ID: 1078608189

View in Genome Browser
Species Human (GRCh38)
Location 11:12796076-12796098
Sequence GTGCAGAAACTGGGCCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 327}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078608189 Original CRISPR GTGCAGAAACTGGGCCAGGA GGG Intronic
900546440 1:3231825-3231847 GTGGAGAAGCTGAACCAGGAAGG - Intronic
900792348 1:4688910-4688932 GTGGAGAAACTGAGGCAGGGAGG + Intronic
901185108 1:7367934-7367956 GTGCAGGCACTGGGCATGGATGG + Intronic
901185168 1:7368222-7368244 GTGCAGGCACTGGGCATGGATGG + Intronic
901185193 1:7368350-7368372 GTGCAGACACTGGGCATGGATGG + Intronic
901640438 1:10690464-10690486 GATCAGAAGCTGGGCCAGGCTGG - Intronic
902078640 1:13806190-13806212 GTGCAGAGACTGGGAGAGGGCGG - Intronic
902817344 1:18923888-18923910 GTGCAGAACTCGGGGCAGGAAGG - Intronic
903066030 1:20700015-20700037 GTGCAGAAACTCAGTCTGGAGGG + Intronic
903700400 1:25243167-25243189 GTGAAGATACTGGGGCAGCAGGG + Intronic
903787692 1:25872297-25872319 TTGGAGAAACAGGGCCAAGAGGG - Intergenic
903911611 1:26730981-26731003 CTGCCTAAACTGAGCCAGGAAGG - Intronic
904130515 1:28272321-28272343 CTGCAGAAACTCGGCCATGTGGG - Exonic
904534139 1:31188113-31188135 GTGCAGGAAGTTGGCTAGGATGG + Exonic
904709474 1:32417989-32418011 TTGGAGGAACAGGGCCAGGAAGG - Intergenic
905295536 1:36952055-36952077 ATGCAGAAACAGGGTCAGCAAGG + Intronic
905734559 1:40316625-40316647 GGGCAGAGACTGGGCCCGGTCGG - Intronic
905891153 1:41519185-41519207 GTGCAGACACAGGACCAGGGTGG + Intronic
906058749 1:42935033-42935055 GTGAAGAGACTGGGCTGGGAAGG - Intronic
906914614 1:49995175-49995197 GCACAGAAACTGGGGCAGGTGGG + Intronic
907277523 1:53325529-53325551 GTGAGGAAACTGAGGCAGGAGGG + Intronic
907317248 1:53580227-53580249 GTGCAGGAACCAGGTCAGGATGG - Intronic
907919946 1:58903161-58903183 GTGCAGTCAGTGGGGCAGGAGGG + Intergenic
908244275 1:62215296-62215318 TTGCAGCAACTGGCCCAGAACGG - Intergenic
908347699 1:63252204-63252226 ATTCAGAAAATGGGCCAGGCAGG - Intergenic
908431603 1:64064007-64064029 CAGCAGAAACTGTGCCTGGATGG + Intronic
912261754 1:108117933-108117955 TTGGAGAAACTGGACTAGGAAGG + Intergenic
914288964 1:146254990-146255012 CAGCAGAAACTGGGCCTGGCTGG + Intergenic
915170525 1:153974077-153974099 GATCAGGAAGTGGGCCAGGAAGG - Exonic
915600963 1:156923151-156923173 CTGCAGGAGCTGTGCCAGGAGGG - Intronic
916051151 1:161038125-161038147 GTTCGGAAGCTGGGCCTGGAAGG + Intronic
917871858 1:179249282-179249304 GCACAGAAGCAGGGCCAGGAAGG + Intergenic
919588185 1:199465267-199465289 GTGCAGAAACTTAGCAAGGCTGG + Intergenic
919931237 1:202222657-202222679 GCGCAGAAGCTGGGCCAGATCGG - Intronic
920174897 1:204094555-204094577 GGGCAGAGAGAGGGCCAGGAAGG + Intronic
920365861 1:205448130-205448152 GTGAGGAAACAGGGCCAGAAGGG + Intronic
920847972 1:209609342-209609364 GTTTAGAAGATGGGCCAGGAGGG + Intronic
921072188 1:211670086-211670108 GCGCAGAAGGTGGGCCAGCAAGG + Intronic
922221727 1:223613499-223613521 CAGCAGAAACTGAGCCAGGCAGG + Intronic
923087663 1:230713716-230713738 GTGCAGGAATTGGGGCTGGAGGG - Intronic
923089511 1:230729126-230729148 GTGGAGAAACTGCACCAGGCAGG - Intergenic
923978262 1:239289502-239289524 GTGCAGAAAATGAGCCAGTGTGG - Intergenic
1062760565 10:13570-13592 GTGCAGGGAGTGGGCCAGGGAGG - Intergenic
1063842650 10:10089488-10089510 CTGCAGGAACAGAGCCAGGATGG - Intergenic
1064357683 10:14634645-14634667 AGGCAGAAACTGGAGCAGGAAGG + Intronic
1064388603 10:14921738-14921760 GAGGAGAAGCTGGGCCAAGATGG - Intronic
1064609251 10:17080015-17080037 GAGCAGAAGCTGAGGCAGGAAGG - Intronic
1065440592 10:25749815-25749837 GTGAACAAACTGGGCAAAGATGG + Intergenic
1068496761 10:57792532-57792554 TTGGAGGAACAGGGCCAGGAAGG - Intergenic
1068773683 10:60849477-60849499 GTCCCTCAACTGGGCCAGGAGGG - Intergenic
1069132259 10:64720757-64720779 GTGAAGGAACTGAGCCAAGATGG + Intergenic
1069173020 10:65256141-65256163 GTCAAGAAACTGGGCACGGAAGG + Intergenic
1069874710 10:71554604-71554626 GTCCAGAAGCTGGGCCATCACGG - Intronic
1070403852 10:76077143-76077165 ATGCAGCACCAGGGCCAGGAAGG + Intronic
1070709033 10:78664138-78664160 GGGCTGAAAGTGGGCTAGGATGG + Intergenic
1070739870 10:78895705-78895727 GGGCAGGGACTGGGCCAGGGAGG + Intergenic
1071989463 10:91087087-91087109 TGGCAGAAACTGTGCGAGGAAGG - Intergenic
1073070903 10:100792670-100792692 AGGCAGAAACTGGCCAAGGATGG + Intronic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1074266922 10:111913966-111913988 GAGCAGAACATTGGCCAGGAAGG + Intergenic
1074507012 10:114080000-114080022 GTGCAGAAACAGGGTCAGTTTGG - Intergenic
1075067635 10:119300235-119300257 GTGCAGGAAGTGAGCCAGCAAGG + Intronic
1075444017 10:122501249-122501271 GAGCAGAATCTGGGCAAGGCAGG - Intronic
1075827737 10:125374242-125374264 GTGCAGACACTGGGAGAAGACGG - Intergenic
1075900870 10:126041936-126041958 CTGCAGAAACAGTGCAAGGAAGG - Intronic
1075996236 10:126878477-126878499 GTGCAGACAGAGAGCCAGGATGG - Intergenic
1076144255 10:128104596-128104618 GTGCAGAAACTGGACCTGCTAGG - Exonic
1076144486 10:128106411-128106433 GTGCAGAAACTGGACCAGCCAGG - Exonic
1076144703 10:128108235-128108257 GTGCAGAAACTGGACCTGGCAGG - Exonic
1078195970 11:9137446-9137468 GTGCAGAAGCTGAGGCAGGCAGG + Intronic
1078360876 11:10666835-10666857 TTGTGGAACCTGGGCCAGGAAGG - Intronic
1078608189 11:12796076-12796098 GTGCAGAAACTGGGCCAGGAGGG + Intronic
1080660691 11:34293572-34293594 GTGCAGGAACTGTTCCGGGAAGG + Intronic
1081759979 11:45570400-45570422 GGGCTGACTCTGGGCCAGGATGG - Intergenic
1083303124 11:61749091-61749113 GGGCAGAGGCTGGGGCAGGAAGG - Intergenic
1083882496 11:65555445-65555467 GTGGAGACACTGAGCTAGGAAGG - Intronic
1084174151 11:67415107-67415129 GTGGAGACCCTGGCCCAGGAGGG + Intronic
1084969711 11:72764500-72764522 GTGAAGAAACTGAGGCAGGCCGG + Intronic
1086061433 11:82703578-82703600 GTGCAGACACTGAGCTAGGAGGG - Intergenic
1086110400 11:83192915-83192937 GTGGAAAAACTGGGCCGAGAGGG + Intergenic
1087115051 11:94515691-94515713 TTTCACAAACTTGGCCAGGAAGG - Intergenic
1089074045 11:115722955-115722977 GGGGAGAAAGTGGGCCAGGAGGG + Intergenic
1089692894 11:120197806-120197828 GTTCAGAGCCGGGGCCAGGAAGG - Intergenic
1090827714 11:130399568-130399590 GTAGAGAAGCTGGGCCATGAGGG + Intergenic
1092523989 12:9298446-9298468 ATGCACAAACTGGGCCAGCTGGG - Intergenic
1092543281 12:9433368-9433390 ATGCACAAACTGGGCCAGCTGGG + Intergenic
1092993541 12:13926499-13926521 CTGGAGAAACTGGGGAAGGAGGG - Intronic
1094509742 12:31089069-31089091 ATGCACAAACTGGGCCAGCTGGG - Exonic
1096240476 12:49957244-49957266 GTTAAGAGGCTGGGCCAGGATGG - Exonic
1096791873 12:54050446-54050468 GTGCAGCCCCTGGGCCAGCAAGG + Intronic
1097264342 12:57737246-57737268 GGGCTGAAACGGGGCCGGGAGGG - Exonic
1098244666 12:68504072-68504094 GTGTAAAATCTGGGCCAGGGTGG + Intergenic
1101782741 12:107850029-107850051 CTGGAGAATCTGGGGCAGGAGGG - Intergenic
1103238945 12:119397857-119397879 GGGCAGAAAGTGGGGCAGGGAGG + Intronic
1105308085 13:19182823-19182845 TTGTAGAAACGGGGGCAGGACGG - Intronic
1105814101 13:24017689-24017711 GTGCAGAAACTCGGTAAGAAGGG + Exonic
1106150307 13:27094211-27094233 GTGGAGAAACTGGCCCAGCACGG + Intronic
1111140406 13:84111034-84111056 ATGAAGAAACTGAGCCAGGTGGG + Intergenic
1112091823 13:96090944-96090966 GTGCAGGAGCTGGTGCAGGAGGG - Exonic
1112683074 13:101789374-101789396 GATCAGAAACTGGGGCATGAAGG - Intronic
1113533110 13:111043754-111043776 GTGCAGAGGATGGGCCTGGAGGG - Intergenic
1113887303 13:113667712-113667734 GTCCAGGTACTGGGCCAGGATGG - Exonic
1115847237 14:37553305-37553327 GTGAAGAAAGAGGGCCTGGATGG - Intergenic
1116069639 14:40027054-40027076 TTCCAGAGACTGGTCCAGGATGG - Intergenic
1116504055 14:45656024-45656046 GGGCAGACACAGGGCAAGGAAGG - Intergenic
1116583680 14:46674822-46674844 CTGGAAAAACTGGGCCAGAAGGG + Intergenic
1117002368 14:51383860-51383882 ATGCAGAGACTAGGCCAGAAGGG - Intergenic
1120191913 14:81447266-81447288 GCTCAGAAACTGACCCAGGATGG - Intergenic
1120194288 14:81465821-81465843 CTCCAGAAATTGGGTCAGGAGGG - Intergenic
1121115193 14:91338416-91338438 GTCCAGTAACGGGGCCTGGAGGG - Intronic
1121487622 14:94330870-94330892 GCACAGAAGCTGAGCCAGGAGGG + Intergenic
1121487630 14:94330924-94330946 GCACAGAAGCTGAGCCAGGAGGG + Intergenic
1121584096 14:95051112-95051134 GTGCAGAGACAGAGCCAGGCAGG - Intergenic
1121636204 14:95455441-95455463 CTGCAGAGGCTGGCCCAGGAGGG - Exonic
1122036308 14:98951557-98951579 GTGCAGAAGCAAGGCCAGGATGG + Intergenic
1122715915 14:103696973-103696995 GGGCAGGAACTGAGCCAGCATGG + Intergenic
1122862147 14:104587503-104587525 GTGAAGAGACGGGGTCAGGAGGG + Intronic
1122893528 14:104744033-104744055 GTGCCGAAGATGGACCAGGAAGG + Intronic
1122985278 14:105208929-105208951 AAGCAGCAACTGGGCCAGGGTGG - Intergenic
1125290849 15:38145207-38145229 ATGCAGAAACTAGGCCTGGAGGG - Intergenic
1127203381 15:56684033-56684055 GTGCAGAAGCTGAGGCAAGAAGG + Intronic
1128737618 15:70062102-70062124 GGGCAGAAACTTGGCCGGGTAGG - Intronic
1129190991 15:73937530-73937552 GCACAGAGCCTGGGCCAGGATGG - Intronic
1129676309 15:77633816-77633838 ATACAGAAACTAGGCCAGCAGGG + Intronic
1130972026 15:88741196-88741218 GTGGAGAAACTGTGGAAGGATGG + Intergenic
1131785171 15:95904839-95904861 GAACAGAAACAGGGCCAGGAGGG - Intergenic
1131868693 15:96738953-96738975 ATGGAAAAACTAGGCCAGGAGGG + Intergenic
1132734501 16:1378869-1378891 GGTGAGAAAGTGGGCCAGGACGG - Intronic
1132931850 16:2462688-2462710 GTGCAGACACTGGCCCACCATGG - Exonic
1133024564 16:2982462-2982484 ACGCAGAAACTGGGGCAGGCAGG - Intergenic
1134392724 16:13834340-13834362 GTGACAAAAGTGGGCCAGGAAGG - Intergenic
1135039351 16:19106064-19106086 GAGCAGAAACTGGGCCACCAAGG + Intergenic
1135492200 16:22919232-22919254 CTGCAGCAACTGGCCCAGAATGG - Intergenic
1136030008 16:27495907-27495929 GTGCAGCACCTGCGGCAGGAGGG + Intronic
1137757494 16:50914293-50914315 GTGCAGAAGGCTGGCCAGGAAGG - Intergenic
1138008022 16:53355468-53355490 ATGGGGAAACTGGGCCAAGAGGG + Intergenic
1138315184 16:56063858-56063880 GTGCTAACACGGGGCCAGGAAGG - Intergenic
1138540623 16:57685222-57685244 GTGCAGGCAGTGGGCCAGGTGGG + Intronic
1139514490 16:67445257-67445279 GGGCAGAGGCTGGGCCTGGAGGG + Intronic
1139529122 16:67533649-67533671 GTACAGAAACTGGACCAGGGTGG + Intronic
1139548691 16:67661665-67661687 GTGCAGAAGCGGGGTGAGGAGGG + Exonic
1141455211 16:84136672-84136694 GTTGAGAAGCTGGGCCATGATGG - Intronic
1141528894 16:84632189-84632211 TTGCAGAAACTGGGGAAGGCTGG - Intergenic
1141722775 16:85766048-85766070 CTGCAAAGAGTGGGCCAGGAAGG - Intergenic
1141819526 16:86435380-86435402 GTGCAGAAGCTGTGCCCAGAAGG - Intergenic
1142150290 16:88509658-88509680 GTGGAGAAACAGGCCCAGGGAGG + Intronic
1142540598 17:655717-655739 TTGCAGAAAGTGGGGCAGGATGG + Intronic
1142909035 17:3071597-3071619 GGGCAGAACCAGGTCCAGGATGG - Intergenic
1142925527 17:3232645-3232667 GGGCAGAACCAGGTCCAGGATGG + Intergenic
1144584100 17:16477618-16477640 GGGCAGAAGCCGGCCCAGGAAGG + Intronic
1144647528 17:16985574-16985596 GGGCAGAGGCTGGGACAGGATGG + Intergenic
1144747209 17:17623853-17623875 TTGCAGCGACTGGGCCAGGGGGG + Intergenic
1145059173 17:19721398-19721420 GTGCAGCACCTGGGCCTGGAAGG - Intergenic
1146458002 17:33022044-33022066 GAGCAGAAGCTGGCCCAGGATGG + Intronic
1146937414 17:36820903-36820925 ATGAAGAAACTGGTGCAGGAGGG - Intergenic
1148163929 17:45469095-45469117 GTGCAGGCACTGGGACAGCAAGG + Intronic
1149724092 17:58874950-58874972 GGACAGAAAATGGGGCAGGAGGG - Intronic
1149954972 17:61038541-61038563 TTCTAGAAACTGGGCCAGCACGG - Intronic
1150250906 17:63704033-63704055 GTGCTGGCACTGGGCCTGGAGGG + Exonic
1150395159 17:64815749-64815771 GTGCAGGCACTGGGACAGCAAGG + Intergenic
1151407919 17:73901498-73901520 GTGAGGAAACTGGGTCAGAAGGG - Intergenic
1151681244 17:75624023-75624045 CTGCAGAAACTTGGTCAGGTAGG - Intergenic
1151897670 17:76991258-76991280 AAGCAGGAGCTGGGCCAGGAAGG - Intergenic
1152225110 17:79089263-79089285 GTGCAGGACGGGGGCCAGGACGG - Intergenic
1152953472 18:13924-13946 GTGCAGGGAGTGGGCCAGGGAGG - Intergenic
1153788008 18:8552009-8552031 GTGCCTAAACTGTGACAGGAAGG - Intergenic
1154128267 18:11713555-11713577 CTGCAGCAACTGGCCTAGGATGG - Intronic
1154443294 18:14412164-14412186 GTGCAGAGTCTGTGCCATGAAGG - Intergenic
1156503641 18:37575574-37575596 GTGCAGAGACAGGGACAGGGTGG - Intergenic
1157117245 18:44873526-44873548 GTGTTGTACCTGGGCCAGGATGG + Intronic
1157483958 18:48073811-48073833 GTGCAGAAACTCGGGGAGCAAGG - Intronic
1157943521 18:51954755-51954777 GTACAAAAACAGGGCCAAGATGG + Intergenic
1158016311 18:52788731-52788753 TTGGAGGAACAGGGCCAGGAAGG + Intronic
1159911683 18:74152007-74152029 GTGTTGTAACTTGGCCAGGAGGG + Intronic
1160430967 18:78812294-78812316 GTGCAGACACTGTGCCTGCAGGG - Intergenic
1161269541 19:3382294-3382316 GTGGTGACACGGGGCCAGGAGGG + Intronic
1162018266 19:7857156-7857178 GTGCAGGGAAGGGGCCAGGAAGG - Intronic
1163013718 19:14441059-14441081 GGGCAGAGGCTGGGCCAGGCTGG + Intronic
1163034730 19:14564093-14564115 GTGCAGTAAGTGGGGCAGGTGGG + Exonic
1163295295 19:16407879-16407901 GTGGAGACCCTGGGCCAGAAGGG + Intronic
1163462315 19:17446551-17446573 GTGCTGAAAAGGGGACAGGAGGG - Intronic
1163569686 19:18073545-18073567 GTGGAGCAGCTGGGCCAGGATGG - Exonic
1164460628 19:28444525-28444547 AAGCTGAAACTGTGCCAGGATGG - Intergenic
1165094612 19:33403334-33403356 GTCCAGAACCAGAGCCAGGAGGG + Intronic
1165116760 19:33533387-33533409 GTGGAGAAGCTGCTCCAGGACGG + Intergenic
1165403621 19:35617309-35617331 CTGCAGGAACTGGGCCCGGAGGG - Exonic
1165543939 19:36517547-36517569 GTGGAGAAACTGGGCAAGAGTGG + Intronic
1166726998 19:45034493-45034515 GGGCAGGAAGTGGTCCAGGATGG - Exonic
1166851424 19:45763324-45763346 GGGCAGGATCTGGGACAGGAAGG - Exonic
1167037791 19:47004246-47004268 GGTCAGAAAGTGGCCCAGGAAGG + Exonic
1168639281 19:58020073-58020095 GTCCAGGAGCTGGGCCAGGCTGG - Intergenic
925260444 2:2524168-2524190 CTGCAGAGCCAGGGCCAGGAGGG - Intergenic
926135492 2:10332884-10332906 TTGCTGAGACTGGGCCAGGCAGG + Intronic
926240400 2:11080869-11080891 AGGCAGAAACAGGGCCAGGCCGG + Intergenic
927213955 2:20655721-20655743 TTGCTGAAGATGGGCCAGGATGG + Intergenic
927427277 2:22995452-22995474 GTGCAGAACCTGGGACAGAGGGG - Intergenic
929624276 2:43390300-43390322 GTGGATAAACAAGGCCAGGAAGG - Intronic
930765283 2:55079018-55079040 GTCCAGAAAAGGGGCCAGGAAGG + Intronic
932429359 2:71664802-71664824 GTGCTGCAACTGGGCCCGAAGGG + Intronic
932437061 2:71708085-71708107 GGGCAGAGACTGGGGCAGGATGG + Intergenic
932468684 2:71940013-71940035 GGGCAGAAGCAGGGCCAGGAGGG - Intergenic
932498313 2:72158619-72158641 ACGCAGAAACAGGGACAGGAAGG - Intergenic
932733321 2:74235772-74235794 GTTCAGAACCTGGCCTAGGAAGG - Intronic
933090128 2:78108271-78108293 CAGCAGAAACTGGGACATGAAGG - Intergenic
933844378 2:86313762-86313784 CTGCAGTAACTGGGCCAGGTGGG + Intronic
935660293 2:105460911-105460933 ATGCAAAAATTGGGACAGGAAGG + Intergenic
937456221 2:122043990-122044012 ATGCATTAACTGGGCAAGGAGGG + Intergenic
938077250 2:128346351-128346373 CTGCAGACCCTGGGCCAGGTGGG + Intergenic
938325203 2:130393764-130393786 GTGAGGAACCTGGGCTAGGAAGG - Intergenic
939996482 2:148925550-148925572 GTGAAGTAACTTGGCCAGGTTGG + Intronic
941080508 2:161055305-161055327 GAGCAGAGTCAGGGCCAGGAAGG + Intergenic
941635410 2:167930492-167930514 ATACAGAAACAGGGCCAGGAAGG + Intergenic
944282054 2:197909509-197909531 GAGGAGGAAGTGGGCCAGGAAGG - Intronic
944855545 2:203763805-203763827 GTGGAGAAAATGAGCCATGAAGG + Intergenic
944893966 2:204145307-204145329 TTGGAGACACTGGGTCAGGAAGG - Intergenic
945178120 2:207064262-207064284 CTGAAGAAACTGGCCCAGGGAGG + Intergenic
947918804 2:233852277-233852299 GTGCAGAGGCTGGGCCAGTTGGG - Intronic
947952586 2:234160977-234160999 GGGCAGAAAGTGCACCAGGAAGG + Intergenic
948100743 2:235370835-235370857 GTGGAGAGAATGGGCCAGGTGGG - Intergenic
948592640 2:239060994-239061016 TTGCTGAAAGTCGGCCAGGAAGG + Intronic
1169263375 20:4153423-4153445 GCTGAGGAACTGGGCCAGGAAGG + Intronic
1170131235 20:13022528-13022550 CTGGAGAAGCTGGGCCAGGAGGG + Intronic
1171399119 20:24860310-24860332 GTGCAGGAGCTGGGTCACGAGGG - Intergenic
1172198010 20:33105395-33105417 GGGCAGATTCTGGGCTAGGAAGG - Intronic
1172776836 20:37412723-37412745 CTGCAGAAAGGGGGCCAGGGAGG - Intergenic
1173250916 20:41363853-41363875 GTGCGGTACCTGGGCCAGGGAGG + Exonic
1173974021 20:47173711-47173733 ATGCAGATTCTGGGCCAGGCAGG - Intronic
1174366924 20:50062044-50062066 GCCCAGAGACTGGGCCAGCAGGG - Intergenic
1174396668 20:50251030-50251052 ATGCAGAAAAGGGGCCAGGATGG - Intergenic
1174466371 20:50720742-50720764 ATGAAGAAACTGAGTCAGGAAGG + Intergenic
1175229607 20:57465435-57465457 TTGGAGAGTCTGGGCCAGGAAGG - Intergenic
1176076324 20:63249998-63250020 GTGGACAAAGTTGGCCAGGATGG + Exonic
1176452795 21:6879044-6879066 GTGCAGAGTCTGTGCCATGAAGG + Intergenic
1176512506 21:7759355-7759377 CGACACAAACTGGGCCAGGACGG - Intronic
1176830968 21:13744093-13744115 GTGCAGAGTCTGTGCCATGAAGG + Intergenic
1178151566 21:29800369-29800391 GTGGGGAAAATGGGCCAGTATGG - Intronic
1178646619 21:34389880-34389902 CGACACAAACTGGGCCAGGACGG - Intronic
1178920380 21:36734834-36734856 GTACAGAACCTGGGCCAGAGGGG + Intronic
1179260858 21:39757200-39757222 GGGGAGAAACAGGGCAAGGAGGG - Intronic
1179480303 21:41672544-41672566 ATGGAGAAACTGAGGCAGGACGG + Intergenic
1179566554 21:42252692-42252714 CTGCAGTCACCGGGCCAGGAAGG - Intronic
1179983099 21:44906677-44906699 GTGCAGACACTGGGCACCGATGG + Intronic
1182073092 22:27477064-27477086 AGGCAGAAGCTGGCCCAGGAGGG + Intergenic
1183513761 22:38251186-38251208 GTGCAGAAACGTGGCCAGCATGG - Intronic
1183517281 22:38273944-38273966 GTGCAAATACTGGACCAGGGTGG - Intergenic
1184231410 22:43160167-43160189 GGGCAGGGCCTGGGCCAGGAGGG - Intronic
1184439182 22:44498216-44498238 GTGCAGGGACCGGGCCAGGCCGG + Exonic
1184851716 22:47124916-47124938 CTGCAGAGATTGGGCCAGGCGGG + Intronic
1185226043 22:49653361-49653383 ATGCAGACACTGGGGAAGGAGGG + Intronic
1185414806 22:50704197-50704219 CTGCAGAAACGGGACCACGAGGG + Intergenic
949767003 3:7537659-7537681 GTGCAGGCACTGGGTTAGGAGGG + Intronic
949947543 3:9202457-9202479 GTGCAGGAGCTGCCCCAGGAGGG - Intronic
950408072 3:12816875-12816897 GTGCAGTGCCTCGGCCAGGATGG - Exonic
950488185 3:13285201-13285223 GAGCAGGGAGTGGGCCAGGAAGG - Intergenic
950572693 3:13811783-13811805 ATGCACACACTGGGCCAGGCAGG + Intergenic
950788700 3:15455726-15455748 GGGCTGAAACTGGGGCAGCAGGG + Intronic
950864579 3:16178923-16178945 GTGTAGGAACTGGGCCAGAGGGG - Intronic
952270740 3:31829022-31829044 GTTCTGAATCTGGCCCAGGAAGG - Intronic
953213193 3:40894423-40894445 GTGAAGAAATTGGGCAATGAGGG - Intergenic
953775892 3:45816791-45816813 GTACAGCATCTGGGCCAGGATGG + Intergenic
955415871 3:58690338-58690360 CTGCAGAAATTGGGCCAGGGAGG + Intergenic
955540648 3:59972587-59972609 GTTCAGAATCTGGGGCAGGATGG - Intronic
956660575 3:71593096-71593118 GTTCAGAAACTTGCCCAGGGTGG - Intergenic
957526031 3:81379951-81379973 CTGCCTACACTGGGCCAGGATGG + Intergenic
960375007 3:116890076-116890098 GTGCAGAAACGGATCCAGGAAGG - Intronic
963136274 3:141908254-141908276 GAGGAAAAACTGGGCTAGGATGG - Intronic
964210600 3:154222808-154222830 TTGCAGAAAGGGAGCCAGGAGGG + Intronic
964961718 3:162436190-162436212 TTGGAGAAACAGGGCCAGGAAGG + Intergenic
972833379 4:42839454-42839476 GTGAGGAAAATGAGCCAGGAAGG - Intergenic
973214011 4:47648823-47648845 GGGCAGACACTGGTCCAGGATGG - Intronic
978093186 4:104742838-104742860 GGGCAGAAACAGGATCAGGAAGG - Intergenic
978160657 4:105543686-105543708 GTGAAGAAACTGAGTCAGGGAGG + Intergenic
980162217 4:129179370-129179392 GAACAGAAAATGTGCCAGGAAGG - Intergenic
983695471 4:170523785-170523807 GTGAGGAAATTGAGCCAGGAAGG - Intergenic
985589633 5:757845-757867 GTGCAGCAACGGGGCCAGCCAGG + Intronic
985832009 5:2240735-2240757 CTGCAGCAACTGGTCCAGGATGG - Intergenic
985873193 5:2575352-2575374 GTGCAGAGATTGGGCCAAGGGGG - Intergenic
988182850 5:27819679-27819701 GGGCAGAATGTGGGACAGGAAGG + Intergenic
990193993 5:53292409-53292431 TTGCTGAAACTGGGCAAGGTGGG + Intergenic
991381184 5:66029784-66029806 TAGTAGAAACAGGGCCAGGATGG + Intronic
992609272 5:78493264-78493286 GTGGAGAACCAGGGCCAGGCTGG - Intronic
996337731 5:122403136-122403158 GTGCTGAAACTGAGCCTGGAGGG + Intronic
997606412 5:135178393-135178415 GTGCAGAGACTGGGCCATGAGGG - Intronic
998520060 5:142792175-142792197 GTGCAGAAACTATGCCCTGAGGG - Intronic
998778385 5:145628963-145628985 ATTCAGAAAATGGGCAAGGAAGG + Intronic
999632843 5:153588259-153588281 GTGCACAAAATGAGCCAGAAGGG - Intronic
1001651734 5:173320621-173320643 GTGCAGAAAGTGGGGCGGGCAGG + Intronic
1001675574 5:173511892-173511914 GTGAAGAAAGTGGGACCGGAAGG - Intergenic
1002784809 6:392749-392771 GTGCGGAAGGAGGGCCAGGAGGG + Intronic
1003114744 6:3276399-3276421 GTGCAGAAGATGCGCCAGGGAGG - Intronic
1004427763 6:15517677-15517699 CTGCGGACACTGGGGCAGGACGG + Intronic
1004981775 6:21032137-21032159 AGGCACAAAATGGGCCAGGAGGG - Intronic
1006629033 6:35418237-35418259 GTGCAGATGCTGGGGCAGGCAGG - Intronic
1007273255 6:40654426-40654448 GTGCAGAGTCTGGGCCCTGAAGG + Intergenic
1012159111 6:95860842-95860864 GGGAAGAAACTGTGCCATGAGGG - Intergenic
1012330772 6:97983291-97983313 ATGCAGAAAATGAGCCAGGGCGG + Intergenic
1018826695 6:167413280-167413302 GCGCAGAAAGTGGGCCCTGAAGG + Intergenic
1019484707 7:1284227-1284249 GTGCAGAGACTAGGTCAGAAGGG - Intergenic
1019772919 7:2894999-2895021 GTGCAGGAAGTGGGCCATGCTGG + Intergenic
1020070414 7:5223571-5223593 GGGCAGAAACAGGCACAGGAGGG - Intronic
1021412325 7:20342466-20342488 GTACAGTAAGTGGCCCAGGATGG + Intronic
1022504328 7:30901036-30901058 AGGCAGAAAGAGGGCCAGGAGGG - Intergenic
1023358887 7:39395706-39395728 GTGCAGAAAAAAGACCAGGAAGG - Intronic
1023548327 7:41342576-41342598 GTGCAGGAACTGTGTTAGGATGG + Intergenic
1024333499 7:48179947-48179969 CTACAGAAAATGAGCCAGGAAGG + Intronic
1024867859 7:53924522-53924544 GTGGAGGAATTGGGTCAGGAGGG - Intergenic
1026867359 7:73831950-73831972 GGGCAGAGACTGAGCCAGGCAGG + Exonic
1026893976 7:73999646-73999668 GGACAGAAGCTGGGCCAGGTCGG - Intergenic
1029211216 7:98909733-98909755 GTGCAGAGTCTGGCTCAGGAAGG - Intronic
1029409429 7:100399355-100399377 GGGTAGAAACTGGGGAAGGATGG - Intronic
1030667383 7:112294279-112294301 GTGTTGAAGCTGGCCCAGGATGG + Intronic
1031041856 7:116846805-116846827 GGGCAGCAGCAGGGCCAGGAAGG + Intronic
1031526307 7:122825111-122825133 GTGCAGTAACTGGATGAGGAGGG + Intronic
1032802288 7:135326305-135326327 GTGCAGATACTGAGTTAGGATGG - Intergenic
1033732190 7:144190967-144190989 ATGGGGAATCTGGGCCAGGAGGG - Intronic
1033743040 7:144289552-144289574 ATGGGGAATCTGGGCCAGGAGGG - Intergenic
1033750858 7:144360047-144360069 ATGGGGAATCTGGGCCAGGAGGG + Intronic
1034456877 7:151175435-151175457 GTGCAGAGAGTTGGGCAGGAAGG - Intergenic
1036613873 8:10373599-10373621 GGGCAGGAACTGGGCCTGGAAGG + Intronic
1037492721 8:19411196-19411218 GTGCATAACATGGGCCAGGAGGG - Intronic
1037750779 8:21680805-21680827 GTGCTGAGCCTGGGCCTGGAAGG - Intergenic
1039386927 8:37144235-37144257 GTGCAGCAACTGTCCCTGGAAGG - Intergenic
1039938172 8:42066207-42066229 GGGCAGAAAATGGGGCAGGCAGG - Intergenic
1040526460 8:48229469-48229491 TTGGAGAAACAGGGCCAGGCAGG - Intergenic
1041828312 8:62123510-62123532 GTGCACCTACTGGCCCAGGAAGG - Intergenic
1047464532 8:125099566-125099588 GTGCAGAAAGTGCATCAGGAAGG + Intronic
1047483597 8:125308081-125308103 GTGGAGGAAGTGGGCCAGGTGGG - Intronic
1047867026 8:129035999-129036021 GTACAGAAAATGGGGCAGTAAGG - Intergenic
1048705357 8:137147344-137147366 GTGAAGTAACTGGGAAAGGAAGG - Intergenic
1049286952 8:141780987-141781009 GTGCAGAGGCTGGGCCTGGGTGG + Intergenic
1049294405 8:141823529-141823551 GAGCTGGAACTGGGCCAGGAAGG - Intergenic
1049397800 8:142409671-142409693 CTGCAGAGGCAGGGCCAGGAGGG - Intergenic
1049416441 8:142497669-142497691 GGGCAGAAGCTAGGCCAGGGTGG - Intronic
1049531323 8:143157022-143157044 GGGCTGAAACTGGAGCAGGAAGG + Intergenic
1049585319 8:143430198-143430220 GCGCAGAAGCTGGGCGAGGAGGG + Exonic
1049696249 8:143985603-143985625 GCCCAGAATCTGGGCCTGGAGGG - Exonic
1049702449 8:144021323-144021345 GGGGAGAAACTGGGTCATGAGGG - Intronic
1051119001 9:13731191-13731213 GGGCTTAAACAGGGCCAGGATGG - Intergenic
1051671878 9:19518615-19518637 TTGCACCATCTGGGCCAGGATGG + Intronic
1052832731 9:33229129-33229151 TTTCAGTTACTGGGCCAGGATGG + Intronic
1053405987 9:37876507-37876529 ATTCAGAAACAGTGCCAGGAGGG + Intronic
1053423731 9:37997598-37997620 GTGTAGAAGCTGGCACAGGAGGG + Intronic
1054771220 9:69086132-69086154 GTGCAGAAACTGCAAAAGGAAGG + Intronic
1056966312 9:91165496-91165518 GTGGAGGAACTGTCCCAGGATGG + Intergenic
1058151997 9:101473587-101473609 GTAGAGAAACTGGACAAGGAAGG + Exonic
1058648917 9:107156854-107156876 GTGAAGAAAGTGGTCCAAGAAGG - Intergenic
1060115957 9:120940912-120940934 ATGCAGACACTGGGAGAGGACGG - Intergenic
1061876675 9:133547597-133547619 GGGCAGGAAATGGGCCAGCACGG - Intronic
1062055749 9:134468999-134469021 CTGCACAAACTGGGCCAAGAAGG - Intergenic
1062662469 9:137645423-137645445 GTGCAGAAGCTGGCACACGAAGG - Intronic
1203516386 Un_GL000213v1:5471-5493 GTGCAGAGTCTGTGCCATGAAGG - Intergenic
1186479314 X:9883944-9883966 TTGCAGATACCGGTCCAGGATGG - Intronic
1186612133 X:11148048-11148070 GTGGAGAAATGGGCCCAGGAGGG + Intronic
1187615942 X:20993016-20993038 TTGCAGAAGCTGGGGAAGGAGGG + Intergenic
1189186214 X:39057598-39057620 GTGAGGAAACTGGGCCTGGCAGG - Intergenic
1190294514 X:49017452-49017474 ATGCAAAAATTAGGCCAGGAGGG - Intergenic
1192191886 X:68996078-68996100 GTGGAGAAGCTGGGGCAGGGCGG + Intergenic
1192363128 X:70451819-70451841 GTTCAGAGACTGGTCCAGGGAGG - Intronic
1193300860 X:79886862-79886884 GTGGAGGAACTCAGCCAGGAGGG - Intergenic
1194917695 X:99724422-99724444 TGGCAGAAAATGGGGCAGGAGGG - Intergenic
1196016367 X:110944512-110944534 GAGCAGGAACTGGGGGAGGAAGG - Intronic
1198056302 X:132998915-132998937 GTGAAGAAACAGGCCCAGAAAGG + Intergenic
1198478988 X:137023408-137023430 GTGTGGAAACTAGGCCAGGCTGG + Intergenic
1200144693 X:153920612-153920634 GTGGAGAAGGTGGGCCTGGAGGG - Exonic
1200279793 X:154767186-154767208 GTGCAGTCACTGGTCCAGGCTGG - Intronic
1200572082 Y:4844111-4844133 AGGCATAAACTGGGCCAGAAGGG + Intergenic
1200734561 Y:6780614-6780636 GTGTACAAACTGTGCCAGAAAGG - Intergenic