAGG - Intergenic
926624512 2:15079856-15079878 TTAGTTATGTACTCTGTGCCTGG - Intergenic
927532239 2:23817648-23817670 TTCTTTGTTTACCCTATGCCAGG - Intronic
927864650 2:26580707-26580729 TTTCTTATTTACACTGTCCTGGG - Intergenic
928063932 2:28144172-28144194 TCAGGTATTTACAATGTGCCTGG - Intronic
928233243 2:29518146-29518168 TGCGTTATTTAAAATGGGCCTGG - Intronic
928576701 2:32662961-32662983 TTCTTTGTTTACACTGTGTGGGG + Intronic
930054224 2:47239679-47239701 TTCTTTTTTAACACTGTGGCAGG - Intergenic
932529628 2:72515118-72515140 TTCTTTATTTACAGGGTGCCCGG - Exonic
935492499 2:103737193-103737215 TTCATTACTTACAGTGTACCTGG + Intergenic
935646148 2:105336937-105336959 TTAGACATTTACAGTGTGCCAGG - Intergenic
936066744 2:109338163-109338185 TTTGGTACTTACAGTGTGCCAGG + Intronic
942533940 2:176943330-176943352 ATGGATATTTACAATGTGCCTGG + Intergenic
943626430 2:190206329-190206351 TTCTTTGTTTACACTGTCCACGG - Intronic
946620826 2:221560835-221560857 TATATTATTTCCACTGTGCCTGG + Intronic
947315058 2:228848285-228848307 TTCCTTATTTACTCTTTGCTAGG + Intergenic
948314710 2:237018760-237018782 TGTGTTATTTATACTGTGCATGG - Intergenic
1169699450 20:8430102-8430124 GGGGTTATTTACACTGTGACTGG + Intronic
1169898655 20:10531505-10531527 TTCCTTATTTCCCATGTGCCAGG + Intronic
1171297439 20:24030781-24030803 TTCGTTGTAGACACTGTGCTAGG + Intergenic
1172553422 20:35819888-35819910 TGAGTGATTTACTCTGTGCCAGG + Intronic
1173298065 20:41776930-41776952 TTGGGCATTTACTCTGTGCCAGG + Intergenic
1173441235 20:43078147-43078169 TTGGTCATTTACTCTGTGCCAGG - Intronic
1174558119 20:51411036-51411058 CTGGGTATTTACTCTGTGCCAGG + Intronic
1178013127 21:28310148-28310170 CTCGTTATTTTCACTTTTCCAGG - Intergenic
1178158333 21:29881095-29881117 TTGATTATTTACAGTGTGCCAGG - Intronic
1181868905 22:25882225-25882247 TTCTTTATCTATCCTGTGCCAGG - Intronic
1182255180 22:29032740-29032762 TTGGCCATTTACCCTGTGCCAGG + Intronic
1183238943 22:36641316-36641338 TTGGCTATCTACACTGAGCCAGG - Intronic
1184352554 22:43954262-43954284 TTCGATGTTTACAGAGTGCCAGG + Intronic
949672818 3:6419148-6419170 TTGAGTATTTACAATGTGCCAGG - Intergenic
952176436 3:30868610-30868632 TGAGTTCTTTACACTGTCCCTGG - Intronic
953343789 3:42158270-42158292 TCCTTTATATACACTGTGGCCGG + Intronic
958866172 3:99504169-99504191 TTGTATATTTATACTGTGCCAGG + Intergenic
959804416 3:110533663-110533685 TTCATTAATAACCCTGTGCCAGG - Intergenic
961434680 3:126908758-126908780 TTGAATATTTACTCTGTGCCAGG + Intronic
961686846 3:128639099-128639121 TTCGTTATTTACATTGTACATGG - Intronic
962207134 3:133444289-133444311 TGCAATATTTACTCTGTGCCAGG + Intronic
963499769 3:146111511-146111533 TTCAGTGTTTACAGTGTGCCAGG - Intronic
965815676 3:172634216-172634238 TTTATTATTTATACAGTGCCTGG - Intronic
967124658 3:186412993-186413015 TTTATTGTTTACCCTGTGCCAGG + Intergenic
968329361 3:197852495-197852517 TTTGTTATTTGCAGTGTTCCAGG + Intronic
968969534 4:3786390-3786412 TTCTGCATTTTCACTGTGCCAGG + Intergenic
969116916 4:4876126-4876148 TTCGTAAGTGACACTGTGCTGGG + Intergenic
972597263 4:40540825-40540847 TTCATTATTTACATTTTGCCAGG + Intronic
973808588 4:54548772-54548794 TTCTCTATCTACACTGTCCCAGG - Intergenic
974791574 4:66696778-66696800 CATGTTAGTTACACTGTGCCTGG - Intergenic
975006370 4:69292799-69292821 TCCGTTATTTCCACTATGGCTGG - Intronic
975041129 4:69744980-69745002 TTCATTATTTACATTGTTTCAGG + Intronic
975582736 4:75921466-75921488 TTGAATATCTACACTGTGCCAGG + Intronic
975914017 4:79301169-79301191 TTCGGTACTTACTCTGTGGCAGG - Intronic
981434709 4:144706971-144706993 TTCCTTATTTACTATGTGCCAGG + Intronic
983152642 4:164303555-164303577 TAATTTATTTACTCTGTGCCAGG - Intronic
983970125 4:173861295-173861317 TTCATCATTTACTATGTGCCAGG - Intergenic
985377571 4:189357211-189357233 TTGGTTATTTACTATATGCCAGG - Intergenic
988229879 5:28462564-28462586 TTCCTTAGTTACACAGTACCTGG + Intergenic
988389217 5:30605812-30605834 GTCAATATTTACTCTGTGCCTGG + Intergenic
988994128 5:36698029-36698051 TTATTTTTTTACTCTGTGCCAGG - Intergenic
990771064 5:59245843-59245865 TTCCATTTTTACAATGTGCCTGG - Intronic
993870763 5:93251610-93251632 TTCATTATTTACACTCTGATGGG - Intergenic
993944568 5:94101997-94102019 TTCATTATTTACACTATGACGGG - Intronic
995211866 5:109549926-109549948 TTGGTTATTTACATTGTGATGGG - Intergenic
998417091 5:141953917-141953939 TCAGATATTTTCACTGTGCCAGG - Intronic
998814701 5:146001572-146001594 TTTATTATTTACTTTGTGCCAGG + Intronic
1000872765 5:166597991-166598013 TTGGATATTTACATTGTTCCAGG + Intergenic
1001751342 5:174133883-174133905 TTGGGTATCTACAGTGTGCCAGG + Intronic
1002503721 5:179664628-179664650 TTCCTTCTTTCCACTGTTCCTGG + Intergenic
1006576685 6:35051600-35051622 TTCTCTATTTACCATGTGCCAGG + Intronic
1006618718 6:35347451-35347473 TTCATTATCTCCTCTGTGCCAGG - Intronic
1008653493 6:53587442-53587464 ATTGTTATTTTCACTTTGCCAGG + Intronic
1009641204 6:66339270-66339292 TTCTTTATTTACACTGTTTTAGG - Intergenic
1009885353 6:69618029-69618051 TTCGTTGTTAAAACTGTGCTGGG - Intergenic
1011181230 6:84623414-84623436 TTTGACATCTACACTGTGCCAGG + Intergenic
1011417332 6:87136376-87136398 TTCTTTATTTGCAGAGTGCCTGG + Intergenic
1011547153 6:88493899-88493921 TTCTTTATTTAGACTGTGAAGGG - Intergenic
1012438330 6:99238393-99238415 TTCTTTGTCTACACTGTGCCAGG + Intergenic
1014238974 6:118993564-118993586 TTAATCATTTACCCTGTGCCAGG - Intronic
1014267099 6:119291851-119291873 TTTATTATTTACAACGTGCCAGG + Intronic
1018990068 6:168667810-168667832 TTGCTTATTTAAACTGTGCAAGG + Exonic
1019055732 6:169222032-169222054 TTTATTATAGACACTGTGCCTGG - Intronic
1021502313 7:21345089-21345111 TGCTTTATTTACACTGTGAGGGG + Intergenic
1021502407 7:21345679-21345701 CTCTTTATTTACACTGTGGGGGG - Intergenic
1022245447 7:28554648-28554670 TTGGTTACAGACACTGTGCCTGG + Intronic
1022516330 7:30977117-30977139 TTCATTACTTACTATGTGCCAGG - Intronic
1022972096 7:35527877-35527899 TTCATCATTGACCCTGTGCCTGG + Intergenic
1022979473 7:35590777-35590799 TTTGTAATATACACTGTCCCAGG - Intergenic
1024991756 7:55240214-55240236 TTCGTGATTTACCCTGTTTCAGG - Intronic
1025899305 7:65731193-65731215 ATCGTTATTAACAATGTACCTGG + Intergenic
1026738668 7:72964993-72965015 TTGGACATTTACAATGTGCCAGG + Intronic
1026789682 7:73323636-73323658 TTGGACATTTACAATGTGCCAGG + Intronic
1027105066 7:75400076-75400098 TTGGACATTTACAATGTGCCAGG - Intronic
1027243145 7:76346466-76346488 TTCTTTGCTTACACTGTGCCAGG + Intronic
1031842268 7:126758235-126758257 TTGCATATTTACACTGTGCCAGG + Intronic
1033445365 7:141416820-141416842 CTCGTTATGTACTCTGTGTCTGG - Intronic
1034590860 7:152137825-152137847 TTGGTTACTGGCACTGTGCCAGG + Intronic
1035658076 8:1326316-1326338 TTCAATATTTCCACTGTTCCAGG - Intergenic
1038402961 8:27299393-27299415 TTCAGTACTTACTCTGTGCCAGG + Intronic
1038936438 8:32257068-32257090 TGCTTTATTTACACTGTGAGGGG + Intronic
1039445924 8:37632043-37632065 TTCTTTATATACACTGTGGGTGG + Intergenic
1042210410 8:66375052-66375074 TATGTTATTAACACTGTGCTGGG - Intergenic
1043956325 8:86363848-86363870 TTAGGTATTTATTCTGTGCCAGG + Intronic
1046107734 8:109686568-109686590 TTCTTGATTTAACCTGTGCCTGG - Intronic
1047515606 8:125552242-125552264 TTTGTTATTTACTATGTGTCAGG + Intergenic
1047574418 8:126137275-126137297 TTCGTTTTTCACCCTGTGGCTGG + Intergenic
1047803039 8:128330107-128330129 TTCTTTACTTATACTCTGCCTGG + Intergenic
1049333165 8:142065882-142065904 TTCGTTATATGAACTGTTCCTGG + Intergenic
1051027372 9:12629457-12629479 TTTGTTATTTATATTTTGCCTGG + Intergenic
1051998480 9:23248092-23248114 GTCTTTGTTTACACTGTGACGGG - Intergenic
1056919237 9:90771668-90771690 TTGGTTATTTACAATGTGCCAGG - Intergenic
1059623769 9:116038606-116038628 TTCTATATTTACTTTGTGCCAGG + Intergenic
1059901486 9:118931972-118931994 TTTGTTACTTACTCTGTGCTAGG + Intergenic
1060293587 9:122327117-122327139 TTTGGTGTTTACAATGTGCCAGG - Intergenic
1187535061 X:20134028-20134050 TTCGTTATTTTAAATGTGACGGG - Intronic
1189901759 X:45713674-45713696 TTGGATATTTACTATGTGCCAGG - Intergenic
1192032509 X:67529134-67529156 TACCTTACCTACACTGTGCCTGG - Intergenic
1195727705 X:107935307-107935329 TTGGTTGCTTACAGTGTGCCTGG + Intergenic
1195964757 X:110419865-110419887 TTGGGTATTTACTATGTGCCAGG + Intronic
1196670712 X:118364579-118364601 TTGGTTATCTACCATGTGCCAGG - Intronic
1196886116 X:120247161-120247183 TTTAGTATTTACTCTGTGCCAGG - Intergenic
1197080469 X:122407604-122407626 TTTGGTATTTACTATGTGCCTGG - Intergenic
1198703910 X:139426609-139426631 TTGGTTACTTACTGTGTGCCTGG + Intergenic
1199780136 X:151050997-151051019 TTAGGTATTCACTCTGTGCCAGG - Intergenic
1200825432 Y:7633917-7633939 TTCCTTATAGACACTGTGCAAGG + Intergenic
1202234626 Y:22697170-22697192 TTCCTTATAGACACTGTGCAAGG - Intergenic
1202308533 Y:23498998-23499020 TTCCTTATAGACACTGTGCAAGG + Intergenic
1202562268 Y:26171588-26171610 TTCCTTATAGACACTGTGCAAGG - Intergenic