ID: 1078606918

View in Genome Browser
Species Human (GRCh38)
Location 11:12785138-12785160
Sequence TCCCCACGGCTCCCAGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 275}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078606918_1078606924 3 Left 1078606918 11:12785138-12785160 CCTGTGCCTGGGAGCCGTGGGGA 0: 1
1: 0
2: 3
3: 38
4: 275
Right 1078606924 11:12785164-12785186 TGTGGGCCTGCATGTGCTCTGGG 0: 1
1: 0
2: 1
3: 41
4: 338
1078606918_1078606927 11 Left 1078606918 11:12785138-12785160 CCTGTGCCTGGGAGCCGTGGGGA 0: 1
1: 0
2: 3
3: 38
4: 275
Right 1078606927 11:12785172-12785194 TGCATGTGCTCTGGGTAAGTGGG 0: 1
1: 0
2: 1
3: 13
4: 157
1078606918_1078606930 17 Left 1078606918 11:12785138-12785160 CCTGTGCCTGGGAGCCGTGGGGA 0: 1
1: 0
2: 3
3: 38
4: 275
Right 1078606930 11:12785178-12785200 TGCTCTGGGTAAGTGGGGGTAGG 0: 1
1: 0
2: 6
3: 21
4: 320
1078606918_1078606923 2 Left 1078606918 11:12785138-12785160 CCTGTGCCTGGGAGCCGTGGGGA 0: 1
1: 0
2: 3
3: 38
4: 275
Right 1078606923 11:12785163-12785185 GTGTGGGCCTGCATGTGCTCTGG 0: 1
1: 0
2: 2
3: 18
4: 241
1078606918_1078606926 10 Left 1078606918 11:12785138-12785160 CCTGTGCCTGGGAGCCGTGGGGA 0: 1
1: 0
2: 3
3: 38
4: 275
Right 1078606926 11:12785171-12785193 CTGCATGTGCTCTGGGTAAGTGG 0: 1
1: 0
2: 1
3: 13
4: 185
1078606918_1078606928 12 Left 1078606918 11:12785138-12785160 CCTGTGCCTGGGAGCCGTGGGGA 0: 1
1: 0
2: 3
3: 38
4: 275
Right 1078606928 11:12785173-12785195 GCATGTGCTCTGGGTAAGTGGGG 0: 1
1: 0
2: 2
3: 13
4: 173
1078606918_1078606929 13 Left 1078606918 11:12785138-12785160 CCTGTGCCTGGGAGCCGTGGGGA 0: 1
1: 0
2: 3
3: 38
4: 275
Right 1078606929 11:12785174-12785196 CATGTGCTCTGGGTAAGTGGGGG 0: 1
1: 0
2: 1
3: 10
4: 173
1078606918_1078606931 25 Left 1078606918 11:12785138-12785160 CCTGTGCCTGGGAGCCGTGGGGA 0: 1
1: 0
2: 3
3: 38
4: 275
Right 1078606931 11:12785186-12785208 GTAAGTGGGGGTAGGAGAGTAGG 0: 1
1: 0
2: 0
3: 68
4: 714

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078606918 Original CRISPR TCCCCACGGCTCCCAGGCAC AGG (reversed) Intronic
900366305 1:2313266-2313288 TCCCCACGGTTCCCTGTCCCTGG - Intergenic
900497505 1:2982728-2982750 CTCCCATGGCACCCAGGCACTGG - Intergenic
900834310 1:4988418-4988440 CCCCCACGGCTCCCAGTGATAGG - Intergenic
900962564 1:5934605-5934627 TCCCCACTGCTCCCAGTCCCGGG + Intronic
901069834 1:6511607-6511629 TCCTCAGGGCCCCCAGGCGCTGG + Intronic
901195114 1:7436131-7436153 TCCCCTCGTCCCCCAGGCCCGGG + Intronic
902040973 1:13492118-13492140 TTCCCCCTCCTCCCAGGCACAGG + Intronic
902332815 1:15738892-15738914 AGCCCCCGGGTCCCAGGCACAGG + Intronic
902725680 1:18334578-18334600 TCCTCACGGCTCCCTGGAAGTGG + Intronic
904043646 1:27598219-27598241 TCCCCTGGGCTCCCAGGCCAAGG + Intronic
904450422 1:30607378-30607400 TGCCCTCGGCTCTCAGCCACTGG + Intergenic
905539201 1:38746694-38746716 TCCCCAGGGCTCCCAGACAGGGG - Intergenic
906077495 1:43062905-43062927 ACCCCACTGGTCCCAGGCTCAGG - Intergenic
906743416 1:48204903-48204925 CCCCCAAGGCTCCCAGCTACAGG - Intergenic
908666420 1:66496237-66496259 TCTCCAAGGCACCCAGGCAATGG - Intergenic
909706855 1:78595735-78595757 TCCTCACACCTCCCAGCCACTGG - Intergenic
909871429 1:80743989-80744011 ACCCCAGGGCTACCAGGCAGTGG + Intergenic
910391905 1:86754620-86754642 ACCCCAAGACTGCCAGGCACAGG + Intergenic
915251196 1:154589915-154589937 TCCCCACAGCTCCCTCTCACTGG - Exonic
915602679 1:156932148-156932170 CCCCCAAGGCTCTCTGGCACAGG + Intronic
916203547 1:162294333-162294355 TCCCCACATCTCCCAGGGACGGG + Intronic
916619854 1:166485468-166485490 TCCCAGCAGCTCTCAGGCACAGG + Intergenic
920032512 1:203045825-203045847 TCCCCTCTTCTCCCAGGCTCTGG + Intronic
920951517 1:210575493-210575515 TCCCCAGGGCTCCCAGGCCCAGG - Intronic
921057261 1:211552518-211552540 TCCCCGCAGCTCCCAGCCACTGG + Intergenic
921671955 1:217935179-217935201 TTACCACAGCTTCCAGGCACTGG + Intergenic
922825375 1:228513842-228513864 TCCTCACCGCCCGCAGGCACAGG - Intergenic
923094152 1:230761394-230761416 TCCCCACTGCTCCCCTGCTCAGG + Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
924127931 1:240875189-240875211 CCCCCACTGCCCCCAGGCCCTGG + Intronic
924938446 1:248792022-248792044 TCCCCAGTGCTCCCAGTCAGGGG + Intergenic
924938466 1:248792192-248792214 TCCCCAAAGCTCCCAGTCAGGGG + Intergenic
1063537148 10:6894380-6894402 TTACAACGGCTCCCAGGCAGAGG + Intergenic
1064130242 10:12702936-12702958 TCCCCACTGGTCCCAGTTACTGG - Intronic
1064209091 10:13348143-13348165 CCCCCGCGGCGCCCAGGCGCGGG - Exonic
1067310124 10:45105135-45105157 TCACCACGTTGCCCAGGCACTGG + Intergenic
1067829913 10:49605660-49605682 TCTCTACAGCTCCCAGGGACAGG - Intergenic
1070664320 10:78332776-78332798 TCCCCATGCCTCCCATGCATGGG + Intergenic
1072728269 10:97828090-97828112 GCTCCAGGGCCCCCAGGCACTGG - Intergenic
1076056924 10:127383586-127383608 ACATCAGGGCTCCCAGGCACAGG - Intronic
1076539705 10:131206364-131206386 TGCCCAGGCCTCCCAGGCCCTGG + Intronic
1076604020 10:131677807-131677829 TCCCCTCAGCTCCGAGGCTCCGG + Intergenic
1076623758 10:131809227-131809249 TCCCCAGGTCTCCTGGGCACTGG - Intergenic
1076623770 10:131809271-131809293 TCCCCAGGTCTCCTGGGCACTGG - Intergenic
1076725387 10:132410635-132410657 CCCTCACGGCTCCCAGGACCAGG - Intronic
1076869949 10:133188355-133188377 TCCCCACGGCCCCCACACGCTGG + Intronic
1077090197 11:774964-774986 TCCCCACTCCTCCCAGGCCGCGG + Intronic
1077472757 11:2771961-2771983 TCTCCACTGCTCCCTGGCCCTGG + Intronic
1077535734 11:3123066-3123088 TGCCCACGGCTCCCAGGGGATGG - Intronic
1078109713 11:8382577-8382599 TCCCCACGCCTCCCGCCCACAGG - Intergenic
1078569516 11:12445245-12445267 TCCCCACAGTTCCCAGCCCCAGG - Intronic
1078606918 11:12785138-12785160 TCCCCACGGCTCCCAGGCACAGG - Intronic
1078986433 11:16603962-16603984 TCCCCGAGGCCCGCAGGCACGGG - Intronic
1079172062 11:18105855-18105877 TCCCTACATCCCCCAGGCACCGG - Intronic
1079418521 11:20263800-20263822 TCCCCACTGCCCCCAGCCTCTGG - Intergenic
1079557834 11:21782863-21782885 TCTCCCTGGCGCCCAGGCACTGG + Intergenic
1079686345 11:23363705-23363727 TCCACACGTCTCTAAGGCACAGG + Intergenic
1083164345 11:60874449-60874471 TCCCCTCTGCCCCCAGTCACTGG + Intronic
1083300094 11:61735651-61735673 TGCCCATGGCTCCCAGCCCCCGG + Intronic
1083685665 11:64373513-64373535 TCCCCAGGCCTCCCGGGGACAGG - Intergenic
1083741298 11:64712925-64712947 TCACCCCCGCGCCCAGGCACCGG + Intronic
1083815085 11:65128184-65128206 TCCCCATGGCTGCCTGGGACTGG + Exonic
1085038259 11:73312334-73312356 TCCCCAATTCTCCCAGGCCCAGG - Intronic
1085085060 11:73661285-73661307 ACCCTACGGCTCCCAGGCCTTGG - Intronic
1086849802 11:91796322-91796344 TCCCCATCTCTCCCAGGCTCTGG + Intergenic
1091001269 11:131911960-131911982 TCACCACGGCCACCAGGCTCAGG - Intronic
1091149539 11:133314758-133314780 TGCCCACGGCTCCCAAGCAATGG + Intronic
1091277165 11:134360414-134360436 TCCCCACGGCTTCCACGCGGTGG + Intronic
1091909893 12:4221091-4221113 TCCCCACTTCTCCCAGCCCCTGG + Intergenic
1092066242 12:5591828-5591850 TCTGCACTGCTGCCAGGCACTGG - Intronic
1092160027 12:6310896-6310918 TCGCCCCGGCTTCCAGGCCCCGG - Intronic
1093037666 12:14348041-14348063 TCCCCACTTCCCCCAGGCCCTGG + Intergenic
1094313502 12:29112756-29112778 AACCCACTGCTCCCAGTCACAGG - Intergenic
1094828891 12:34290873-34290895 ACCCCACGGACCCCAGGCAGGGG + Intergenic
1096375946 12:51110719-51110741 TCCTCAATGCTCTCAGGCACAGG + Intronic
1100258120 12:92904779-92904801 TCTGCAGGGCTCCCAAGCACAGG + Intronic
1102592795 12:113969672-113969694 TCCCCACTGTTGCCAGGCCCTGG - Intergenic
1103488255 12:121296905-121296927 TCCCCACCCCTCCCCGGCGCAGG - Intronic
1104659031 12:130595776-130595798 TCTCCCCTGCTCCCTGGCACAGG - Intronic
1104785053 12:131443918-131443940 TCCCCACCCTTCCCAGGCCCAGG + Intergenic
1104841471 12:131828082-131828104 CCCCCACGGCGCCGAGGCCCGGG - Intergenic
1104979638 12:132568073-132568095 GCCCCACAGCTCACAGCCACAGG - Intronic
1105642841 13:22284220-22284242 TCCCCACCGCTCCCCGGCCCTGG + Intergenic
1105801163 13:23903971-23903993 TTCCCACGGACCCCAGGCCCCGG - Intergenic
1105847714 13:24307965-24307987 TTCCCACGGACCCCAGGCCCCGG + Intronic
1107114113 13:36727963-36727985 TCCCCTCTGCTCCCAGGTTCTGG - Intergenic
1107925010 13:45250559-45250581 TACCCACTTCTGCCAGGCACTGG - Intronic
1113200222 13:107859073-107859095 TCCCCACGGTACACAGGCTCTGG + Intronic
1113567146 13:111326001-111326023 TCCCCACCGTCCCCAGACACGGG - Intronic
1113853858 13:113433322-113433344 TCCCACCTGCACCCAGGCACTGG + Intronic
1115268598 14:31527170-31527192 TCCCCCCGGCTCCCCGCCATGGG - Intronic
1115757743 14:36546273-36546295 TCCCCAGTGCTCACAGCCACTGG - Intergenic
1117736381 14:58773082-58773104 TACCCACGGTTCCCACGGACTGG - Intergenic
1117954349 14:61111192-61111214 ACTCCACGGCTACCAGGCACAGG - Intergenic
1119735139 14:76976767-76976789 TCCCCAGGGCTCCCAGTGAAAGG - Intergenic
1120145320 14:80972769-80972791 TCCCCACTCCTCCCAGCCCCTGG + Intronic
1121013604 14:90535411-90535433 TCCCCAGGGCTCCCTGGCTTGGG + Exonic
1121092337 14:91191283-91191305 TCCCCTCTCCTCCCAGCCACTGG - Intronic
1121092481 14:91192329-91192351 TCCCCTCTCCTCCCAGCCACTGG - Intronic
1121631164 14:95422849-95422871 TCCCCAAGACTCCCAGGAAGGGG + Intronic
1121749691 14:96340543-96340565 TCCCCACTGTTCCCAGCCTCTGG - Intronic
1121757050 14:96411927-96411949 TCCCCATGGCTCCCAGTCCTTGG - Intronic
1121961786 14:98266625-98266647 TCCCCAAGGCCCCTAGGCCCTGG - Intergenic
1122178766 14:99939577-99939599 CCCCCACGGCTCCCTTGCTCCGG + Intronic
1122293819 14:100693939-100693961 TACCCACCCCTCCCAAGCACTGG + Intergenic
1122882663 14:104697043-104697065 ACCCCAGGGCTGCCAGGCTCAGG + Intronic
1123931095 15:25172013-25172035 TGCCCTCCACTCCCAGGCACAGG + Intergenic
1128783407 15:70377597-70377619 TTCCCACAACTCCCAGGCTCTGG - Intergenic
1128980569 15:72182777-72182799 TCCCCTCTGCCCCCAGGCCCTGG - Intronic
1129016535 15:72474184-72474206 TCCCCTCGGGTCCCAGGCCCAGG + Intergenic
1129648094 15:77456596-77456618 TGCCCACGCCTCCCAGGTTCAGG - Intronic
1131098239 15:89669448-89669470 CCCACAGGGCTCCCAGGCACCGG + Intronic
1131249166 15:90819516-90819538 TCCCCATGGGTCCCACACACAGG + Intergenic
1132368614 15:101277231-101277253 TTCCCAGGCCTCCCAGGCTCCGG + Intronic
1132577571 16:671018-671040 TCCCCACACTCCCCAGGCACAGG - Intronic
1132622247 16:873356-873378 TCGCCTCCGCTCCCAGCCACCGG - Intronic
1132648357 16:1009452-1009474 TCCCCACTGCTCACAGACCCCGG - Intergenic
1132661267 16:1062530-1062552 TCCCCTCGGCTCCCACGGCCGGG - Intergenic
1133025384 16:2986962-2986984 TCCCCAGGGCTCACACCCACAGG - Intergenic
1134124168 16:11605099-11605121 CCCTCAGGGCTCCCAGGAACAGG + Intronic
1136449859 16:30347740-30347762 TCACCCAGGCTCCCAGGCAGGGG - Intergenic
1136617985 16:31410400-31410422 TCCCCACAGCCCCCAGGAAGAGG - Exonic
1137787982 16:51152626-51152648 TGCCCAGGGGTCCCAGGGACTGG - Intergenic
1140097054 16:71884068-71884090 GCCCCTCGGCTCCCCGCCACCGG - Exonic
1141456337 16:84144949-84144971 TCACCACGCCCCCCAGGCCCCGG - Intronic
1141505839 16:84477850-84477872 TCCCCCAGGCTCCCAAGCCCGGG + Exonic
1141645471 16:85365080-85365102 ACCCCACAGCTGCCAGTCACTGG - Intergenic
1142668984 17:1478785-1478807 TCCCACCTGCTCCCAGGCTCAGG + Intronic
1142956586 17:3527077-3527099 TGCCTACGCCCCCCAGGCACAGG - Intronic
1143056922 17:4169474-4169496 TCCCCAAGTCTCCCGGGCAAGGG - Intronic
1143594739 17:7907452-7907474 TCCCCACGGTACCCAGGTTCAGG - Exonic
1144598954 17:16596496-16596518 TCCCCCCTCCTCCCAGGCTCTGG - Intergenic
1144620810 17:16817356-16817378 TCCCCAGGCCCCACAGGCACAGG - Intergenic
1144668304 17:17116858-17116880 TCCCCAGGGCCCCAAGGCAAGGG + Intronic
1145252562 17:21304562-21304584 TCCCCAAGCCCCCCAGGCTCAGG + Intronic
1145324002 17:21783347-21783369 TCCCCAAGCCCCCCAGGCTCAGG - Intergenic
1145883053 17:28365526-28365548 TCTCCAGTGCTCCCAGGCACTGG + Intronic
1147572200 17:41578259-41578281 TCCCCAGGCCCCACAGGCACAGG - Intergenic
1147763931 17:42820182-42820204 TACCCACAGCTGCCAGTCACTGG - Intronic
1150103925 17:62447928-62447950 TACCCATGGCAGCCAGGCACTGG + Intronic
1151200672 17:72465645-72465667 ACGTCACGTCTCCCAGGCACTGG + Intergenic
1151390841 17:73785793-73785815 ACCTCACAGCTCCTAGGCACTGG - Intergenic
1151796008 17:76346330-76346352 TCCTCTCGGCTCCCAGGAAGAGG + Intronic
1151898786 17:76998001-76998023 TCCCGACGGCTCACAAGCAGGGG - Intergenic
1152064742 17:78104677-78104699 TCCCCTTGCCACCCAGGCACGGG - Exonic
1152147980 17:78580693-78580715 ACCCCAGAGCTCCCAGACACAGG + Intergenic
1152362616 17:79839571-79839593 TCCCCCCGCCGCCCAGGCCCGGG - Intergenic
1153508561 18:5828975-5828997 TCACCAGGGGTCCCTGGCACTGG + Intergenic
1154502252 18:15002778-15002800 GCCACAAAGCTCCCAGGCACAGG + Intergenic
1155043191 18:22082271-22082293 TAGCCACTGCTCCCAGCCACTGG + Intergenic
1157601615 18:48896671-48896693 TACCCACAGCTTCCAGGCAGAGG + Intergenic
1157762335 18:50274112-50274134 TGCCCACCACTTCCAGGCACTGG + Intronic
1157897709 18:51484593-51484615 GCCCTGCGGCTCCCAGGCACAGG + Intergenic
1158503183 18:58022035-58022057 TCCCCATGGCTCCCCGACCCAGG - Intergenic
1160024927 18:75209225-75209247 TCCCCCCGCCTCCCCGGCGCCGG + Exonic
1160851560 19:1195307-1195329 TCCCCCCGGCTCCGATGCCCAGG - Intronic
1160851984 19:1197121-1197143 TCCCCCCGGCTCCGATGCCCAGG - Intronic
1160915885 19:1496301-1496323 TCTGCATGGCTCCCAGGCCCTGG + Exonic
1160982677 19:1823529-1823551 TGCCCACGGCCCCCCGGCACAGG + Intronic
1161061094 19:2215363-2215385 TCCTCCCTGCTCCCAGGCAGAGG + Intronic
1161165345 19:2784003-2784025 TCCAAACGGACCCCAGGCACAGG + Intergenic
1161216838 19:3098839-3098861 TCCCCACGTCTCCCTGGCCTGGG - Intronic
1161219848 19:3113531-3113553 TCCCGAAGGGTCCCAGGCACCGG - Intronic
1161301408 19:3544668-3544690 TCCCCACAGTTCCCTTGCACAGG + Exonic
1161353045 19:3804337-3804359 TCCCCGGGTCCCCCAGGCACGGG + Exonic
1161456823 19:4373780-4373802 TCCCCACGGCCCCCAGGCTGTGG + Intronic
1161662293 19:5554292-5554314 TCCCCACCGCTCCCTGGCGCTGG + Intergenic
1161723305 19:5915303-5915325 TGCTCACAGCTGCCAGGCACTGG - Exonic
1161998854 19:7730853-7730875 ACCCTGCGGCTCCCAGGCTCGGG - Exonic
1162007316 19:7788780-7788802 ACCCCGCGGCTCCCAGGCTCGGG + Intergenic
1162413084 19:10517958-10517980 TTCCCGCTGCTCCCGGGCACAGG + Intergenic
1162904926 19:13817763-13817785 TCCCCAGGGCTCCCGGGCACAGG - Exonic
1162917366 19:13881611-13881633 TCCCAGCGGCTCCCAGGGTCTGG + Intergenic
1163322828 19:16584569-16584591 TCCCCACTGCTCCCAGGGTGTGG - Intronic
1164686778 19:30172088-30172110 GGCCCACGGGTGCCAGGCACTGG + Intergenic
1165013855 19:32866811-32866833 TCCCCTCTGCTGCCAGGCATGGG + Intronic
925618731 2:5769228-5769250 TCCCCATGTCCCCCAGGCCCTGG - Intergenic
926142390 2:10375429-10375451 CCCCCACGGCTCTGATGCACAGG - Intronic
926681298 2:15665897-15665919 TCCCCACGCCTCCCCAGCACTGG + Intergenic
927419424 2:22914650-22914672 TCCCCACCCTTCCCAGACACTGG - Intergenic
927636657 2:24821640-24821662 TCTCCACGGTCCCCTGGCACAGG - Exonic
929509620 2:42556492-42556514 TCAGCATGGCTCCCAGGCACTGG - Intronic
929585210 2:43109514-43109536 TCCCCATGGCCCCCAGGCTTTGG - Intergenic
931868287 2:66434255-66434277 TCCCAGCGGCTCCCCGGCCCCGG + Intronic
932332289 2:70904624-70904646 ACCCTACTGCTCCCAGACACAGG - Intronic
934552955 2:95273148-95273170 TCTCCAAGGCTCCCAGTCAGGGG + Intergenic
938501426 2:131832950-131832972 GCCACAAAGCTCCCAGGCACAGG + Intergenic
938760688 2:134423152-134423174 TGACCATGGATCCCAGGCACAGG + Intronic
944356239 2:198791985-198792007 TCCTCACAGCTCACAGCCACTGG - Intergenic
947528594 2:230894400-230894422 TCTTCACGGCTCCCAGCCTCGGG - Intergenic
948991796 2:241559244-241559266 TCCCCGAGGCTGCCAGGGACCGG - Intronic
1172620529 20:36315790-36315812 TCCCCAAGCCTTCCCGGCACTGG + Intronic
1173507330 20:43598283-43598305 TCCCCACCTCCCCCAGGCCCTGG - Intronic
1174282647 20:49450374-49450396 TCCCCACCCCTCCCTGGCACAGG + Intronic
1174553552 20:51378464-51378486 TCCCCACGCCTCCCAGCCAAGGG - Intergenic
1175264281 20:57693146-57693168 ACCCCACGCCTCCCAGGGCCAGG + Intronic
1175705208 20:61171661-61171683 TCTCCACGACCTCCAGGCACAGG - Intergenic
1175724501 20:61308586-61308608 TTCCCATCACTCCCAGGCACAGG - Intronic
1175781266 20:61683839-61683861 ACCCCACGGCAGGCAGGCACAGG - Intronic
1175837819 20:62007509-62007531 GCCCTACTGCTCGCAGGCACCGG + Intronic
1176037066 20:63044737-63044759 TGCACAGGGCTCCCAGGCCCCGG + Intergenic
1176060231 20:63169301-63169323 AGCCCACAGATCCCAGGCACAGG + Intergenic
1178915065 21:36701445-36701467 GCCCCGCGGCTCCCCGGCCCAGG + Intronic
1178915599 21:36704135-36704157 ACCCAAAGGCACCCAGGCACTGG - Intronic
1179323101 21:40312215-40312237 ACCCCAAGGCTCCCAGGGATTGG + Exonic
1179868462 21:44230197-44230219 TCCCCAAGGCTCCCAGCTCCAGG + Intronic
1180116280 21:45707566-45707588 TCCCCACGCCTCACATCCACTGG - Intronic
1180816361 22:18792103-18792125 TCAGCATGTCTCCCAGGCACAGG + Intergenic
1180842752 22:18966933-18966955 GCCCCCCAGCTCCCTGGCACCGG + Intergenic
1180968465 22:19802603-19802625 TCTCCACTTCTCCCATGCACAGG + Intronic
1181058696 22:20271801-20271823 ACCCCCCAGCTCCCTGGCACTGG - Intronic
1181164642 22:20976785-20976807 GCCCCAGGGCTCCAAGGCACTGG - Intronic
1181202550 22:21226435-21226457 TCAGCATGTCTCCCAGGCACAGG + Intronic
1181560526 22:23697149-23697171 TCCCCACCCCTCCTTGGCACAGG + Exonic
1183098914 22:35571289-35571311 TCCCCAGGCCTCCGAGGCACCGG + Intergenic
1183189701 22:36313969-36313991 CACCCAGGCCTCCCAGGCACTGG + Intronic
1183420555 22:37709281-37709303 TCCCCAGGGATCCCAGGCCCAGG + Intronic
1185041747 22:48507782-48507804 TCCCGACAGCTCCCAGGCAGGGG - Intronic
1185333606 22:50262032-50262054 TCCCCACGGCTCCAGGGCGCAGG + Intergenic
1203224365 22_KI270731v1_random:68978-69000 TCAGCATGTCTCCCAGGCACAGG - Intergenic
1203266461 22_KI270734v1_random:17814-17836 TCAGCATGTCTCCCAGGCACAGG + Intergenic
950456784 3:13097443-13097465 TGCCCAAGGCTCCCAGACCCTGG + Intergenic
950465038 3:13148677-13148699 TCCCCGGGGCTCCCTGGCCCAGG + Intergenic
953996617 3:47524684-47524706 TCCACCCGGCTCCCAGCTACCGG + Intergenic
954124537 3:48520819-48520841 TCCCAAGGGCTGCCAGGCCCAGG + Intronic
955069158 3:55557757-55557779 TCCCTATGGCTTCCAGCCACAGG + Intronic
957732687 3:84161822-84161844 TCCCCCCGGCCCCCAAGCCCTGG + Intergenic
957926219 3:86815361-86815383 TCCCAACAGCTGCCAGTCACAGG - Intergenic
957939885 3:86991104-86991126 TCCCCACGGCTGCCCGACCCGGG - Exonic
961539189 3:127589065-127589087 ACCCCAGGCCTCCCAGGAACAGG + Intronic
961692630 3:128681012-128681034 TCACCGCGTCTCCCAGGGACAGG - Intronic
963593974 3:147301709-147301731 TCCCCCCGTCCCCCAGGCAGGGG - Intergenic
967938013 3:194744750-194744772 TCCCCAGAGCTCCTAGGGACTGG + Intergenic
968506346 4:973043-973065 GCCCCACGGCGCACAGGCCCCGG + Intronic
968705302 4:2074840-2074862 TCCCCACAGCACCCAGCCACTGG - Intronic
969114102 4:4860474-4860496 AGCCCACGGCTCCCTAGCACCGG - Intronic
969455017 4:7295617-7295639 CCTCCAGGGTTCCCAGGCACAGG - Intronic
971349412 4:25843097-25843119 TCCCCACTGCTTCCAGCCACAGG - Intronic
972565465 4:40265288-40265310 TCCCCAAGGAGCCCAGGCCCAGG - Intergenic
973792967 4:54395167-54395189 TACCCATGGCTCTGAGGCACAGG - Intergenic
980391225 4:132150378-132150400 TCCCAACTGTTCCCAGGCTCTGG + Intergenic
984923106 4:184783115-184783137 TCCACACGGCACCCCGGAACAGG - Intronic
985614414 5:910905-910927 TCACCCCGGCGCGCAGGCACAGG + Intronic
987299900 5:16588035-16588057 TCCCCACTGCTCCCAGTCTGAGG + Intronic
989152731 5:38316367-38316389 TCCCCAAGGGCCCCAGGCTCTGG + Intronic
992546352 5:77817636-77817658 GTCCCACGCCTCCCAGGAACAGG - Intronic
994954269 5:106507193-106507215 TCCCCACAGCTCCCAGCCTCTGG - Intergenic
995192120 5:109329096-109329118 ACCCCACTCCTCCCAGCCACAGG - Intergenic
995666098 5:114544461-114544483 ACCCCACGGCCCCCAGCCAAGGG + Intergenic
999252322 5:150190218-150190240 CCCCCGCGGCTCCCGCGCACCGG - Exonic
1000637356 5:163659455-163659477 TCCCCAAGGCTGGAAGGCACTGG + Intergenic
1001437294 5:171710062-171710084 TCCCCAAGGCTCTCAGGCACCGG + Intergenic
1001747571 5:174103528-174103550 TCCCCACCGCGCCCCAGCACTGG - Intronic
1002211430 5:177601756-177601778 TCCCAGTGGCTCCCAGGCCCAGG - Intronic
1002382373 5:178839974-178839996 TCCCAAAGGCTCTCAGGGACCGG - Intergenic
1002470975 5:179435983-179436005 TCCCCACCCCTCCCAGGCATGGG - Intergenic
1002648203 5:180672701-180672723 TCCCAAAGGCTCTCAGGGACCGG + Intergenic
1003506996 6:6748302-6748324 TCCCCACGGCTCCGTGCCTCCGG + Intergenic
1004562420 6:16762205-16762227 TCCCCGCGGCCCCCAGGCCTGGG - Intergenic
1005361912 6:25038914-25038936 TCCCCACGGGGGCCAGGCCCTGG - Intronic
1006612545 6:35303065-35303087 CCCCTACCGCACCCAGGCACAGG + Intronic
1006846888 6:37068603-37068625 GCCCCTCTGCTCCCAGGCACTGG - Intergenic
1008196735 6:48533741-48533763 TCCCCAAGTTTCCCAGTCACGGG - Intergenic
1010787758 6:80024584-80024606 TCCCCACTGCTCCCAGCCCCTGG - Intronic
1013155382 6:107488424-107488446 TCCCCTCGCCTCCCCGGGACGGG + Intergenic
1013360711 6:109391538-109391560 TCCCCAGGGTTCCCAGGCGTGGG - Intronic
1015704892 6:136077036-136077058 TCCTCCAGGCTCCCTGGCACAGG - Intronic
1016824982 6:148379903-148379925 TCACCACCCCTCCCAGGCCCAGG + Intronic
1019161934 6:170074722-170074744 TCCACCCGGCTCCCAGGCCCAGG - Intergenic
1019295464 7:271871-271893 TCCCCTCTCCTCCCAGGCAGAGG + Intergenic
1019395936 7:817478-817500 TCCCCAGGGCTCCCCAGGACAGG + Intronic
1019613375 7:1948004-1948026 CTCCCACCGCTCCCGGGCACTGG - Intronic
1019639763 7:2097126-2097148 ACCCCATGGCACCCAGGCACAGG + Intronic
1019685887 7:2382033-2382055 TCCCCACGGCTGGCGGGCTCAGG + Intergenic
1019710859 7:2517607-2517629 TCCCCACAGTTCCCAGGCCAGGG - Intronic
1019990416 7:4686512-4686534 TCGCCAGAGCTCCCAGGCACAGG + Intronic
1022508659 7:30921973-30921995 TACCCAGGCCTCCCAGGCCCAGG - Intronic
1024526555 7:50354406-50354428 TTCCAAAGCCTCCCAGGCACAGG + Intronic
1026911711 7:74094969-74094991 TCCCCTAGGCTCCCAGACAAAGG + Intronic
1027239875 7:76320142-76320164 TCCCCACCTCCCCCAGGCATAGG + Intergenic
1029437148 7:100569760-100569782 TCCTCACGTCGCCCAGGAACTGG - Intergenic
1030632268 7:111908702-111908724 CCCCCACCGCCCCCAGGCCCTGG + Intronic
1031956862 7:127951409-127951431 TTCCCAAGGCTCCCAGACCCTGG - Intronic
1035331170 7:158098342-158098364 TCCCGAAGGCTCCGAGGGACGGG + Intronic
1035926793 8:3736573-3736595 TCACCATGGCTCCCAGGCCCTGG + Intronic
1039484340 8:37899396-37899418 ACCACACGGCCCCCAGGCCCCGG + Exonic
1040422263 8:47251644-47251666 TCCCCCCAGTTCCCAAGCACAGG - Intergenic
1040580656 8:48696173-48696195 CCCCCATGGCTTCCAGCCACAGG - Intergenic
1045111697 8:98942684-98942706 TCCCCAAGCCTCCCACTCACGGG - Intronic
1045507482 8:102788946-102788968 TCCCCAGGGCTCCTAGGGAGTGG + Intergenic
1047271810 8:123367533-123367555 TCCCCACCACCACCAGGCACAGG - Intronic
1047946625 8:129887171-129887193 TCCCCAGGGCAGCCAGGCCCTGG - Intronic
1047992254 8:130298189-130298211 TTCCCTTGGCTCCCAGACACTGG - Intronic
1048557505 8:135494837-135494859 TCCCCACAGCTTCCAGCCAAAGG - Intronic
1049071013 8:140356137-140356159 CCACCACCACTCCCAGGCACGGG + Intronic
1049219022 8:141420450-141420472 ACCCCAAAGCTCCCAGGCAAAGG - Intronic
1050064041 9:1739954-1739976 TCACCATGGCTGCCATGCACAGG - Intergenic
1053064424 9:35057490-35057512 TCTCGACGGATCTCAGGCACTGG + Exonic
1053482227 9:38424202-38424224 CGCCCTCGGCTCCCAGGCAGCGG + Exonic
1054745030 9:68845372-68845394 CCCCCACGGCTCCACGGCTCTGG - Intronic
1055432475 9:76258041-76258063 TTTCCACAGCTCCCAGGTACAGG + Intronic
1057274428 9:93668770-93668792 TGCACACTGCTCCGAGGCACGGG - Intronic
1057858141 9:98618124-98618146 TCCCCATGGCTGTCAGGCTCAGG + Intronic
1061505562 9:131029906-131029928 TCCCCACTGAACCCAGGCACTGG - Intronic
1061695015 9:132366747-132366769 TCCCCACTTCTCTCAGGCTCTGG + Intergenic
1061758163 9:132830033-132830055 TCCCCACAACCCCCAGCCACCGG - Intronic
1061857387 9:133449725-133449747 TCCCCTGGGTTCCCAGGCCCTGG + Intronic
1062334314 9:136058327-136058349 TCCCCACGGCTCCCAGTGCCTGG + Intronic
1062498230 9:136841573-136841595 GCCACAAGGCTCCCAGGCAGAGG - Intronic
1189432898 X:40964777-40964799 TCCCCCCGCCCCCCAGGCCCTGG - Intergenic
1189522383 X:41783433-41783455 TCCCTCAGCCTCCCAGGCACAGG - Intronic
1189901170 X:45707842-45707864 TCCCCACTCCTCCCAGCCTCTGG - Intergenic
1192161179 X:68789074-68789096 TCCCCACTGTTCCCATGGACAGG - Intergenic
1192168007 X:68838067-68838089 TCCCCGCAGCTCCCAGCCAAAGG - Intronic
1196164680 X:112525903-112525925 TCCCCAGGGATCCCAGTTACTGG - Intergenic
1199571379 X:149270299-149270321 CCCCCACATGTCCCAGGCACAGG + Intergenic
1200115731 X:153768953-153768975 TCTCCACGGCTCCCAGGGCCAGG + Exonic