ID: 1078611055

View in Genome Browser
Species Human (GRCh38)
Location 11:12819965-12819987
Sequence GTGGAGAAACAGAATGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 352}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078611051_1078611055 -10 Left 1078611051 11:12819952-12819974 CCTGGGATTAGAGGTGGAGAAAC 0: 1
1: 0
2: 0
3: 33
4: 222
Right 1078611055 11:12819965-12819987 GTGGAGAAACAGAATGGGCTGGG 0: 1
1: 0
2: 0
3: 36
4: 352
1078611050_1078611055 -7 Left 1078611050 11:12819949-12819971 CCTCCTGGGATTAGAGGTGGAGA 0: 1
1: 0
2: 0
3: 15
4: 188
Right 1078611055 11:12819965-12819987 GTGGAGAAACAGAATGGGCTGGG 0: 1
1: 0
2: 0
3: 36
4: 352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078611055 Original CRISPR GTGGAGAAACAGAATGGGCT GGG Intronic
900027696 1:292289-292311 CTGGACAAACAGAGTGTGCTGGG - Intergenic
900041651 1:471731-471753 CTGGACAAACAGAGTGTGCTGGG - Intergenic
900063086 1:706708-706730 CTGGACAAACAGAGTGTGCTGGG - Intergenic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
900737330 1:4307365-4307387 GGGCAGACACAGAAGGGGCTTGG - Intergenic
901192280 1:7419824-7419846 GTGGAGAGGAAGAATGGGGTGGG - Intronic
901202843 1:7476372-7476394 AAGGAGACACAGAATGGGCGGGG + Intronic
901805733 1:11737273-11737295 CTGGAGCAAGGGAATGGGCTTGG + Intronic
901878780 1:12181824-12181846 GTGGAGAAACAGCACGAGCTGGG - Intronic
902141799 1:14362990-14363012 GGTGAGATACAGCATGGGCTAGG - Intergenic
903309970 1:22447509-22447531 GGGGAGAAACAGGCTTGGCTGGG + Intergenic
903812006 1:26039787-26039809 GTGGACAGACAGAACAGGCTGGG + Exonic
904469083 1:30724764-30724786 GAGCAGAAAGAGCATGGGCTTGG + Intergenic
906080689 1:43086410-43086432 GTAGAGACACAGAAGGGGTTGGG - Intergenic
906124542 1:43419651-43419673 GGAGAGAAAGAGACTGGGCTAGG - Intronic
906518800 1:46455491-46455513 ATGGAGTAACAGACTGGGCTTGG + Intergenic
907822133 1:57980546-57980568 GTGGAGAAGCAACATGGGATAGG - Intronic
908011574 1:59783621-59783643 GGGGAGAAACAGAAAGCGCCAGG + Intergenic
908565719 1:65354193-65354215 ATGGAGGAACAGAATGAGGTGGG + Intronic
909406429 1:75295525-75295547 ATGGAGGAAGAGACTGGGCTGGG + Intronic
910159620 1:84259279-84259301 GTGGAGAAACCCAGTGTGCTAGG - Intergenic
910289534 1:85587145-85587167 GTGGAGAAAGAGAAAGGACCAGG + Intergenic
911601274 1:99850316-99850338 GGGGAGAAACAGAAGGGGAAGGG - Intronic
912998484 1:114555569-114555591 GTGGAGGAAGAGAGTGGACTTGG + Intergenic
913085164 1:115430107-115430129 ATGGAGAAAGAGAATGGGAGGGG - Intergenic
913110474 1:115653243-115653265 GATGAGAAACAGAAGGAGCTCGG + Intronic
913110684 1:115654686-115654708 GATGAGAAACAGAAGGAGCTCGG - Intronic
915962520 1:160279073-160279095 GGGGAGAAACAGCCTGGGCTGGG - Exonic
917861950 1:179154555-179154577 GTGAAGAAACATAATTGGTTAGG - Intronic
918657964 1:187052857-187052879 GAGGAGAAAAAGAATGGGATGGG - Intergenic
919432558 1:197514577-197514599 GTGGAGAAAGAGAATAGGTGAGG + Intronic
920019786 1:202946730-202946752 GTGGAGAACCAGCCTGGACTGGG + Intronic
920572226 1:207025812-207025834 GTGGAGAAACTGGATGGTATGGG + Intronic
921124499 1:212165121-212165143 GTGGATAAATAGGATGGTCTAGG - Intergenic
922204815 1:223437028-223437050 GTGGAGCACCAGAGTGGGCATGG - Intergenic
922260029 1:223931733-223931755 CTGGACAAACAGAGTGTGCTGGG - Intergenic
923308779 1:232713725-232713747 ATTGAGAATCAGAATGGCCTGGG - Intergenic
924341194 1:243034293-243034315 CTGGACAAACAGAGTGTGCTGGG - Intergenic
1064308439 10:14189276-14189298 GAGGAGGAAGAGAATGGGCCCGG + Intronic
1064506852 10:16040573-16040595 CTGGGGAAACAGAATTAGCTCGG + Intergenic
1064583244 10:16815059-16815081 GAGGAGAAAGAGAAGGGGATAGG - Intronic
1065127127 10:22584481-22584503 CTGGAGAAACAGAAGGGGAGAGG + Intronic
1067321242 10:45223166-45223188 GAGGAGAAAGAGAAGGGGATAGG - Intergenic
1067719772 10:48719616-48719638 GAGGAGAAACAGGAGGGGCTGGG + Intronic
1067950672 10:50734794-50734816 GTCAAGAAACAGAATGATCTAGG - Intergenic
1068853132 10:61767760-61767782 GTGGAGAGACAGAGAAGGCTCGG - Intergenic
1070770938 10:79082039-79082061 GTGGAGTAACAGGCAGGGCTGGG - Intronic
1070886016 10:79899991-79900013 GTCAAGAAACAGAATGACCTAGG - Intergenic
1072252551 10:93593111-93593133 GTAGAGAAACAAAATGGGCCAGG - Intronic
1072670253 10:97424199-97424221 GTGGAGAAAGAGTATGGTCTTGG + Intronic
1074084070 10:110194223-110194245 TTGGAGAAAGAGGATGGGGTAGG + Intergenic
1074377337 10:112951123-112951145 GGGGAGAAAAAGAATCGGCGAGG - Intronic
1074831102 10:117250037-117250059 GTGGGGAAGCAGAAAGGGTTTGG + Intronic
1075350748 10:121722758-121722780 ATGGAGAAACAGAGTGGAATGGG - Intergenic
1075398731 10:122146245-122146267 GGGGAGAAACAGCATGTGCATGG + Intronic
1076619317 10:131776921-131776943 GTGGAGACACAGGAAGGTCTCGG + Intergenic
1076944757 10:133638184-133638206 GTGGGGAGAGAGAATGGGCCGGG - Intergenic
1076967926 11:107959-107981 CTGGACAAACAGAGTGTGCTGGG - Intergenic
1077026888 11:443895-443917 GTTCAGAAACAGAATGTGCAAGG + Intergenic
1078396777 11:10988481-10988503 GAGGAGAGAGATAATGGGCTAGG + Intergenic
1078611055 11:12819965-12819987 GTGGAGAAACAGAATGGGCTGGG + Intronic
1078894136 11:15583245-15583267 GTGGGGAAAGTGAATGGACTTGG + Intergenic
1079370171 11:19845816-19845838 GTGCATAATCATAATGGGCTTGG + Intronic
1079407268 11:20157596-20157618 GGGGAGAAACACAGTGGCCTCGG - Intronic
1081562257 11:44228519-44228541 GGAGTGAAACAGAATGGGATGGG - Intronic
1081702378 11:45159894-45159916 CTGCAGAAACAGAATGGGCCAGG + Intronic
1082132825 11:48512104-48512126 GTGGAGAAATAGAATTGTCAAGG + Intergenic
1082566260 11:54682659-54682681 GTGGAGAAATAGAATTGTCAAGG + Intergenic
1083110367 11:60400283-60400305 GTGGAAAAACGGGATGGTCTTGG + Intronic
1084353805 11:68623688-68623710 GTAGAGACACAGAAAGGGTTGGG - Intergenic
1084515626 11:69636844-69636866 GTGAACACACAGAAGGGGCTTGG + Intergenic
1085282314 11:75339319-75339341 CTGGAGAAAGAAAATGGGGTGGG - Intronic
1085555048 11:77411984-77412006 TTGGCGAAACAGAAGGGGCGGGG + Intronic
1086053108 11:82617250-82617272 GTGCAAAAGCAGACTGGGCTTGG - Intergenic
1087158131 11:94924053-94924075 GTGGGGAATGAGAAAGGGCTGGG + Intergenic
1087956157 11:104290105-104290127 GTGGACAACCTGAATGAGCTTGG - Intergenic
1088243800 11:107797295-107797317 GTAAGAAAACAGAATGGGCTAGG + Intronic
1088753926 11:112869620-112869642 ATAGAGAAACAAAATGTGCTAGG - Intergenic
1089468126 11:118698945-118698967 GAAGAGAAACAAAAAGGGCTAGG - Intergenic
1090710919 11:129384322-129384344 GTGGAGAAATGGAGTGGTCTTGG + Intronic
1090864860 11:130690694-130690716 GTGGGGAAAGAGAGTGGTCTTGG + Intronic
1091287173 11:134413861-134413883 GTGCAGAAGCAGGATGGGCGGGG + Intergenic
1091562149 12:1623004-1623026 GGGGAGAAACAGGATGGGTTTGG + Intronic
1091817997 12:3454135-3454157 GTGAAGAGACAGCAGGGGCTAGG - Intronic
1092248481 12:6877436-6877458 GTGGAGCAACAGAAGGGTCAAGG + Intronic
1093936557 12:25007815-25007837 GTGAAATAAAAGAATGGGCTGGG - Intergenic
1097359947 12:58647624-58647646 GTGGAAAAAAACAATGGACTTGG + Intronic
1108763724 13:53601363-53601385 GTGGAAAATCAGAATGCCCTGGG - Intergenic
1110845098 13:80184448-80184470 GTAGAGACACAGAAGGGGTTGGG - Intergenic
1111911413 13:94316420-94316442 ATAAAGAAACAGAATGGGCCGGG + Intronic
1112283198 13:98080742-98080764 GTGGACCAAGAGAATGTGCTAGG + Intergenic
1113757730 13:112825322-112825344 GTGAAGAAACAGAATAGGAAGGG - Intronic
1114216358 14:20660438-20660460 GAGGAGAACCAGCATGGGCGTGG + Intergenic
1114504178 14:23196349-23196371 GTGGTGACGCAGAGTGGGCTTGG - Intronic
1116425086 14:44781168-44781190 GGTGAAAAACAGAGTGGGCTGGG + Intergenic
1117316936 14:54580337-54580359 GTAAAGAAACAGAAAGGGGTGGG - Intronic
1117334132 14:54742327-54742349 GAGGAGAAATAGAATGGGGGGGG + Intronic
1118823104 14:69357930-69357952 GGAGAGAATCAGAATGAGCTGGG + Intergenic
1118823929 14:69363368-69363390 GAGGAGAAAGAGAAGAGGCTGGG + Intergenic
1119479731 14:74951866-74951888 TGGGAGAAACAAAAGGGGCTGGG + Intronic
1119716493 14:76863336-76863358 GTGGAGAGACAGTAAGGGCCAGG - Intronic
1119950406 14:78738675-78738697 GTGGGGAAAAAGAATGGGGTGGG - Intronic
1120277023 14:82388910-82388932 GTGGAGAACCAGAAGGGGACTGG + Intergenic
1120859083 14:89238294-89238316 GTCAAGAAACAGAGTGGGATTGG - Intronic
1121558470 14:94856521-94856543 GTGGAGCTGCAGAATGTGCTCGG - Intergenic
1125296981 15:38213815-38213837 TTGGAGAAACACAAGTGGCTTGG + Intergenic
1127688911 15:61375787-61375809 GAGGAGAATCAGAAAGGGCCAGG - Intergenic
1128352893 15:66903235-66903257 TGGTAGAAACAGAATGAGCTGGG + Intergenic
1128486511 15:68095824-68095846 ATGAAGAAAAAGAATGGGCCAGG - Intronic
1129328257 15:74813219-74813241 GAGGAGAAACAGCTTGGGCAGGG - Intronic
1129496125 15:75982826-75982848 GTGGGGAGACAGCTTGGGCTTGG - Intronic
1129965332 15:79729899-79729921 CTGGAAAAACAGAATGTCCTGGG + Intergenic
1130007509 15:80114318-80114340 GTATGTAAACAGAATGGGCTTGG - Intronic
1130433089 15:83868729-83868751 GTGGAGAAGCAGAGTGGTTTGGG + Intronic
1130733740 15:86526839-86526861 TTGGAGAAACAGAAGGGGGTTGG + Intronic
1131191244 15:90318672-90318694 CTGGAGAGACAGGCTGGGCTGGG - Intergenic
1131672025 15:94630362-94630384 GTGCAGAAACTGAGTTGGCTAGG - Intergenic
1134880924 16:17745076-17745098 GTGGAGGAACAAAGAGGGCTCGG - Intergenic
1135099303 16:19592504-19592526 GTGGGAAAAGAGAAAGGGCTGGG - Intronic
1137377518 16:47965760-47965782 GTGGAGCTGCAGAAGGGGCTGGG - Intergenic
1137580365 16:49630146-49630168 GTGGAGAGAAAGACAGGGCTGGG + Intronic
1137621602 16:49880043-49880065 GAGGAGAAACAGCGTGGCCTGGG + Intergenic
1139417327 16:66824030-66824052 TAGGAGAAGCAGAATTGGCTGGG - Intronic
1139446540 16:67001719-67001741 GTGGAGAGGCAGAAGGTGCTGGG - Intronic
1140176921 16:72670774-72670796 GTTGAGAAAGAGAACGGGCCTGG - Intergenic
1140233419 16:73137245-73137267 GTGCAGAAAAAGAAAGGGGTAGG - Intronic
1140632406 16:76869978-76870000 GTGGAGAAAAAGAATGGATATGG - Intergenic
1141344687 16:83233910-83233932 ATGGAGAGACAGAGTGGGTTAGG + Intronic
1142407836 16:89901045-89901067 GTGCAGAGACAGAACTGGCTGGG + Intronic
1142452754 16:90191180-90191202 CTGGACAAACAGAGTGTGCTGGG + Intergenic
1142687040 17:1583339-1583361 GTGGAGACACAGAACGTGCAGGG + Intronic
1142976570 17:3648240-3648262 GTGCAGAGACAGAAGGAGCTGGG - Intronic
1143620442 17:8077200-8077222 GTGGTGAAAGAGAAAGGGTTGGG + Intronic
1145144038 17:20466450-20466472 GTGGGGAGACAGAATGGGGAGGG - Intronic
1145758320 17:27409003-27409025 GTGGAGAAAGAGAAGGGACCAGG - Intergenic
1147025503 17:37579286-37579308 GTGGAAAGACTGAAAGGGCTGGG + Intronic
1147870384 17:43582965-43582987 GTTTAGAAACAGAATGGGAATGG - Intergenic
1148637814 17:49162611-49162633 GACAAAAAACAGAATGGGCTGGG + Intronic
1149557612 17:57585306-57585328 GTGGAGATAGAGATTGGGCTAGG + Intronic
1150395602 17:64819457-64819479 GTGGTGTTACAGACTGGGCTTGG - Intergenic
1150478072 17:65488947-65488969 GGGGAGAGACAGAAAGGGATGGG + Intergenic
1150608746 17:66716128-66716150 GGGGAGATAGAAAATGGGCTGGG - Intronic
1150793850 17:68222199-68222221 GGGGAGAAACAGACTTGGGTGGG + Intergenic
1152126880 17:78452343-78452365 GTGGACAAACACAATGCGCCCGG + Intronic
1153388736 18:4531186-4531208 GTGGAGAAATAGGTAGGGCTGGG - Intergenic
1153643194 18:7173122-7173144 GGGGAGAAACAGAAGAGGCGTGG + Intergenic
1156108281 18:33692056-33692078 GTGGAGAAAAAGCATAAGCTTGG - Intronic
1156320867 18:36020409-36020431 CTGGAGAAAATGAATGGCCTTGG + Intronic
1156836540 18:41561915-41561937 GAGGAGAGAAAGAATGGGCAGGG - Intergenic
1158680688 18:59563835-59563857 GAGGGGAAACAGCATTGGCTGGG + Intronic
1159002488 18:62986797-62986819 GTGGAGTGACAGAGTGGGCTGGG + Intergenic
1159902439 18:74060222-74060244 CTGGAGAAAAAGAAAGAGCTGGG - Intergenic
1160644731 19:177582-177604 CTGGACAAACAGAGTGTGCTGGG - Intergenic
1160868966 19:1268416-1268438 GTGGAGGAGCAGAGTGGGCCTGG + Intronic
1162442630 19:10702233-10702255 GTGCAGATCCAGAATGCGCTGGG + Exonic
1163248729 19:16113061-16113083 GTGGTTGAACAGAATTGGCTTGG + Intronic
1164166944 19:22687923-22687945 AAAGAGAAACAGCATGGGCTGGG - Intergenic
1164713684 19:30376558-30376580 TTTCAGAAACAGAATGGGCCAGG + Intronic
1164918321 19:32069889-32069911 GTGGAGAAAAAGATTGGGGAGGG - Intergenic
1164976752 19:32579418-32579440 ATGGATAAACAAAATGTGCTAGG + Intergenic
1165207255 19:34200561-34200583 ATGGAGAAACAGAGTGGGTTTGG + Intronic
1165510513 19:36264161-36264183 GTAGAGACACAGAAGGGGTTGGG + Intergenic
1167099214 19:47393759-47393781 GTAGAGACACAGAAGGGGTTGGG - Intergenic
1167689064 19:50974758-50974780 GCCCAGAAACAGAAGGGGCTGGG + Intergenic
1168082317 19:54019169-54019191 GTGGTAAAACAGAAAGGGCTTGG + Intergenic
1168238776 19:55078970-55078992 GGGGAGAAAGAGAATGAGCCTGG - Intronic
925805317 2:7642473-7642495 GTGGAGAAACACAGAGGACTTGG + Intergenic
926757466 2:16247765-16247787 GTGGAGAAACTGGGTGGGTTTGG + Intergenic
926907067 2:17816010-17816032 TTGGAGAAGCAGCATGGTCTAGG - Intergenic
927474908 2:23405810-23405832 GAGGTCAAGCAGAATGGGCTGGG + Intronic
927503170 2:23595792-23595814 GTGGAGAGACAGCATGGGAAGGG - Intronic
927593009 2:24373049-24373071 TTAAAGAAACAGAATGGGCCGGG + Intergenic
927804211 2:26131208-26131230 GTGGAGAAGAAGAATTGTCTTGG + Intronic
927909376 2:26885727-26885749 GTGGAGAACCTGAATGGCCTGGG - Intronic
928032747 2:27795702-27795724 GTGGTGAAACAGGATGGGAGCGG - Intronic
929556414 2:42928333-42928355 CAGGACAAGCAGAATGGGCTGGG - Intergenic
930524404 2:52509094-52509116 ATTGAGAAAGGGAATGGGCTGGG - Intergenic
930840573 2:55840835-55840857 GGGGAGAAAGATAATGGGTTTGG - Intergenic
932737158 2:74262237-74262259 GAGGAGAATCAGAAGGGACTTGG + Intronic
932769746 2:74493939-74493961 GTGGAGAAACAGAGTGGCCAAGG - Exonic
933073794 2:77896618-77896640 ATGGAGAATCTGAATAGGCTGGG - Intergenic
933222762 2:79709745-79709767 ATGGAGAAATAGGATGGGGTAGG + Intronic
933315017 2:80705078-80705100 GTGGAGAGAATGAATGGACTGGG - Intergenic
934584711 2:95481055-95481077 GAGGAGAAACACAATGGAATGGG - Intergenic
934594744 2:95595664-95595686 GAGGAGAAACACAATGGAATGGG + Intronic
934788033 2:97029970-97029992 GAGGAGAAACACAATGGAATGGG - Intergenic
937772547 2:125737144-125737166 GTGGAGAAAGAGCAAGGGGTAGG + Intergenic
939705406 2:145446769-145446791 GTGGAGAAAGAGAGAGGTCTAGG - Intergenic
939840382 2:147180994-147181016 ATCGAGAAACAGGAGGGGCTAGG + Intergenic
940512096 2:154628583-154628605 GTGGAGAAACAGATAGGAGTAGG - Intergenic
941744558 2:169073234-169073256 GTGGTAGAACAGAATGGTCTGGG + Intronic
943745135 2:191454365-191454387 GTGCACAGACAGAATGAGCTTGG + Intergenic
944820702 2:203427784-203427806 GTGGAAGAAAAGAAGGGGCTAGG - Exonic
944876359 2:203966767-203966789 GTAGAGACACAGAAGGGGTTGGG + Intergenic
946179429 2:217940886-217940908 GAGGAGAACCAGAGAGGGCTGGG - Intronic
946986867 2:225283121-225283143 TTGGAGAAACAGAAGGTGGTGGG - Intergenic
948489852 2:238305568-238305590 GTGTAGAAAGAGAAGTGGCTTGG - Intergenic
948527357 2:238579807-238579829 GGGGAGAAGCCGAAAGGGCTGGG + Intergenic
1169780325 20:9302368-9302390 GTAGTGAAACAGGATTGGCTGGG + Intronic
1170761439 20:19254709-19254731 GAGGACACACAGCATGGGCTGGG + Intronic
1171872504 20:30539716-30539738 ATGCACAAACAGAATTGGCTTGG - Intergenic
1171886888 20:30660498-30660520 GGGGAGGAACAGAGTGGGCCAGG - Intergenic
1173141592 20:40489774-40489796 GTGGAGAAAAAGAAAAGACTTGG + Intergenic
1173678979 20:44862719-44862741 GTGAAGAAACAGAAAAGGCATGG - Intergenic
1173818212 20:46003738-46003760 GAGGTGAAAGAGAATGGGCCTGG - Intergenic
1174972606 20:55293306-55293328 GTGGAGAGACAGTTTGGGCTGGG + Intergenic
1176243620 20:64086378-64086400 GTGGAGAAACAGTAGGGGTGAGG - Intronic
1176280777 20:64308329-64308351 CTGGACAAACAGAGTGTGCTGGG + Intergenic
1176744466 21:10639418-10639440 AAAGAGAAACAGAATGTGCTAGG + Intergenic
1176929908 21:14796827-14796849 GTGGAACAACTGAATGGCCTGGG + Intergenic
1177438795 21:21090844-21090866 TTTGAGAAACAGATTGGGATAGG - Intronic
1178692255 21:34759906-34759928 GTGGAGAAAATGGATGGGTTCGG + Intergenic
1178833278 21:36074150-36074172 TGGAAGAAACAGAATGGCCTGGG - Intronic
1179302857 21:40128174-40128196 GCAGAGAAACAGGATGGGCATGG - Intronic
1180649939 22:17369451-17369473 CCGGAGAAACAGATGGGGCTAGG - Exonic
1181072258 22:20352571-20352593 GTGGAGAAACTGAAGGGCCAAGG + Intronic
1182085287 22:27557007-27557029 GGAGAGAAAGAGAATGGGCCAGG + Intergenic
1182676822 22:32045554-32045576 TTGAAGAAACACAATGGGCCTGG - Intronic
1183483633 22:38077949-38077971 GTGTAGAGACACAAGGGGCTGGG - Intergenic
1183524711 22:38316598-38316620 GTGGAGAGAAAGAAAGGGGTGGG - Intronic
1184274595 22:43403124-43403146 GTGGAGGAATAGAGTGGGGTTGG + Intergenic
1184804818 22:46787769-46787791 GTAGAGAACCAGAATGGGGAGGG + Intronic
1184852488 22:47128377-47128399 GTGGAGAATCAGGAGTGGCTAGG + Intronic
1185004319 22:48266625-48266647 GTTGAGGAACAGAACTGGCTGGG - Intergenic
1185189806 22:49427952-49427974 GTTGAGAGACAGAAAGAGCTTGG - Intronic
1185411315 22:50684426-50684448 GTAGAGAAGAGGAATGGGCTGGG + Intergenic
949609724 3:5692033-5692055 CTGGAGAAACAAAATGGCCCTGG - Intergenic
949827209 3:8177910-8177932 GTAGAGACACAGAAGGGGTTGGG - Intergenic
950280440 3:11703179-11703201 ATGAGGAAACAGAATGGGCTTGG + Intronic
950413050 3:12851378-12851400 GTGGAGCCACAGAATGGGGGAGG + Intronic
952026814 3:29092723-29092745 GTGCCAAAACAGAATGGGCCTGG - Intergenic
952205612 3:31179151-31179173 GGGGAGAAATAGAATGGGGAAGG - Intergenic
952307198 3:32156780-32156802 GATGAAAAACAGAATGAGCTGGG - Intronic
952731811 3:36645152-36645174 GAAGAAAAACACAATGGGCTGGG - Intergenic
954463284 3:50639814-50639836 GTGTAGAAGCAGAAGGTGCTGGG - Intronic
955519086 3:59757281-59757303 GTGCAGAAATAGAATTTGCTTGG - Intronic
956971280 3:74529841-74529863 GGTGAGGAACAGAATGGTCTGGG - Intergenic
956971292 3:74530004-74530026 GGTGAGGAACAGAATGGTCTGGG - Intergenic
957353259 3:79052812-79052834 GTGGAGAAACATCATTGGTTCGG + Intronic
959402715 3:105922390-105922412 GTGGGGAGATGGAATGGGCTGGG + Intergenic
959697832 3:109268628-109268650 GTGGAGATACAGATTGTGGTAGG - Intergenic
960918099 3:122717764-122717786 GAGGAGGAACACAATGAGCTGGG + Intronic
961805209 3:129484200-129484222 GTGGAGCCACAGAATGGGGGAGG + Intronic
961826240 3:129600624-129600646 CTGGAGAAACAGATAGGGCTTGG - Intronic
962201323 3:133403321-133403343 GTGGAGAAACAGGAGGGGTAAGG - Intronic
962280153 3:134045776-134045798 GTGAAGAAACTAGATGGGCTTGG + Intronic
964656594 3:159073660-159073682 GTGGAGAGACTGAATTGGATGGG - Intronic
965369912 3:167848710-167848732 ATGAAAAAACAGTATGGGCTGGG - Intergenic
966421575 3:179739378-179739400 GTCCAGAAACAGTATGGGGTGGG + Intronic
968809111 4:2792268-2792290 GTGGAGAAAGTGAAGAGGCTGGG - Intergenic
968844441 4:3032186-3032208 GTGAAAAAGCAGAATGGGCCGGG + Intronic
969484416 4:7464145-7464167 GTAGAGGAACAAAATGGGCCAGG + Intronic
969986424 4:11216125-11216147 ATGGATAAACAGAAAGAGCTTGG - Intergenic
969997376 4:11326724-11326746 GTGGAGAAATCGACTGGGCACGG - Intergenic
971304530 4:25468055-25468077 GAGGAGAAACGGAAAGGTCTTGG - Intergenic
972600398 4:40566941-40566963 ATGAAGACACAGAATGGGCCGGG - Intronic
973277357 4:48324278-48324300 GTAGTGAAAAAGAATGAGCTAGG + Intergenic
973931237 4:55794541-55794563 GTGGATCAACAGAATAGGCCCGG + Intergenic
973997303 4:56471925-56471947 GTGGAGCATCAGGATGGGCTGGG - Intronic
974036421 4:56821855-56821877 GGGGAGAACCGGAAAGGGCTGGG + Intergenic
976416977 4:84787840-84787862 GTGGAGAAACAGGAAGGGCAAGG + Intronic
977102199 4:92831053-92831075 ATTGAGAAACAGAAGGGACTAGG + Intronic
977960106 4:103076067-103076089 GTGTACAAACAGAAAAGGCTGGG + Intronic
978069081 4:104444005-104444027 GTGGAGAGATAGAAGGGGCAAGG - Intergenic
978396785 4:108289189-108289211 ATGGAGAAACAATCTGGGCTGGG + Intergenic
978852220 4:113352911-113352933 GAGGGGCAACAAAATGGGCTGGG - Intronic
979261633 4:118654082-118654104 CTGGACAAACAGAATGTGCTGGG + Intergenic
979664504 4:123295662-123295684 GTTGAGAAACAGAAAGTTCTAGG + Intronic
980837580 4:138215971-138215993 GTAGAGAAAAGGAAAGGGCTTGG + Intronic
981467841 4:145094528-145094550 GAGGGGAAACAGAAGAGGCTTGG + Intronic
981733240 4:147921983-147922005 CTGGAAAAAGATAATGGGCTTGG + Intronic
981912749 4:150000739-150000761 CTGGAAAAGCAGAATGGGGTAGG - Intergenic
982522332 4:156433907-156433929 GTGGAGAAATAGAATACACTAGG - Intergenic
983150205 4:164269248-164269270 CTGGACAAACAGAGTGTGCTGGG - Intronic
983945540 4:173582379-173582401 GTGGAGAAACAGTGTGGTATGGG + Intergenic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
984708203 4:182863111-182863133 GTGGAGAAAGGAAATGGTCTTGG - Intergenic
984818199 4:183857689-183857711 GAGGAGAAAGAGACAGGGCTGGG - Intronic
985266344 4:188154972-188154994 GTGGAGAAGCAGATTCCGCTTGG - Intergenic
985757675 5:1728900-1728922 GTGGTGACACAGAGTGGGCCTGG - Intergenic
985869405 5:2542368-2542390 GTGGTGGAACAGAAAGGGCTTGG - Intergenic
986250937 5:6058232-6058254 GTGGAGAAGCAGCACGGGCTTGG - Intergenic
987249083 5:16080348-16080370 GTGGAGAAACAGGAAGGGGAGGG - Intronic
989459447 5:41680576-41680598 GAGGAGAAAAAGAAGGGACTGGG + Intergenic
990164971 5:52984868-52984890 TTGAAGAAAATGAATGGGCTGGG + Intergenic
990376144 5:55173118-55173140 GTGGTGAAATAGAATGGTCCTGG - Exonic
991528783 5:67592819-67592841 GTGAAGAAAAAGAATGTTCTTGG - Intergenic
993069413 5:83140747-83140769 ATTGAGAAACAGAAAGGGGTGGG - Intronic
993398694 5:87422051-87422073 GTGAAGGAAAAGAATGAGCTCGG - Intergenic
995956639 5:117784493-117784515 GTGGAGTCTCAGAGTGGGCTTGG + Intergenic
995972760 5:117992673-117992695 GTAGAGAAATAGATTGGGGTGGG + Intergenic
996297251 5:121935611-121935633 GTGGAGAGAGAGAATTGCCTGGG - Intergenic
997677610 5:135724895-135724917 GTGGAGAAACAGCACAGACTCGG + Intergenic
998150963 5:139757215-139757237 GTGGAGTCACAGAGTGGGCTGGG + Intergenic
998226390 5:140329958-140329980 CTGGAGAAACAAAGTGTGCTTGG + Intergenic
999195002 5:149775819-149775841 GTGGAGAAAGAGAAGGGGGTAGG - Intronic
999934660 5:156474038-156474060 CTGGAGAAAATGAAGGGGCTGGG - Intronic
1000131449 5:158304259-158304281 TGGGAGAATCAGACTGGGCTGGG + Intergenic
1000252847 5:159511558-159511580 GTGGAGAAGGAGCATGGGTTTGG - Intergenic
1000998515 5:167982681-167982703 GAGGGGAAAATGAATGGGCTTGG - Intronic
1001260860 5:170227389-170227411 ATGGAAACACAGAAGGGGCTGGG + Intergenic
1001677575 5:173531327-173531349 GTGGAGAGACAGCATGTGCTTGG - Intergenic
1002176881 5:177405617-177405639 GTGGAGGGAGAGAAGGGGCTGGG + Intronic
1002607186 5:180390358-180390380 GAGGAGAAACAGAAGAAGCTCGG - Intergenic
1002732193 5:181347198-181347220 CTGGACAAACAGAGTGTGCTGGG + Intergenic
1002752342 6:126906-126928 CTGGACAAACAGAGTGTGCTGGG - Intergenic
1003485061 6:6568567-6568589 GAGGAGGAACAGAATAGGATAGG - Intergenic
1003598484 6:7496277-7496299 ATAGAAAGACAGAATGGGCTGGG + Intergenic
1005021670 6:21424393-21424415 ATGGAGAAACATAATGGCTTTGG - Intergenic
1006754476 6:36403383-36403405 TTTAAGAAACAGAATAGGCTGGG + Intronic
1007681097 6:43633973-43633995 GTGTAGAATGAGAATGGGCTAGG - Intronic
1007711220 6:43825619-43825641 GTTGACACACAGAATAGGCTGGG - Intergenic
1008206093 6:48659151-48659173 GTGCAGAAACTGAGTGGGCAGGG - Intergenic
1010486903 6:76425678-76425700 AGAGAGAAACAGAATGGGATGGG + Intergenic
1010614843 6:78000083-78000105 ATGGAGAAAGGGAATGGCCTCGG + Intergenic
1011436296 6:87341345-87341367 GGTGAGAAGCAGAATGGCCTTGG + Exonic
1011708498 6:90027250-90027272 TGGGAGAAAAAGAATGTGCTTGG + Intronic
1012303560 6:97621056-97621078 CTAGAGAAACAGAATGGCCCAGG - Intergenic
1012855546 6:104497106-104497128 GTGCATAATTAGAATGGGCTTGG + Intergenic
1013189386 6:107789384-107789406 GTGGGGAGGCAGGATGGGCTGGG - Intronic
1014454104 6:121616999-121617021 GTGGAGACACGGAATTGGATTGG - Intergenic
1015288190 6:131508795-131508817 GTAGAGAAACGGAAGGGGTTCGG + Intergenic
1016028247 6:139310988-139311010 GTATTGAAACAGAATGGGCTGGG - Intergenic
1018430944 6:163722419-163722441 GTGGAGAACCACATTGGGGTGGG + Intergenic
1018740539 6:166725473-166725495 CTGGAGAAAGAGGCTGGGCTGGG - Intronic
1018868637 6:167764585-167764607 CTGGGGAACCAGAGTGGGCTTGG + Intergenic
1019052421 6:169193255-169193277 GAGGAAATACAGAGTGGGCTTGG - Intergenic
1019162023 6:170075403-170075425 GTGGAGAAAAAGAAGGGGAGAGG + Intergenic
1019236445 6:170619512-170619534 CTGGACAAACAGAGTGTGCTGGG + Intergenic
1021949811 7:25763682-25763704 GTGGAGAAAGAGGAAGAGCTAGG - Intergenic
1022300157 7:29095337-29095359 GTGTAGAAACACTCTGGGCTGGG - Intronic
1027674263 7:81140559-81140581 TGGAAGAAACAGTATGGGCTGGG - Intergenic
1029269800 7:99370350-99370372 GTGGAGAAACACTTTGGGTTAGG - Intronic
1029410096 7:100403967-100403989 TGGGAGAAACAGAATGGGGAGGG - Intronic
1029604257 7:101589159-101589181 CTGGAGAGAGAGCATGGGCTGGG + Intergenic
1031339809 7:120585293-120585315 GCAGAGAAACAGAAGGGGATGGG + Intronic
1031887260 7:127254738-127254760 TTGGAGAGAGAAAATGGGCTGGG + Intergenic
1031935568 7:127732107-127732129 GTGGAGGAAGACAATGTGCTTGG - Intronic
1035511325 8:187095-187117 CTGGACAAACAGAGTGTGCTGGG - Intergenic
1035719804 8:1783541-1783563 GTTGGGAAACAGAATGGGCCAGG + Exonic
1036569988 8:9971750-9971772 ATGGATAAACAGAATGTGGTAGG - Intergenic
1037495224 8:19433909-19433931 GTGGTGAAACAAAATGGGGTTGG - Intronic
1037831838 8:22194420-22194442 GTGGGGACACAGGATGGGGTGGG - Intronic
1038114503 8:24538178-24538200 GTTGAGGAACAGAATGAGGTAGG + Intergenic
1038616360 8:29099157-29099179 GGGGAGAAACAGAGAGGGCGGGG + Exonic
1039022429 8:33222654-33222676 GAGTAAAAACAGAACGGGCTTGG - Intergenic
1039746362 8:40431558-40431580 GTAAAGAAACAGAATCGGCCAGG + Intergenic
1041825566 8:62092999-62093021 ATGGGGAGAGAGAATGGGCTCGG - Intergenic
1041869858 8:62620364-62620386 TTTGAGAAACAGAATGTGCATGG - Intronic
1041964423 8:63658515-63658537 GTGGAGAAAGAGAATGTTCTAGG + Intergenic
1042752315 8:72171276-72171298 TTAAAGAAACAGAATGGGCCTGG + Intergenic
1044489047 8:92790335-92790357 GAGGAGGAAAAGAATGGGTTGGG + Intergenic
1048250985 8:132866745-132866767 GTGGGGGAACAGAACGGGGTGGG - Intergenic
1048744927 8:137603842-137603864 GCGGAGAAACATAATGGGTACGG - Intergenic
1049248719 8:141576891-141576913 GTGGAGAGAAAGCGTGGGCTTGG + Intergenic
1049604916 8:143524837-143524859 GTGGACACAGAGCATGGGCTTGG - Intronic
1051231794 9:14962815-14962837 GTGTGGAAACACAATGGCCTGGG - Intergenic
1053077520 9:35146281-35146303 ATAGAGAAACAGCATGGGCTGGG + Intergenic
1054720069 9:68595202-68595224 GTTGAGAAATAGAATAAGCTGGG - Intergenic
1055154581 9:73044594-73044616 ATGGAGAAAGAGAGAGGGCTGGG - Intronic
1055858118 9:80716672-80716694 GTGGTGGAATAGAATGGGTTGGG + Intergenic
1056048583 9:82744988-82745010 GTGGAGTTATAGAATGGTCTGGG - Intergenic
1056105689 9:83344107-83344129 GTGGAGTAACAGAAAGGACAGGG - Intronic
1057302826 9:93896463-93896485 GGGAAGGAACAGAATGGGCAGGG - Intergenic
1057822743 9:98344979-98345001 GTGTGGAATGAGAATGGGCTTGG - Intronic
1059302017 9:113321422-113321444 GTGGAGAATCAGAGTGGGAATGG + Intronic
1059327639 9:113513925-113513947 GGGAGGAAACAGATTGGGCTGGG + Intronic
1059352563 9:113676048-113676070 GTGGAGAAATAGGCTGGGCATGG + Intergenic
1059709798 9:116857005-116857027 GTGGAGAAAAATAATGGGAAAGG - Intronic
1059989597 9:119852864-119852886 GGGGTGAAACACAAGGGGCTGGG + Intergenic
1060421707 9:123473770-123473792 GTGGAGAAAGAGACTGGGATGGG - Intronic
1062756595 9:138299524-138299546 CTGGACAAACAGAGTGTGCTGGG + Intergenic
1185511368 X:667315-667337 GAGGAAAAAAAAAATGGGCTTGG - Intergenic
1187100098 X:16183395-16183417 GTAGAGACACAGAAGGGGTTCGG + Intergenic
1187144068 X:16621501-16621523 GTGGAGAAGCAGGATGGTCCAGG + Intronic
1190480794 X:50874823-50874845 GCTAAGAAGCAGAATGGGCTTGG + Intergenic
1192037368 X:67578779-67578801 GTGCATAGACAGAATGGGCTGGG + Intronic
1192631614 X:72781929-72781951 ATGGAGCAGCAGAAGGGGCTTGG + Intronic
1192650095 X:72938872-72938894 ATGGAGCAGCAGAAGGGGCTTGG - Intronic
1193103766 X:77644736-77644758 GTGAAGAAACAAAAAGGGATGGG + Intronic
1193549852 X:82878664-82878686 GTGGAGAGATGGAATGGGGTGGG + Intergenic
1199473436 X:148220317-148220339 GTGGGGAAAGCAAATGGGCTTGG + Intergenic
1200139899 X:153894941-153894963 CTTGAGAAACAGAGTGGGCCAGG - Intronic
1201613167 Y:15865750-15865772 TTGGAGAATGAGAATGAGCTTGG - Intergenic
1202247372 Y:22833747-22833769 GTGGAGAAACATCATCGGTTTGG - Intergenic
1202383717 Y:24302541-24302563 CTGGACAAACAGAGTGTGCTGGG + Intergenic
1202400360 Y:24467495-24467517 GTGGAGAAACATCATCGGTTTGG - Intergenic
1202470420 Y:25202591-25202613 GTGGAGAAACATCATCGGTTTGG + Intergenic
1202487066 Y:25367579-25367601 CTGGACAAACAGAGTGTGCTGGG - Intergenic