ID: 1078604766

View in Genome Browser
Species Human (GRCh38)
Location 11:12765292-12765314
Sequence CCTTTTGGGAAGCAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 289}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078604758_1078604766 21 Left 1078604758 11:12765248-12765270 CCATAAATGCTTCCAGCTGCAGA 0: 1
1: 0
2: 2
3: 16
4: 174
Right 1078604766 11:12765292-12765314 CCTTTTGGGAAGCAGATGGCAGG 0: 1
1: 0
2: 0
3: 24
4: 289
1078604761_1078604766 -2 Left 1078604761 11:12765271-12765293 CCTGTACTTTTTGGCTGCTTACC 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1078604766 11:12765292-12765314 CCTTTTGGGAAGCAGATGGCAGG 0: 1
1: 0
2: 0
3: 24
4: 289
1078604759_1078604766 9 Left 1078604759 11:12765260-12765282 CCAGCTGCAGACCTGTACTTTTT 0: 1
1: 0
2: 1
3: 17
4: 176
Right 1078604766 11:12765292-12765314 CCTTTTGGGAAGCAGATGGCAGG 0: 1
1: 0
2: 0
3: 24
4: 289
1078604757_1078604766 25 Left 1078604757 11:12765244-12765266 CCTTCCATAAATGCTTCCAGCTG 0: 1
1: 0
2: 0
3: 11
4: 239
Right 1078604766 11:12765292-12765314 CCTTTTGGGAAGCAGATGGCAGG 0: 1
1: 0
2: 0
3: 24
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078604766 Original CRISPR CCTTTTGGGAAGCAGATGGC AGG Intronic
900493944 1:2967684-2967706 CCTTTTAGGCAGGAGAGGGCAGG - Intergenic
901374273 1:8826335-8826357 CCTTTGGGGAAGCAGCTCCCTGG - Intergenic
902101524 1:13994217-13994239 GCTCTTTGGAAGCAGATGGTGGG - Intergenic
902405992 1:16183963-16183985 CCTGTGGGGAAGGAAATGGCGGG - Intergenic
903895725 1:26602534-26602556 TCTTTTGAACAGCAGATGGCAGG + Intergenic
905456966 1:38094957-38094979 CCTCTGGGGATGCAGACGGCTGG - Intergenic
905877731 1:41443670-41443692 CATTTTGGGAGCCAGATGGGTGG - Intergenic
906101400 1:43266006-43266028 TTTTTTGGGTAGCAGATGGCGGG - Intronic
908530179 1:65026717-65026739 CACTTTGGGAGGCAGAGGGCGGG + Intergenic
909260350 1:73480989-73481011 CACTTTGGGAGGCAGAAGGCGGG - Intergenic
909497570 1:76295931-76295953 GCTTTTGGGAAACAGATGGAGGG + Intronic
912755981 1:112325212-112325234 CCTTTGGGGAGGAATATGGCTGG + Intergenic
912874890 1:113347699-113347721 CACTTTGGGAGGCAGAAGGCTGG - Intergenic
918993577 1:191729116-191729138 CCTGTGGGTATGCAGATGGCAGG - Intergenic
919644878 1:200085474-200085496 GCTTATGGGAAGCAAATGGAAGG - Intronic
921040877 1:211430679-211430701 CACTTTGGGAGGCAGAGGGCAGG - Intergenic
922027092 1:221760270-221760292 CCTAGTGGGAAGCAGAGTGCTGG - Intergenic
923071113 1:230565258-230565280 CCTCTTGGGCAGCAGAAGCCTGG + Intergenic
1063294988 10:4796396-4796418 CCTTTCTGGTAGCAAATGGCTGG + Intronic
1065115437 10:22478666-22478688 CATTTTGGTGGGCAGATGGCAGG + Intergenic
1065118460 10:22505100-22505122 CCTTTTGGAAAGCTGGCGGCAGG + Intergenic
1065794454 10:29292989-29293011 GCTTATGGAAAGCAGCTGGCAGG - Intronic
1065948103 10:30625769-30625791 GCTTATGGAAAGCAGCTGGCAGG + Intronic
1065967190 10:30779879-30779901 CTCTCTGGGAAGCAGAAGGCAGG - Intergenic
1066065976 10:31761084-31761106 CCTTGAGGCAAGCAGGTGGCTGG - Intergenic
1067296547 10:44978055-44978077 CCTGTTGGGAAACAGAAGCCTGG + Exonic
1070187076 10:74074872-74074894 CCTCTTGGGATGAAGATGCCTGG + Exonic
1070765847 10:79055866-79055888 CCTTCTGGGAAGTAGGGGGCTGG + Intergenic
1070798702 10:79232315-79232337 ACTTATGGGAGGAAGATGGCTGG + Intronic
1071111495 10:82162944-82162966 CCTGTTGGGAACTAGTTGGCAGG + Intronic
1072899071 10:99391580-99391602 CCTTGGGGGAAGCAGATGATGGG - Exonic
1073974703 10:109087329-109087351 CCTTATGGGAAGCAGTTAGCTGG - Intergenic
1074049530 10:109869196-109869218 GCTTTTGGGAATAAGATGGGAGG + Intronic
1074554091 10:114472335-114472357 CATTTTGGGAGGCTGAGGGCCGG - Intronic
1074789186 10:116869103-116869125 CCTTTGGGGGACCAGATGGAAGG - Intronic
1075607261 10:123821092-123821114 CCTGTTGGGACCCAGGTGGCAGG - Intronic
1075623419 10:123944682-123944704 CCTGTTTGGAAGCAGAATGCTGG - Intergenic
1076269089 10:129134800-129134822 CCTTTTTGGAGGCAAATGGTTGG - Intergenic
1076784973 10:132745260-132745282 CCCTTTGGGAAGGTGAGGGCTGG + Intronic
1077329975 11:1979911-1979933 ACTCTTGGGAAGAAGCTGGCAGG + Intronic
1078604766 11:12765292-12765314 CCTTTTGGGAAGCAGATGGCAGG + Intronic
1081280748 11:41207087-41207109 CCTTTTGGGAAGAAGAAAGGAGG - Intronic
1081901845 11:46635249-46635271 CACTTTGGGAAGCTGAGGGCAGG - Intronic
1081957391 11:47105247-47105269 CACTTTGGGAAGCAGATGTGAGG + Intronic
1083134761 11:60661848-60661870 CCCTTTGGGAAGCCAAAGGCAGG + Intergenic
1083846845 11:65340292-65340314 CTTCTAGAGAAGCAGATGGCAGG + Intronic
1084662444 11:70554079-70554101 CTTTGTGGGGAGCAGATGGTAGG + Intronic
1088575968 11:111271667-111271689 CATTTTGGGAAGCAGAGGCAGGG - Intronic
1089254867 11:117188914-117188936 CATTTAGGGAAGCAGAAGGAAGG + Intronic
1089309494 11:117548399-117548421 CCCTATGGGAAGGAGCTGGCAGG - Intronic
1089328889 11:117676504-117676526 CCCTTTGGGAAAAAGAGGGCTGG - Intronic
1089758278 11:120703320-120703342 CTTCTTGGGAAGCAGAGGGTAGG - Intronic
1089816625 11:121182408-121182430 CCTTTTGGGAAACTGAGGGCAGG - Intronic
1091092047 11:132780518-132780540 CATTTTTGAAAGCAGATGGCAGG + Intronic
1202812952 11_KI270721v1_random:35090-35112 ACTCTTGGGAAGAAGCTGGCAGG + Intergenic
1091432078 12:444913-444935 CCATATGGAAAGCAGATGACTGG + Intergenic
1091445611 12:542879-542901 CCCCTTGGGAAGCAGCTGGGAGG - Intronic
1091754402 12:3042258-3042280 CATTTAGTGAAGCAGATGGAGGG + Intergenic
1092399715 12:8164483-8164505 CCTGTTGGGAGGCAGGTGGAGGG - Intronic
1092511328 12:9159955-9159977 CCTTTGGGGAACGATATGGCAGG - Exonic
1092821429 12:12357072-12357094 CCTTCCGGGACGCAGATGGGCGG - Intronic
1092926419 12:13276300-13276322 CCTTTTGGGAAGTGGGTGGGTGG + Intergenic
1095740400 12:45600587-45600609 CATTTTGGGAGGCAGTAGGCAGG - Intergenic
1096394894 12:51258334-51258356 CATTTTGGGAGGCTGAGGGCAGG + Intronic
1097346339 12:58497630-58497652 CCATTTGCAAAGCAGAAGGCAGG + Intergenic
1098524231 12:71468628-71468650 CCTTTTCAAAAGCATATGGCTGG - Intronic
1098574231 12:72022897-72022919 CCTTTTAGGAAGTAGATGCTGGG - Intronic
1098939812 12:76521052-76521074 GCTTTTAGGAAGAAAATGGCTGG - Intronic
1099779007 12:87170913-87170935 CCTTTTGGGAAAAAGTTGGAAGG + Intergenic
1100210173 12:92391555-92391577 CCTTTTGGGCAGCATAAGTCTGG - Intergenic
1101862734 12:108496308-108496330 ATTTTTGTGAAGGAGATGGCAGG - Intergenic
1102082302 12:110108262-110108284 TCCTCTGGGAAGCAGATGCCAGG - Intergenic
1102599653 12:114020094-114020116 CCATTTGGGAGGCAGGAGGCTGG - Intergenic
1103059214 12:117845323-117845345 ACTTTTAAGAAGCAGAAGGCAGG - Intronic
1103972744 12:124682282-124682304 GCTTTTGGGAAGGACAGGGCTGG + Intergenic
1104430182 12:128709918-128709940 CCTTGTGAGAAGCAGATGAGAGG + Intergenic
1105371995 13:19810210-19810232 CCTTTTGGGAGGCTGAGGGCGGG - Intergenic
1107639008 13:42421954-42421976 CACTTTGGGAAGCCGAGGGCAGG - Intergenic
1110372929 13:74759482-74759504 GCTTTTGGGGAGCAGAGGTCAGG - Intergenic
1111019130 13:82423601-82423623 CCTTTTGGGAGGCAGAAGGTGGG - Intergenic
1111171732 13:84535392-84535414 GCTTGTGGGAAGCAGGTGGGAGG + Intergenic
1112033063 13:95474794-95474816 CCTTTTGGGAAGCTCATTCCAGG + Intronic
1112210853 13:97375575-97375597 GCGTGTGGAAAGCAGATGGCTGG - Intronic
1112225144 13:97532320-97532342 CCTTTTTGGAAACAGATGATTGG + Intergenic
1112484341 13:99806865-99806887 CCATGTGTGAACCAGATGGCAGG - Intronic
1112501483 13:99946625-99946647 ACTGTGGGGAAGCAGATTGCAGG - Intergenic
1116354667 14:43913774-43913796 CCTTTTGGGAGGATGATTGCTGG - Intergenic
1117804738 14:59480108-59480130 CTTTTAGGGAAGCCTATGGCAGG + Intronic
1118284117 14:64455469-64455491 CCAGTTGGGAAGCAGAGGGGAGG + Intronic
1118469109 14:66058079-66058101 CTTGTTGGGTAGCAGATGACAGG - Intergenic
1119797684 14:77414005-77414027 CACCTTGGGAAGCAGCTGGCTGG - Exonic
1121269254 14:92626968-92626990 TATTTTGGCAAGAAGATGGCAGG + Intronic
1121548598 14:94781170-94781192 CCTTTTGTTATGCAGATAGCAGG - Intergenic
1121733000 14:96199320-96199342 CATTTTGGGAGGCTGAAGGCAGG + Intergenic
1122492025 14:102124026-102124048 CATTTTGGGAGGCAGAGGCCAGG - Intronic
1122581894 14:102776761-102776783 CCTTTTCGCATGCAGAGGGCAGG - Intergenic
1123988212 15:25663846-25663868 CCATTTGGAAAGCAAAAGGCCGG - Intergenic
1124252398 15:28115460-28115482 CCTGTCTGGAAGCAGCTGGCTGG - Exonic
1125316576 15:38438807-38438829 TCTTGTAGGGAGCAGATGGCTGG + Intergenic
1125426472 15:39554161-39554183 CTTACTGGGAAGCAGATGGGTGG + Intergenic
1125487579 15:40123126-40123148 TCCTGTGGGAAGCAGATGGCAGG + Intergenic
1125489393 15:40135932-40135954 TCCTGTGGGAAGCAGATGGCAGG + Intergenic
1128006833 15:64250495-64250517 CATTTTGGGAGGCTGAAGGCAGG + Intronic
1128517784 15:68353983-68354005 GTTGTTGGCAAGCAGATGGCTGG - Intronic
1128671213 15:69576025-69576047 CCTTCTGGGAAGTAGATGGAGGG + Intergenic
1129863628 15:78884391-78884413 CATTTTGGGAAGCCGAGGGTGGG + Intronic
1132262487 15:100438711-100438733 CCTGTTGAGTTGCAGATGGCTGG + Intronic
1134208801 16:12259068-12259090 GCTCTGGGGAAGCAGAGGGCAGG - Intronic
1135048710 16:19174869-19174891 CATTTTGGGAGGCTGAGGGCAGG + Intronic
1135424399 16:22325142-22325164 TCTCTTGTGAAGCAGATGGTAGG + Intronic
1140984394 16:80143963-80143985 CCTTTTGGGAAGCAAAAGTATGG + Intergenic
1141200178 16:81891678-81891700 CCTGTTGTGAAGCAGGTGGAGGG + Intronic
1141269605 16:82527046-82527068 CCTTTTCCTAAGCAGTTGGCAGG + Intergenic
1142640832 17:1285015-1285037 GCATTTGGGAAGCAGATGGATGG + Intronic
1142808435 17:2383994-2384016 CCTGTAGGGAAGCATGTGGCAGG - Intergenic
1143099060 17:4495020-4495042 CCTTTTGGGAAGCTGAGGTGTGG + Intergenic
1143179700 17:4976816-4976838 CCCTTTGGGATGGAGAAGGCAGG + Intronic
1143613505 17:8035039-8035061 ACGTGTGGCAAGCAGATGGCTGG - Intergenic
1145255429 17:21319653-21319675 CCTTTTGGAAACCAGGTGGGAGG + Intergenic
1145321180 17:21768299-21768321 CCTTTTGGAAACCAGGTGGGAGG - Intergenic
1146379027 17:32314882-32314904 CATGCTAGGAAGCAGATGGCAGG - Intronic
1147638297 17:41977538-41977560 CCTTTGGGGCAGCAGTTGGAAGG - Exonic
1147885249 17:43679860-43679882 CCTTCAGAGAAGCAAATGGCTGG + Intergenic
1147946106 17:44080986-44081008 CATTTTGGGAGGCTGAGGGCTGG + Intronic
1147949273 17:44097943-44097965 CCTATTGGTATGCAGGTGGCAGG + Intronic
1148012652 17:44496113-44496135 CATTTTGGGAGGCTGAGGGCAGG - Intronic
1150625488 17:66838472-66838494 CCTTGTGGGGAGGAGAAGGCTGG + Intronic
1151692394 17:75694603-75694625 TCTGCTGGGAAGCCGATGGCCGG + Intronic
1151903020 17:77029833-77029855 CACTTTGGGAGGCAGAGGGCAGG + Intergenic
1151909003 17:77069106-77069128 CCTGTTGGGATGCAGCAGGCCGG - Intergenic
1152513231 17:80804493-80804515 GCTTTAGGGAAACAGAAGGCAGG - Intronic
1153164025 18:2241611-2241633 TATTTTGAGAAGCACATGGCGGG - Intergenic
1153591642 18:6680188-6680210 CAGATTGAGAAGCAGATGGCCGG - Intergenic
1153837724 18:8979059-8979081 CATTTTGGAAGGCAGTTGGCAGG + Intergenic
1154191345 18:12233332-12233354 CCCTTTGGAAGACAGATGGCAGG - Intergenic
1154294239 18:13135658-13135680 CCTTTGGGAAGGCGGATGGCAGG + Intergenic
1155150769 18:23121288-23121310 CCCGCTGGGAAGCAGATGGATGG - Intergenic
1155346343 18:24861161-24861183 CCTTGTGCTAAGCAGATAGCAGG - Intergenic
1156377031 18:36524033-36524055 CACTTTGGGAGGCCGATGGCTGG + Intronic
1157279915 18:46339998-46340020 CCTTTTCTGAAGCAAAGGGCAGG + Intronic
1157313226 18:46567956-46567978 GATTTTGGGCAGCAGCTGGCGGG - Intronic
1157316215 18:46592185-46592207 CCTTATGGCAGGCAGAGGGCCGG + Intronic
1157560348 18:48641040-48641062 TCTTTTGGGAAGAGGATGCCAGG - Intronic
1160421269 18:78747355-78747377 CCTTTTGGGCAGGAGTTGGTGGG + Intergenic
1160605589 18:80047261-80047283 CTTTTTGGGGAGGAGGTGGCAGG - Intronic
1160619528 18:80160929-80160951 CCTTCTGGGAGGCAGCAGGCTGG + Intronic
1161206948 19:3046503-3046525 CCCTTTGGGGTGCAGATGGGGGG + Intronic
1161894560 19:7070349-7070371 CATTTTAGGGACCAGATGGCTGG + Intronic
1162115424 19:8426437-8426459 CCCTTTGGGAAGGAGATGCAGGG - Intronic
1162237065 19:9317727-9317749 CCTCTTGGGCAGCATAAGGCTGG + Intergenic
1162642439 19:12022281-12022303 CCTTTTGGGAAACAAAGGGATGG - Intronic
1163288009 19:16361121-16361143 CCTTTTCGGAAGCAAATCTCGGG - Intronic
1163420611 19:17211873-17211895 CCTTTTGAGAGACAGATGGCAGG - Exonic
1163488028 19:17600757-17600779 CCTTAAGGGCAACAGATGGCCGG + Intergenic
1163739353 19:19001259-19001281 CACTTTGGGAGGCAGAGGGCGGG - Intronic
1165003004 19:32780330-32780352 CACTTTGGGAAGCTAATGGCAGG - Intronic
1165172447 19:33903598-33903620 CACTTTGGGAAGCTGAGGGCCGG - Intergenic
1166405119 19:42515023-42515045 CACTTTGGGAAACAGATGGGAGG + Intronic
1166658830 19:44631699-44631721 CCTTATGGGAAGCAAAGGGATGG + Intronic
1166967598 19:46539249-46539271 CCTTTTGGGAAGCACTTCCCAGG + Intronic
1167782511 19:51608301-51608323 CCTTTTGGGAAGGAGAGGCCAGG + Intergenic
1168229866 19:55023623-55023645 CCGTATAGGAAGCAGAAGGCTGG - Intronic
1168580266 19:57549664-57549686 CCCTTTGGGCACCAGATGCCTGG + Intronic
926176890 2:10601566-10601588 CACTTTGGGAAGCCGATGGGAGG + Intronic
928086336 2:28348463-28348485 GCTTTTGGGCAGAACATGGCTGG - Intergenic
930918105 2:56719277-56719299 CCTTATGGGAAACAAATGGATGG - Intergenic
931221460 2:60291985-60292007 CCTGTTGGGAAGCAGACCCCTGG - Intergenic
932198416 2:69804369-69804391 CTTTTTGGGAAACAGATGCTAGG - Intronic
935100247 2:99987693-99987715 CCTTTGGGGTAGCAGATGATAGG - Intronic
936933191 2:117811427-117811449 CATTGTAGAAAGCAGATGGCTGG - Intergenic
937572068 2:123376011-123376033 CTTGTTGGGAAGCAGATGGTAGG + Intergenic
940084945 2:149848676-149848698 AGTTTTGGGAAAGAGATGGCAGG + Intergenic
941237230 2:162989771-162989793 CCTTTAGGTAACCAGGTGGCTGG - Intergenic
942180242 2:173373322-173373344 CACTTTGGGAAGCTGAGGGCAGG - Intergenic
942689446 2:178569937-178569959 CCTTTTGGTAAGCAGAAGGAGGG + Exonic
945883180 2:215347975-215347997 CCATCTGGGAAGCAGAGGGTAGG - Intronic
946063734 2:216968327-216968349 ACTTTTGGGGAGCACATGGTGGG - Intergenic
946936215 2:224723512-224723534 CCTTTATGGCAGCAAATGGCTGG - Intergenic
947374530 2:229482397-229482419 CCTTTTGGGAAGCCATTGGAGGG - Intronic
1169771646 20:9207682-9207704 CCTATTGTGGAGCAGATGGTGGG - Intronic
1170029654 20:11931615-11931637 CCCTCTGAGAAGCAGATGGAAGG - Intergenic
1170614367 20:17937106-17937128 CCTGTTGGGAGGCAGGTGGCTGG - Intergenic
1172036423 20:32014001-32014023 TCTTTTGAGATTCAGATGGCTGG + Intronic
1172163796 20:32886527-32886549 CCTTTGGGGAAGAAGAGGCCTGG + Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1175213944 20:57380206-57380228 CCTGGTGGCAGGCAGATGGCAGG - Intergenic
1176553927 21:8244779-8244801 ACTTTTGGGAGGCCGAGGGCCGG - Intergenic
1176572849 21:8427803-8427825 ACTTTTGGGAGGCCGAGGGCCGG - Intergenic
1181099166 22:20527711-20527733 ACTTTTGGGAGGCCGAGGGCAGG + Intronic
1181888725 22:26042269-26042291 CCTTTTAGGATGCAGCTGGCAGG - Intergenic
1182523987 22:30904102-30904124 CCCTTTGGGGAGCAGTTGGGGGG + Intronic
1182736022 22:32532760-32532782 GCTAATGGGAAGCACATGGCTGG - Intronic
1185310287 22:50150520-50150542 ACTTCGGGGAGGCAGATGGCAGG + Intronic
1203258931 22_KI270733v1_random:161817-161839 ACTTTTGGGAGGCCGAGGGCCGG - Intergenic
949501998 3:4688787-4688809 TCTTTTGGGGATGAGATGGCAGG + Intronic
950487121 3:13280503-13280525 TCTTTTGGGAAGGAGAATGCTGG - Intergenic
952263644 3:31764941-31764963 CCTTTTGGGAGGATGATGGAAGG - Intronic
953046604 3:39298494-39298516 CCTCCTGGGAGGCAGAAGGCAGG + Intergenic
953191872 3:40695230-40695252 CCTTTTACAAAGCAGATGGGAGG - Intergenic
953325700 3:42010799-42010821 GCTTGGAGGAAGCAGATGGCAGG - Intergenic
953347438 3:42188004-42188026 CCTTTTGGGAAGCAAATGATGGG + Intronic
953723414 3:45376539-45376561 CCTTTTGGGAAACAAAGGGATGG + Intergenic
953955885 3:47231715-47231737 CTTTTTAGAATGCAGATGGCCGG - Intronic
954122126 3:48505464-48505486 CCTTTAGGGAGGCAGAGGGCTGG - Intergenic
954250854 3:49366269-49366291 CCTTTTGTGAAGCTGCTGGAAGG - Intronic
955963034 3:64360524-64360546 CATCTTGGGAAGCAGATTACGGG - Intronic
962327779 3:134450127-134450149 TCCTCCGGGAAGCAGATGGCAGG - Intergenic
962414848 3:135172905-135172927 GCTGTTGGGAAGCAAAGGGCAGG - Intronic
962867175 3:139456902-139456924 TCTTTTGGGAGGAAGATGTCTGG + Intronic
963427634 3:145152815-145152837 CCTGTTGAGCAGCAGATTGCAGG + Intergenic
963800121 3:149667846-149667868 CCTCTGGTGAAACAGATGGCAGG - Intronic
965582722 3:170286606-170286628 CCTTTTGAGAAGCAGTTTGATGG + Intronic
965593344 3:170382963-170382985 CACTTTGGGAGGCTGATGGCAGG - Intronic
965627670 3:170697956-170697978 CCTTTTGGTCAACAGAAGGCAGG - Intronic
966407984 3:179619009-179619031 CCAGCTGGGAAGCAGATGGATGG + Intronic
967856828 3:194124314-194124336 ACTGCTGGGAAGCAGATGGAAGG - Intergenic
967944693 3:194794726-194794748 CCTTGTAGGAAGCATATGGTTGG + Intergenic
968630118 4:1646023-1646045 CCATCTTGGAAGCAGAGGGCAGG + Intronic
969780382 4:9397112-9397134 CCTGTTGGGAGGCAGGTGGAGGG + Intergenic
970307809 4:14751396-14751418 CCTGTTGGGTAGCAGAGGGGAGG - Intergenic
976239059 4:82934157-82934179 CATTTTGGGAGGCTGATGGGTGG + Intronic
980411873 4:132430155-132430177 CTTTTTGCCCAGCAGATGGCTGG + Intergenic
981127257 4:141120896-141120918 CTGTATGGGCAGCAGATGGCAGG + Intronic
983231450 4:165133206-165133228 CCCTTTTAGAAACAGATGGCAGG - Intronic
983935628 4:173500960-173500982 CCTTCCGGGGAGCAGAAGGCCGG + Intergenic
984710115 4:182877825-182877847 TCTTTTGGGAAGGAGCTGGTGGG - Intergenic
985702797 5:1383660-1383682 GCTTTGAGGAAGCACATGGCTGG - Intergenic
986622752 5:9692555-9692577 CCTTACTGGAAGCAGATGGCAGG - Intronic
989042678 5:37245591-37245613 CATTTTTGGAAACAGATGCCTGG - Exonic
989293357 5:39794633-39794655 CCTCTTGGGAAGCAGCTGGGTGG + Intergenic
990533003 5:56692850-56692872 CATCTTGGGAACCAGACGGCTGG - Intergenic
991989738 5:72325793-72325815 CCTTCTGGAAAGCAGATGCTTGG + Intronic
994129832 5:96213851-96213873 CCTCTTGGGAAGGGGATGGGAGG - Intergenic
994422545 5:99539275-99539297 CATTTTGGGAGGCAGGTGGGAGG - Intergenic
994454363 5:99985592-99985614 CCTCTTGGGTAGCATATGTCTGG - Intergenic
994459828 5:100058228-100058250 CATTTTGGGAGGCAGGTGGGAGG + Intergenic
994679898 5:102873346-102873368 CCTTTTGGGCACCAGCTGGTGGG + Intronic
995715715 5:115080336-115080358 TCTTTGGGGAGGAAGATGGCTGG + Intergenic
996529777 5:124516162-124516184 CCTTTTGGCAAGGCGATGGTGGG - Intergenic
996870850 5:128191764-128191786 CAGTTTGGGAAGGAGGTGGCTGG + Intergenic
997382461 5:133447399-133447421 GCTTTTGAGAAGCACCTGGCTGG + Intronic
998592282 5:143490280-143490302 CCCTTTGGGGAGATGATGGCTGG + Intergenic
999272530 5:150305087-150305109 CCTTTTATTAAGCAGGTGGCCGG - Intronic
999495413 5:152091668-152091690 CCTTTTGGGAAGCAGCATGATGG + Intergenic
1001080723 5:168665412-168665434 CCTTCTTGGAAGCGGAAGGCTGG - Intronic
1001255405 5:170179436-170179458 TCTGTTGGGAAGGAGATGGCTGG + Intergenic
1001700304 5:173701914-173701936 CCTTTTGGGAATCAGATACTAGG + Intergenic
1001763043 5:174223358-174223380 GTTTCTGAGAAGCAGATGGCTGG + Intronic
1003273131 6:4624622-4624644 CCATTTGGGAAGGTGATGGAAGG - Intergenic
1003312531 6:4982126-4982148 CCTTTTGGCAGACAGAGGGCGGG + Intergenic
1004206222 6:13594039-13594061 CCTTTTGGTAAGAACATGTCAGG - Intronic
1004531723 6:16460666-16460688 CCTGTTGGGAAGCATAAGTCTGG - Intronic
1006212170 6:32405198-32405220 CCTCTTGGGGAGTAGCTGGCAGG + Exonic
1007414563 6:41684161-41684183 CTTTTTGGGACTCAGATGGCAGG - Exonic
1007492285 6:42232786-42232808 CCCTCTGGGAAGCAGAAGCCTGG - Exonic
1007538407 6:42617885-42617907 CCTTTTGGGAGGGAGGTGGGAGG - Intronic
1007598085 6:43064081-43064103 CATTTTGGGAGGCCGAGGGCAGG - Intronic
1010422476 6:75690947-75690969 CACTTTGGGAAGCTGATGGGGGG - Intronic
1013240781 6:108243683-108243705 CATTTTAGGAAGCCGAGGGCGGG + Intronic
1014284722 6:119484099-119484121 CCTTTTGGGACACTGATAGCAGG + Intergenic
1014479643 6:121920287-121920309 CCATTTGAGAAGCAGCTGTCAGG - Intergenic
1014528331 6:122528296-122528318 TCTTTTAGAAAGCAGATAGCTGG + Intronic
1014863421 6:126497876-126497898 CCTTTTGGGAAGGAGGAGGTAGG + Intergenic
1015023666 6:128507494-128507516 CCTTATGGGATGCAGGTGCCAGG + Intronic
1021720751 7:23502103-23502125 ACTTTTGGGAGGCCGAAGGCAGG - Intergenic
1023222443 7:37933197-37933219 CCTCTTGAGAGTCAGATGGCCGG + Intronic
1024010501 7:45262164-45262186 CCCTTTAGTAGGCAGATGGCTGG - Intergenic
1024037853 7:45523913-45523935 GCCTCTGGCAAGCAGATGGCTGG - Intergenic
1024559916 7:50634619-50634641 TCTTGTAGGCAGCAGATGGCTGG - Intronic
1024710439 7:52009415-52009437 CTACTTGGCAAGCAGATGGCTGG - Intergenic
1024874780 7:54009304-54009326 GCTTTTGGGAGCTAGATGGCTGG - Intergenic
1025076187 7:55945285-55945307 CACTTTGGGAAGCCGAGGGCAGG - Intergenic
1025943488 7:66089593-66089615 CCTCCTGGGAGGCACATGGCAGG - Exonic
1026636873 7:72091080-72091102 CATTTTGGGAGGCAGAGGGTGGG + Intronic
1027179523 7:75928524-75928546 CCTGATGGGAAGAAGATTGCTGG - Intronic
1034490772 7:151392132-151392154 ACTCTTGGGGAGCACATGGCTGG - Intronic
1036277803 8:7371056-7371078 CCTGTTGGGAGGCAGGTGGAGGG + Intronic
1036343722 8:7940837-7940859 CCTGTTGGGAGGCAGGTGGAGGG - Intronic
1036839061 8:12101605-12101627 CCTGTTGGGAGGCAGGTGGAGGG - Intergenic
1036860850 8:12347848-12347870 CCTGTTGGGAGGCAGGTGGAGGG - Intergenic
1037643922 8:20773108-20773130 CCTTCTGGGAAGCAGAAACCAGG + Intergenic
1038864606 8:31426125-31426147 CCTTTTGTGTCTCAGATGGCTGG + Intergenic
1042085857 8:65108143-65108165 GTATTTGGGAAGCAAATGGCTGG - Intergenic
1043525122 8:81088136-81088158 CCTTTTAGGAAGGAGTTGGGAGG - Intronic
1043539237 8:81240639-81240661 CCTGGTGAGAACCAGATGGCCGG - Intergenic
1044233038 8:89800960-89800982 CATTTTAGGAAGCAGATAGAAGG - Intergenic
1044738206 8:95300640-95300662 CCTGGAGGGAATCAGATGGCTGG - Intergenic
1046584869 8:116138978-116139000 CCTTTGGGGAAGGATATTGCAGG - Intergenic
1046695367 8:117333615-117333637 GTTTTGGGGAAGCAGGTGGCAGG - Intergenic
1047185865 8:122632893-122632915 ACTTTTTGGAAGCAGAAGGTGGG - Intergenic
1051435257 9:17023888-17023910 CATTTTGGGAGGCCGAGGGCGGG + Intergenic
1055296421 9:74837993-74838015 CCTTTCGGGAAGCTGAGGGCTGG - Intronic
1055486059 9:76757714-76757736 CATTTTGGGAAGCAGAGGCAGGG + Intronic
1055855308 9:80678915-80678937 CATTTTGGGAAGCTGATGCAGGG + Intergenic
1058975915 9:110125439-110125461 CCTTTTAGGGAGCAGAGGGAGGG + Intronic
1059248935 9:112871065-112871087 CCTAGTGAGAGGCAGATGGCTGG + Exonic
1059522065 9:114952062-114952084 TATTTTGGTCAGCAGATGGCAGG + Intergenic
1059836149 9:118155822-118155844 CATTTTGGGAAGCTGAGGACAGG + Intergenic
1060290697 9:122299951-122299973 TCTTCTGAGAAGCAGATGCCAGG + Intronic
1060874817 9:127075125-127075147 CCTCTTGGGAAGCACCTGCCAGG - Intronic
1062179137 9:135181287-135181309 CCCTGTGGGAAGCCGAGGGCTGG + Intergenic
1203475123 Un_GL000220v1:143826-143848 ACTTTTGGGAGGCCGAGGGCCGG - Intergenic
1186146078 X:6625535-6625557 AGGTTTGGGAAGCAGGTGGCAGG - Intergenic
1186683101 X:11896522-11896544 CCATTTGTGAAGCAGAAAGCAGG + Intergenic
1187929257 X:24279085-24279107 CACTTTGGGAAGCAGGGGGCAGG - Intergenic
1189363640 X:40371621-40371643 CCTTATGGGAAGGGGCTGGCAGG + Intergenic
1191616106 X:63171162-63171184 CCTTGAAGGAAGCAGATGGTTGG - Intergenic
1191620191 X:63207761-63207783 CCTTGAAGGAAGCAGATGGTTGG + Intergenic
1193649462 X:84111912-84111934 TCTTTTTGGCAGCAGATGGTTGG - Intronic
1196304569 X:114086698-114086720 CAATTTGGGAGGCTGATGGCTGG - Intergenic
1196361685 X:114868552-114868574 CCCTTTAGTAGGCAGATGGCAGG - Intronic
1198152772 X:133927176-133927198 CCAATAGGGAAGCAGATGGGTGG + Intronic
1200059332 X:153477241-153477263 GCTAATGGGAACCAGATGGCAGG + Intronic
1201926962 Y:19298030-19298052 CCTTATGGGAAGTAAATGGATGG - Intergenic