ID: 1078610426

View in Genome Browser
Species Human (GRCh38)
Location 11:12814545-12814567
Sequence CATGGCACTAGGCAGAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 225}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078610426_1078610432 -4 Left 1078610426 11:12814545-12814567 CCAGGGCTCTGCCTAGTGCCATG 0: 1
1: 0
2: 2
3: 23
4: 225
Right 1078610432 11:12814564-12814586 CATGGAAGGGAAGACCAGATTGG 0: 1
1: 0
2: 0
3: 26
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078610426 Original CRISPR CATGGCACTAGGCAGAGCCC TGG (reversed) Intronic