ID: 1078611981

View in Genome Browser
Species Human (GRCh38)
Location 11:12828771-12828793
Sequence ATGCAAATCAATAAGAAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 625
Summary {0: 1, 1: 0, 2: 2, 3: 57, 4: 565}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078611981 Original CRISPR ATGCAAATCAATAAGAAACA AGG (reversed) Intronic
901589094 1:10324381-10324403 AGGATAATCAATAATAAACATGG + Intronic
903444690 1:23414699-23414721 ATACAAATAAATAAGAAAATAGG - Intronic
904342011 1:29841856-29841878 ACTCAAATCAATAAGGAACAGGG + Intergenic
904843667 1:33391566-33391588 ATGCAGATGTATCAGAAACAAGG - Intronic
905593947 1:39189228-39189250 ATGGGCAACAATAAGAAACAAGG - Intronic
905859259 1:41337334-41337356 TTACAAATCAATAACAAAAAGGG - Intergenic
906011122 1:42527542-42527564 AAACAAATCAATAAGAAGAAAGG + Intronic
906597934 1:47096480-47096502 TTGGAAATCAAAAAGAAAAAAGG - Intronic
907584316 1:55603148-55603170 AATCAAATTAATAAGAAACAGGG - Intergenic
907653319 1:56317601-56317623 GTGCAAGTCAAGCAGAAACATGG - Intergenic
907931252 1:59002935-59002957 AAGGAAATCAATAAGCAAAAAGG - Intergenic
908066059 1:60406040-60406062 GTGAAAATCAATGTGAAACAGGG - Intergenic
908362264 1:63381014-63381036 ATGCTAAACATTAAGAAAAATGG + Intronic
908486275 1:64596991-64597013 AGGCAAATCACTCAGAAACCTGG - Intronic
908907528 1:69033697-69033719 ATGAAAATCTATAATAAAAAAGG + Intergenic
908936168 1:69378709-69378731 ATGTATATAAATAAAAAACAAGG - Intergenic
909415901 1:75405015-75405037 ATGGAAAGCAAAAAGAAGCAAGG + Intronic
909570009 1:77098764-77098786 CCGCAAATCAGTAAGACACAAGG + Intronic
909626723 1:77725234-77725256 AGGCAAAACAATAAGAAAAGAGG + Intronic
909741316 1:79032777-79032799 ATTCAAAATAATAAGAAAGATGG + Intergenic
909860763 1:80602472-80602494 ATACCAATCACTAATAAACAAGG + Intergenic
910180947 1:84482373-84482395 ATGCAAATAAACAGCAAACAGGG - Intronic
910492700 1:87790231-87790253 ACACAAATAAATAATAAACAAGG + Intergenic
911608730 1:99937461-99937483 AGGCAAATTAATAAGAGAAAAGG + Intergenic
911757266 1:101573106-101573128 ATCCAAAGCGATAAGAAAAAAGG + Intergenic
912156165 1:106923098-106923120 ATGCAAATTAATATAATACATGG + Intergenic
912304961 1:108558259-108558281 ATGCAAATGAATAAGACATAGGG - Intergenic
913289247 1:117257459-117257481 GTGCAAACCATTGAGAAACAAGG + Intergenic
913398869 1:118405447-118405469 ATGGAAAGCAAAAAGAAGCAGGG + Intergenic
913721597 1:121602013-121602035 ATGGAAAACAAAAAGAAGCAGGG - Intergenic
914397469 1:147284268-147284290 ATTCAAATCAATAACAAAAGTGG - Intronic
915182100 1:154071020-154071042 ATGAAAAACAATAACAAAAAAGG - Intronic
915508541 1:156372685-156372707 ATGATAATCAAGAAGAAGCAGGG - Intronic
915893479 1:159792457-159792479 AGGCAAATCAGAAAGAAACCAGG + Intergenic
917088400 1:171327494-171327516 GTGCAAAACAAAAACAAACAGGG + Intronic
917582083 1:176389543-176389565 ATGGAAAGCAAAAAGAAGCAGGG - Intergenic
917585491 1:176422999-176423021 ATGGAAATCAGAAAAAAACAGGG - Intergenic
917598716 1:176554579-176554601 TTTCAAATCAATTGGAAACATGG + Intronic
918160255 1:181891695-181891717 ATGGAAAGCAAAAAGAAGCAGGG + Intergenic
918477265 1:184938261-184938283 ATGGAAATGAATAAGAAAGAAGG + Intronic
918678279 1:187318012-187318034 ACCCATATCAATCAGAAACATGG - Intergenic
918773535 1:188596750-188596772 ATGCAAAGCAAAAAGCAAAAAGG + Intergenic
918874176 1:190018064-190018086 TTGCAAATCAATGAGAAAAATGG + Intergenic
920618231 1:207516208-207516230 TTGCCCATCCATAAGAAACAGGG - Intronic
920634666 1:207688267-207688289 TTGCCTATCCATAAGAAACAGGG - Intronic
921658188 1:217766205-217766227 ATGAAAATCAATATCAAATATGG - Intronic
922031980 1:221810062-221810084 TTGCAAATAATAAAGAAACAGGG + Intergenic
922830567 1:228551412-228551434 ATTCTAATAAATAAGAAACCTGG - Intergenic
923438669 1:233994554-233994576 ATGAAAGTCAAGAAGGAACAAGG - Intronic
924079259 1:240376413-240376435 ATACTAATTAATAAGAAAAAAGG - Intronic
924108534 1:240674256-240674278 ATTCAAATTGATAAGAAAGAGGG - Intergenic
924372487 1:243367341-243367363 ATTCAAATCAAAAATAAACCTGG - Intronic
924698930 1:246430226-246430248 ATGGATATCAATAAAATACAGGG + Intronic
1063294005 10:4783107-4783129 ATCCATTTCAATAAGAAACAAGG - Intergenic
1063351239 10:5357671-5357693 ACCAAAATAAATAAGAAACATGG + Intergenic
1064632020 10:17326186-17326208 AAGCAATTGAAAAAGAAACAGGG - Intronic
1064671159 10:17715228-17715250 ACACAAAACATTAAGAAACATGG - Exonic
1064760371 10:18612980-18613002 AGGAATATAAATAAGAAACAGGG + Intronic
1065241801 10:23712838-23712860 ATTGAGAGCAATAAGAAACACGG - Intronic
1065245770 10:23755592-23755614 ATGCAAAGCAAAAACAAACGAGG + Intronic
1066964793 10:42253170-42253192 ATGCCAATGACTAATAAACATGG - Intergenic
1068218435 10:54011983-54012005 ATGAAAATCATTGAGAATCAGGG + Intronic
1068242414 10:54320226-54320248 ATGAAAATGAAGAAAAAACAAGG + Intronic
1068499873 10:57831114-57831136 AAGGAAATCAACAAGAAAGAGGG - Intergenic
1068651823 10:59530517-59530539 ATGGAAAGCAAAAAGAAGCAGGG + Intergenic
1069073289 10:64012337-64012359 ATGCAAAAGTATAATAAACATGG + Intergenic
1069178106 10:65320228-65320250 ATGTAAATGAATAAGAAAGGAGG + Intergenic
1069245041 10:66193845-66193867 ATTGAAATCAATAAGAATTACGG + Intronic
1069330805 10:67290467-67290489 ATGCAAAACCATAAAAATCATGG + Intronic
1070683874 10:78467802-78467824 ATGCAAACCAAATACAAACAGGG + Intergenic
1070933896 10:80278947-80278969 AAGCAAAGCCCTAAGAAACAAGG + Intronic
1071001785 10:80839567-80839589 ATGGAAAGCAAAAAGAAGCAGGG - Intergenic
1071314423 10:84380326-84380348 TTCCATATCAATAAGAAAAATGG - Intronic
1072105270 10:92267736-92267758 TTGTTAATCAATAATAAACATGG - Intronic
1072194967 10:93109737-93109759 AGGCAAATTAATAAGAGAAAAGG + Intergenic
1072502156 10:96028402-96028424 ATGCAAATCAAAACTAAATAAGG + Intronic
1073746086 10:106469492-106469514 ATGGAAAGCAAAAAAAAACAGGG + Intergenic
1073990390 10:109255750-109255772 CTACATATCAATAAGAAAAATGG + Intergenic
1074194450 10:111169181-111169203 TTGAAAATCAACATGAAACAAGG + Intergenic
1074245955 10:111693635-111693657 ATGCCAATTAGTAAGAAAAAAGG + Intergenic
1074439424 10:113461881-113461903 ATGCAAATGAATAAAAACAAAGG + Intergenic
1074668266 10:115756981-115757003 ATGCAAAACAAAAAAAAGCAGGG - Intronic
1074684236 10:115944563-115944585 ATGAAAAGCAATAAAAAGCAGGG + Intronic
1074987645 10:118671793-118671815 ATGCAAAGCAAGAACACACAGGG + Intergenic
1075001299 10:118800302-118800324 ATCCAAATAACTAGGAAACAAGG + Intergenic
1075805139 10:125182776-125182798 ATGCAAAGCAAAAAAAAGCAGGG - Intergenic
1075860569 10:125672949-125672971 ATGGAAATCAGAAAAAAACAGGG - Intronic
1076212539 10:128660051-128660073 AATCAAATAAATAAGATACATGG + Intergenic
1077655441 11:4014873-4014895 ATGGAAAGCAATAAAAAGCAGGG - Intronic
1077692415 11:4357830-4357852 ATGCAAAAAAAAAAGAAACTAGG + Intergenic
1078590877 11:12640055-12640077 ATGTTATTAAATAAGAAACAAGG + Intergenic
1078611981 11:12828771-12828793 ATGCAAATCAATAAGAAACAAGG - Intronic
1078890579 11:15553278-15553300 ATGCAAATCAGGAGGAAAAAAGG - Intergenic
1079497081 11:21057119-21057141 TGTCAAATCAATAAGAAAAAAGG + Intronic
1079519586 11:21310425-21310447 ATGTAAAGCAAAAACAAACATGG + Intronic
1080817133 11:35769452-35769474 TTGTAAATTAAAAAGAAACAAGG - Intronic
1080947285 11:36988073-36988095 CTGAAAATCAAGAAGAAAAATGG + Intergenic
1080986101 11:37467909-37467931 AAACAAATAAATAAGCAACATGG - Intergenic
1081068800 11:38582983-38583005 ATGCTATGCAATAAGAAACTAGG + Intergenic
1081143606 11:39534620-39534642 ATGCAAAGCAAAAAAAAGCAGGG - Intergenic
1081252105 11:40848968-40848990 ATGGAAAGCAAAAAGAAGCAGGG - Intronic
1082892031 11:58149948-58149970 ATGCAAAAGAATAGAAAACAGGG - Intronic
1083638881 11:64134828-64134850 CTACAAATCAATAAGAAAAATGG - Intronic
1085787259 11:79464297-79464319 ATGCAGGTCAATTAAAAACAGGG + Intergenic
1086515646 11:87610111-87610133 ATACAAATGAATAACAAAAAAGG + Intergenic
1086859172 11:91904697-91904719 ATGGAAATACATATGAAACAAGG - Intergenic
1087004911 11:93460372-93460394 ATGGAAAGCAAAAAAAAACAAGG + Intergenic
1087051722 11:93892511-93892533 CTTCAAATCAGTAAGAAAAATGG - Intergenic
1087061301 11:93981047-93981069 ATGCAAAGGAGGAAGAAACAGGG - Intergenic
1087107571 11:94425659-94425681 ATGCAAATGAAAAACAAAAAAGG + Intronic
1087362096 11:97173738-97173760 ATGCAAATCAATTATGTACAAGG - Intergenic
1087435206 11:98107838-98107860 ATGCAGATCAATAAAGAACAAGG + Intergenic
1088197929 11:107296009-107296031 ATGCAAAACAAAAAAAAGCAGGG + Intergenic
1089214298 11:116826538-116826560 GTGCAAATCACTAAGAACCAAGG + Intergenic
1089222252 11:116883409-116883431 AAGTAAATCAATAAGAAACCAGG + Intronic
1090164248 11:124530837-124530859 ATAAAAATCAATAATATACATGG - Intergenic
1090475597 11:127017388-127017410 ATTCAAATGTATAAAAAACAAGG - Intergenic
1090685124 11:129108050-129108072 ATTCAATTAAATAAGAAAGAAGG + Intronic
1090715383 11:129425957-129425979 ATGTAAATGAATTAGAAACACGG - Intronic
1090724485 11:129511446-129511468 ATTCCAATCAATAAGAAAAAAGG - Intergenic
1091690974 12:2597207-2597229 CTGCAAAACAAAAAGGAACAGGG - Intronic
1091695404 12:2624991-2625013 CTGCAAATAAATAATAATCAGGG - Intronic
1092987439 12:13860072-13860094 ATGCAAATCCATATGAGCCAAGG + Intronic
1093198941 12:16163918-16163940 ATACAGATCAATTACAAACAAGG + Intergenic
1093399320 12:18725294-18725316 AAGAAAAGCAATAAGAAAGAAGG + Intronic
1093540806 12:20282455-20282477 TTGCAAATGAATAAGAAAGTAGG + Intergenic
1094362776 12:29648176-29648198 ATGCAAGTCCATAAAAAACATGG + Intronic
1094718463 12:33035607-33035629 AATGAAATAAATAAGAAACATGG + Intergenic
1094805474 12:34086571-34086593 ATGCAAATAAACTAGAAAAATGG + Intergenic
1094873222 12:34611042-34611064 ATTCCAATCAATAGGAAAAAAGG - Intergenic
1095160385 12:38907048-38907070 AAGGAAAGCAAGAAGAAACAGGG - Intronic
1095235284 12:39787694-39787716 ATGCAAATGAATAAATAGCAAGG + Intronic
1095244458 12:39902892-39902914 ATGCAACTCAATAAGGAATAAGG - Intronic
1095356032 12:41276261-41276283 ATGGAAACCAAAAAGAAACAGGG + Intronic
1096547286 12:52348866-52348888 CTGCAAATCACTAAGAAAAAAGG - Intergenic
1097768630 12:63553950-63553972 ATATAAATCAATAAGAATAAAGG + Intergenic
1098298621 12:69029851-69029873 ATGCCTAACAATAAGAAACATGG - Intergenic
1098603983 12:72367493-72367515 ATGAAAGTCTAGAAGAAACAGGG - Intronic
1098847837 12:75560066-75560088 ATGCAAAAAAAGAAGAAAAAAGG - Intergenic
1099119838 12:78675113-78675135 AAGTAAGTCACTAAGAAACAAGG + Intergenic
1099132336 12:78850617-78850639 ATGGAACACAATAAGAAAAAAGG - Intergenic
1099162222 12:79256783-79256805 AGGCAAACAAATGAGAAACATGG - Intronic
1099191203 12:79563750-79563772 ATGCAAATCAAGAAGAAAAAAGG + Intergenic
1099717891 12:86319991-86320013 AAGAAAAACAATAAGAACCACGG - Intronic
1099775148 12:87117237-87117259 ATGCAAACCAATAGCAATCATGG + Intergenic
1100107990 12:91201042-91201064 ATGCAAATCAATTTGAAAACTGG + Intergenic
1101808705 12:108089508-108089530 AGGCAAATAAAGAAAAAACAAGG - Intergenic
1103678919 12:122678013-122678035 AGGCAAATTAATAGGAAAAAAGG - Intergenic
1104545509 12:129709158-129709180 ATGGAACTCAAGAAGAATCATGG + Intronic
1104561110 12:129845681-129845703 ATTCAAATCAAAATGACACAGGG + Intronic
1105427957 13:20312019-20312041 AAGCAAATCTATCAGAAATAAGG + Intergenic
1106294549 13:28399198-28399220 ATGCAAAAAATTCAGAAACAAGG + Intronic
1106341730 13:28836116-28836138 TTAAAAATCAAAAAGAAACATGG + Intronic
1106747184 13:32717768-32717790 TTTCAAATCTATAAGAAACCAGG + Intronic
1107133635 13:36920784-36920806 AAGCAAATCAGGAACAAACAGGG - Intergenic
1108207999 13:48110423-48110445 ATGCAAAGAAATGAAAAACAAGG - Intergenic
1108545143 13:51486064-51486086 ATGGAAAGCAAAAAGAAGCAGGG - Intergenic
1108596004 13:51950131-51950153 ATGCCAGTCACTAAGAAACCCGG - Exonic
1109061015 13:57620453-57620475 CCACAAATCAATAAGAAACGTGG - Intergenic
1109926406 13:69146092-69146114 AAGCAAAACACTAAGAAAAAAGG + Intergenic
1110104599 13:71655793-71655815 AAGCAAATGAAAAAGAAAGATGG - Intronic
1110171046 13:72500565-72500587 ATAGAAAACAATAAAAAACAAGG - Intergenic
1110257476 13:73447559-73447581 ACCCAAAACAATTAGAAACATGG - Intergenic
1111210904 13:85078350-85078372 TTGCAAATAAATATGAAAAAAGG - Intergenic
1112160561 13:96862838-96862860 ATGCAAATAAGTAATAAACAAGG + Intergenic
1112985783 13:105447570-105447592 AAACAAATAAATAAGAAAAAAGG + Intergenic
1113369925 13:109714559-109714581 ATACAAATCAATGAAAAAAATGG - Intergenic
1113391016 13:109897151-109897173 TTGCAAATAAATCAGAAAGAAGG + Intergenic
1113719500 13:112543864-112543886 AAACAAATCCATAAGAAAAATGG + Intronic
1114603808 14:23979115-23979137 ATGCAAAGCAAAAAAAAGCAGGG + Intronic
1114608819 14:24021889-24021911 ATGCAAAGCAAAAAAAAGCAGGG + Intergenic
1114609424 14:24028172-24028194 ATTCCAATCAATAAAAAAGAGGG + Intergenic
1115398692 14:32935578-32935600 ATGCAAATGCATAAGATTCAGGG + Intronic
1115716306 14:36108403-36108425 ACTCAAATCAATAAGAATGAAGG + Intergenic
1116157816 14:41230842-41230864 ATGCAAATCAAACAGAAACTTGG - Intergenic
1116995118 14:51315345-51315367 CTGCAAAGCCATTAGAAACAAGG - Intergenic
1117281333 14:54244091-54244113 AGAAAAATCAAAAAGAAACAAGG + Intergenic
1118177716 14:63458409-63458431 TTGCAAAGCAAAAAGTAACAAGG + Intronic
1118507686 14:66431838-66431860 ATGCCAATCAATCAGAAATGAGG - Intergenic
1118866112 14:69704905-69704927 ATGCAAAGCAATAAGCACAATGG - Intronic
1118938192 14:70307597-70307619 ATTCCAATCAATAGAAAACAAGG - Intergenic
1119398016 14:74342561-74342583 TGACAAATCAATAAGAAAAAGGG + Intronic
1120689917 14:87581042-87581064 ATGCAGACAAAGAAGAAACAAGG + Intergenic
1120738862 14:88085568-88085590 AAACAATTCAATAAGAAATAGGG + Intergenic
1122674401 14:103399301-103399323 ACTCAAAGCAATAAGAAAAATGG - Intronic
1123796640 15:23778899-23778921 CTTCAAATCAATAAAAAAAAAGG + Intergenic
1124217774 15:27823308-27823330 ATGCTAATGAAGAAGAAAGAGGG + Intronic
1124885885 15:33685264-33685286 ATGGAAAGCAATAAAAAGCAGGG + Intronic
1125347384 15:38732094-38732116 AGGCAAACAAATAAAAAACAAGG - Intergenic
1125650498 15:41313451-41313473 ATGAAAATCATTAAGAAGCCAGG - Intronic
1126453185 15:48833080-48833102 ATGAAACTCAAAAAGAATCAGGG - Intronic
1126516012 15:49539004-49539026 ATGCAAGGCAAAAAGAAACAAGG - Intronic
1126570526 15:50145925-50145947 ATGAAAATGAATGAGAAAGATGG + Intronic
1126858052 15:52858239-52858261 ATGGAGATGAATATGAAACATGG + Intergenic
1126937574 15:53728366-53728388 ATACAATTCAAGATGAAACATGG + Intronic
1127744826 15:61956597-61956619 CTACATATCAATAAGAAAAAAGG + Intronic
1129067595 15:72919862-72919884 ATGTAATTGAAAAAGAAACAAGG - Intergenic
1129578719 15:76782205-76782227 ATGGAAAGCAAAAAAAAACAGGG + Intronic
1130003517 15:80069314-80069336 ATGCAAAATAAAAAGAAACAGGG - Intronic
1131772673 15:95756942-95756964 CTAGAAATCAATAAGAAAAAAGG + Intergenic
1131812313 15:96185355-96185377 ATGGAAAGAAATAAGATACAAGG + Intergenic
1132370794 15:101296558-101296580 CCACAAATCAATAAGAAAAAAGG - Intergenic
1134835682 16:17358653-17358675 ATGTAAAGAAAAAAGAAACAAGG + Intronic
1135204689 16:20473472-20473494 AGGCAAAGCAATAAGGAATATGG + Intronic
1135762031 16:25145461-25145483 ATTCAAAGCAAAAAGATACAGGG + Intronic
1135839616 16:25863105-25863127 ATGCAAATCAATTAGAAAATAGG - Intronic
1136730487 16:32407159-32407181 ATGCCAATGACTAATAAACATGG - Intergenic
1137422175 16:48344612-48344634 ATGGTAATCAATAAGAATCTTGG + Intronic
1139016967 16:62701655-62701677 ATGCAATCCAATATGACACAGGG + Intergenic
1139494891 16:67309197-67309219 AAGAAAAGCAAAAAGAAACATGG + Intronic
1140641790 16:76982787-76982809 ATGTAGATCAGTAACAAACATGG - Intergenic
1142103301 16:88286998-88287020 AAGCAAAAGAATAAGAAAAACGG - Intergenic
1142438735 16:90079825-90079847 ATGCTATTCAGCAAGAAACAGGG - Intronic
1202995918 16_KI270728v1_random:110153-110175 ATGCCAATGACTAATAAACATGG + Intergenic
1203022605 16_KI270728v1_random:422495-422517 ATGCCAATGACTAATAAACATGG + Intergenic
1143246343 17:5488713-5488735 AAGCAAATCAATAAAAAATAAGG - Intronic
1143917880 17:10307504-10307526 AGGCAAATCAATTAAAAAAAGGG + Intronic
1145375439 17:22343323-22343345 ATTCAAGTAAAGAAGAAACAAGG - Intergenic
1146168161 17:30608476-30608498 AAGAAGATCCATAAGAAACAAGG + Intergenic
1146221129 17:31021956-31021978 AAGAAGATCCATAAGAAACAAGG + Intergenic
1147010909 17:37447019-37447041 ATGAAAATCAATAATTTACAGGG - Intronic
1147285225 17:39397317-39397339 ATGAAAAACAATAATGAACATGG + Intronic
1147314866 17:39615071-39615093 AAATAAATCAATAAGAAAAAAGG - Intergenic
1150366671 17:64593505-64593527 AAGAAGATCCATAAGAAACAAGG - Exonic
1150965329 17:69961354-69961376 ATGGAAAACAATATGAAACAAGG + Intergenic
1151079251 17:71309620-71309642 AAGCAAATGAAAACGAAACAGGG + Intergenic
1152302207 17:79501663-79501685 ATGCAAATCAATAATGTATAAGG - Intronic
1153318232 18:3745624-3745646 ATAAAAATAAATAAAAAACAAGG + Intronic
1153424003 18:4943348-4943370 ATTCAAATCAATTTTAAACAAGG + Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153965461 18:10177393-10177415 ATGGAAATCAAAAAAAATCAGGG - Intergenic
1154063018 18:11081330-11081352 ATGCCAATCATTAGGAAACATGG + Intronic
1154159668 18:11971910-11971932 ATGCAATTGAAAAAGAAATAAGG + Intergenic
1154328467 18:13409438-13409460 ATGGCAATAAATAAGAGACAAGG - Intronic
1155155631 18:23155207-23155229 AAGGAAATGAATAAGATACATGG + Intronic
1156435266 18:37120146-37120168 ATGCAAATGAATCAGAGGCAGGG + Intronic
1156567271 18:38206627-38206649 TTGTAAATCAATAATAAAAAAGG + Intergenic
1157117128 18:44872432-44872454 ATGCAAACCAACAAAAAATAAGG - Intronic
1157130678 18:45004563-45004585 AGGTAAATGAAAAAGAAACAGGG + Intronic
1157508267 18:48247623-48247645 AAGCATATCACTGAGAAACAGGG - Intronic
1158117013 18:54006449-54006471 ATGCACATCCATAAGCATCATGG + Intergenic
1159189369 18:65021728-65021750 TTTCAAATCCAAAAGAAACAGGG - Intergenic
1159671626 18:71227298-71227320 GTGCAGATCCATAAAAAACAGGG - Intergenic
1159991259 18:74911489-74911511 ATAAAAATCAATAAAAAATAAGG - Intronic
1164060320 19:21667095-21667117 TTGCAAATCAATAAAAACAAGGG + Intergenic
1167192226 19:47999179-47999201 ATGAAAAAAAATAATAAACAGGG - Intronic
1168663473 19:58184813-58184835 TTTCAAATGAATAAGAAATAGGG + Intronic
925784361 2:7415909-7415931 ATAGAAAAAAATAAGAAACAAGG - Intergenic
927772215 2:25873128-25873150 ATGCAAAGGAATAAGAACAATGG - Intronic
928037503 2:27838692-27838714 ATGCAAATCTGTAATAGACAAGG + Intronic
928801433 2:35098680-35098702 ATGGAAAACAATAAAAAGCAGGG - Intergenic
929179949 2:39027045-39027067 ATTCAAGTCAGTAAGATACAAGG + Intronic
930154999 2:48097735-48097757 TTGCAAATCCACAAGAACCATGG + Intergenic
930294243 2:49534376-49534398 ATGAAAAAAAAAAAGAAACAAGG + Intergenic
930923398 2:56785878-56785900 AAGCTAACCAATAAGAAAAATGG - Intergenic
931667359 2:64618866-64618888 AGGAAAAACAGTAAGAAACAAGG + Intergenic
932104136 2:68927459-68927481 TTGCAAATGAATAAGGACCACGG + Intergenic
932110828 2:68998370-68998392 ATGCATATCATTGAGAAACATGG - Intergenic
932138464 2:69253663-69253685 AAGCAAATCAACAATAGACATGG + Intergenic
932508655 2:72262816-72262838 CTGCAAATCAATAAGACAAAAGG + Intronic
932802358 2:74752177-74752199 ATGCAAACAAATAACAAAGAAGG - Intergenic
933541953 2:83655752-83655774 ATGCACATCAATACAAAAGAAGG + Intergenic
934186794 2:89685208-89685230 ATGCCAATGACTAATAAACATGG - Intergenic
934315233 2:91912021-91912043 ATGCCAATGACTAATAAACATGG + Intergenic
934849703 2:97690215-97690237 ATAAAAAACAATAAGAAAAAGGG - Intergenic
934877489 2:97938347-97938369 ATGGAAATCAAAAAAAAGCAGGG + Intronic
935393443 2:102579944-102579966 ATGCAAGTTAATTAGAAACCAGG + Intergenic
936663131 2:114564456-114564478 ATGAGAATCAATATGAAATAGGG - Intronic
936775122 2:115963838-115963860 ATGAAAATCAATAAAAAAGCAGG - Intergenic
936807983 2:116360185-116360207 ATGGAAAACAAAAAGAAGCAGGG + Intergenic
936819890 2:116508020-116508042 ATGGAAATCAAAAAAGAACAGGG - Intergenic
937138853 2:119580486-119580508 GTGCAAATTAATTAGAAACAGGG + Intronic
937528261 2:122797291-122797313 AATCAAATAAATAAGAAATATGG - Intergenic
937663978 2:124463412-124463434 AACCAAAACAATAAGAAAAATGG + Intronic
937807169 2:126160244-126160266 ATGTAAATGAATAAGGTACATGG - Intergenic
937807526 2:126163106-126163128 ATGGAAAGCAATAAAAAGCAGGG + Intergenic
938627520 2:133127343-133127365 ATGCAAATCAGTAAAAGACATGG - Intronic
939218988 2:139278141-139278163 ATGCAAATGGATAAAGAACATGG + Intergenic
939874571 2:147562867-147562889 ATCCAAATCAATAAGACCCTTGG + Intergenic
939937522 2:148311471-148311493 ATGGAAAGCAATAAAAAGCAGGG - Intronic
939942299 2:148364660-148364682 ATGGAAAGCAATAAAAAGCAGGG + Intronic
939947164 2:148423869-148423891 ATGGAAAGCAATAAAAAGCAGGG + Intronic
940723763 2:157311122-157311144 ATGAAAATCAATTAAAAAAATGG - Intronic
940876335 2:158901195-158901217 ATACACATACATAAGAAACAAGG - Intergenic
941393876 2:164950245-164950267 ATGAGAATCAATGAGAATCAAGG - Intronic
941698975 2:168583461-168583483 AAGCAAATGAAAAAGAAGCAAGG - Intronic
941884842 2:170517266-170517288 GTGTAAATTAATAAGAAACATGG + Intronic
943009933 2:182434960-182434982 ATTTAAATCCATCAGAAACAAGG + Intronic
943938022 2:193949710-193949732 ATTCAAATCAATAAAAATCCAGG - Intergenic
943970986 2:194405810-194405832 ATGGAAAGCAATAAAAAGCAGGG + Intergenic
944333986 2:198507278-198507300 AGGCAAATAAAGAAGAAAAAAGG + Intronic
944645644 2:201778509-201778531 ATACAGATGAATAAGAGACAGGG + Intronic
944996029 2:205294850-205294872 ATGGTAATGAATAGGAAACAGGG + Intronic
945123138 2:206479809-206479831 ATACAGAACAATGAGAAACAAGG - Intronic
946660646 2:221995528-221995550 ATGCAAATCAAAAACCAAAATGG - Intergenic
948164152 2:235848366-235848388 AGGTAAATGAATAAGGAACAAGG + Intronic
1168852586 20:986777-986799 CTATAAATCAATAAGAAAAAGGG + Intronic
1170005546 20:11664819-11664841 TTGCAAATCAAAAACAAAAAAGG - Intergenic
1170128324 20:12990123-12990145 ATACATATGAATAAGACACAGGG + Intergenic
1170389068 20:15852250-15852272 CTTCAACTCAATAAGAAAAATGG - Intronic
1170398167 20:15950650-15950672 ATTCAGATCTATAAGCAACACGG + Intronic
1170520723 20:17182052-17182074 ATGGAAATCAAAAAGAAGCAGGG + Intergenic
1170814616 20:19703017-19703039 ATGTAAATGAACAAGAAACAGGG + Intronic
1175373347 20:58507784-58507806 TTACAAATCAATAAGAAAAATGG + Intronic
1175473033 20:59246716-59246738 ATGAAAATTACTAAGAAAAATGG + Intronic
1175557868 20:59885205-59885227 ATTTAATTCAATAAGCAACAGGG + Intronic
1177341536 21:19808426-19808448 ATTGAAATAAATAAGTAACATGG + Intergenic
1177622503 21:23614631-23614653 ATGCAAATAAATACCAAAAATGG - Intergenic
1178949589 21:36975269-36975291 ATGGAAATAAACAAGACACAGGG - Intronic
1178982336 21:37275393-37275415 TTGCAAATCTATAAAGAACAGGG + Intergenic
1180541995 22:16457901-16457923 ATGCCAATGACTAATAAACATGG + Intergenic
1181451578 22:23026257-23026279 ATGCAAATTAATAAGGAAGAAGG + Intergenic
1183741653 22:39671986-39672008 ATACACATAAATAAGAAAAAGGG + Intronic
949222166 3:1648684-1648706 ATTCAAGTTCATAAGAAACATGG + Intergenic
949225073 3:1683964-1683986 ATGGAAAACAAAAAAAAACAGGG + Intergenic
949407790 3:3732951-3732973 ATGCAAATCAATAAATGAGAAGG - Intronic
949643057 3:6061704-6061726 ATGTAAATCAATTAGAAGAAGGG + Intergenic
950759650 3:15209780-15209802 ATGTAAGTCTATAGGAAACAAGG - Intronic
950933765 3:16817835-16817857 TTGGAAATCAATAAGGAAGAAGG - Intronic
951546214 3:23828912-23828934 ATGTCCATCAATAAGTAACAGGG + Intronic
951812068 3:26711768-26711790 ATGCAAAGAAGTGAGAAACAAGG + Intergenic
952425748 3:33173065-33173087 ATTCAAATCAATTAGAAAAATGG + Intronic
952513793 3:34083534-34083556 ATGGAAAACAAAAAGAAGCAGGG - Intergenic
952515160 3:34096379-34096401 ATGGAAAACAAAAAGAAGCAGGG + Intergenic
954542005 3:51399660-51399682 ATCAAAATCAGAAAGAAACAGGG + Intronic
955045477 3:55355486-55355508 ATTCAAAACAATAAAAAACGGGG - Intergenic
957826028 3:85445534-85445556 TTGAAAAACAATAAGAAATATGG + Intronic
958054097 3:88387045-88387067 ATGAAAGTGAATAGGAAACATGG + Intergenic
958163383 3:89847637-89847659 AAGTAAATCAATAACAAAGAAGG - Intergenic
958617050 3:96507740-96507762 ATGCCAATAAATAAGATATAAGG + Intergenic
958647961 3:96897329-96897351 TTGCAAATAAATAAGAAAATGGG - Intronic
959143672 3:102517523-102517545 ACGCAAATCAATAAGAAGAAAGG - Intergenic
959775446 3:110155302-110155324 ATGCAAATAAATATGAATTATGG - Intergenic
959998639 3:112706509-112706531 ATGCAAATCAAAAACAAAATGGG - Intergenic
960115323 3:113886661-113886683 ATGCAAAGCAAGAAGAAGCAAGG + Intronic
960741973 3:120844082-120844104 ATGAAAAAAAATAAGAAAAATGG - Intergenic
960827427 3:121805162-121805184 ATGCAAATAAACAAGAAAACAGG - Intronic
961395885 3:126589790-126589812 ATGGAAAACAAAAAGAAGCAGGG - Intronic
962543267 3:136405155-136405177 ATGCAAATAAATAATCAATATGG + Intronic
963839175 3:150087712-150087734 TTACAAATCAATAAGAAAAAGGG + Intergenic
964144100 3:153437836-153437858 ATGCAAAACCACCAGAAACAGGG - Intergenic
964329016 3:155580024-155580046 ATACAATTCAAAAACAAACATGG + Intronic
965161309 3:165136917-165136939 ATTCCAATCAATAGGAAAGAGGG - Intergenic
965230532 3:166045993-166046015 ATGCAAAACTATAAAAATCATGG - Intergenic
965743644 3:171902619-171902641 CTGAAAATCAATAGGAAAAATGG - Intronic
966150607 3:176863604-176863626 ATGGAAAACAAAAAAAAACACGG + Intergenic
966494686 3:180566572-180566594 ATGCAAAACACTAAGGAACTGGG + Intergenic
967313429 3:188128042-188128064 AAGCAAAACAAAAAGAAAGATGG + Intergenic
967363582 3:188660118-188660140 AAGCAAATCTATGAGAAATACGG - Intronic
967472101 3:189873987-189874009 ATGCAAATGAACAATAAAAATGG + Intronic
967674992 3:192287136-192287158 ACGTTAATCAAAAAGAAACAGGG - Intronic
967683921 3:192397831-192397853 TTAAAAATCATTAAGAAACAGGG - Intronic
969996800 4:11321459-11321481 ATTCCAATCAATATTAAACAAGG - Intergenic
970225096 4:13849539-13849561 ATGCAACTTAATAAGCAAGAAGG + Intergenic
970659799 4:18271923-18271945 ATACAAATCATTATGAAAAAGGG - Intergenic
970685467 4:18561703-18561725 ATGGAAAGCAAAAAGAAGCAGGG + Intergenic
971652585 4:29297590-29297612 TTACAAATCATTAAGAAATATGG - Intergenic
972196398 4:36658345-36658367 ATGGAAAGCAAAAAGAAGCAGGG + Intergenic
972912855 4:43839834-43839856 ATGAAAATGAAAATGAAACATGG - Intergenic
973775108 4:54234635-54234657 ATGCAAAGCATTAACAACCAAGG - Intronic
973938430 4:55876809-55876831 ATGGAAATTAAAAAGAAAAAAGG - Intronic
974198486 4:58608763-58608785 ATGAAAATGAGTAAAAAACAAGG + Intergenic
974439107 4:61894226-61894248 ATCCAAATCAATAATACCCAAGG - Intronic
974504030 4:62744891-62744913 ATGTAAAGCAATAAAAAGCAGGG + Intergenic
974810908 4:66944629-66944651 GGGCAAAACAATGAGAAACACGG + Intergenic
974885506 4:67811968-67811990 ATGCAAAGCAAAAAGAAGCAGGG + Intergenic
975580293 4:75901213-75901235 CTAGAAATCAATAAGAAAAATGG + Intronic
975611138 4:76204702-76204724 ATGTGAATAAATAAGAAATAAGG + Intronic
976052358 4:81024243-81024265 ATGTAAATCACTAAGAAAATGGG + Intergenic
976961154 4:90976296-90976318 ATACAACTCATGAAGAAACAGGG + Intronic
976975663 4:91163754-91163776 ATGCAAAGCAAAAAAAAGCAGGG - Intronic
977493222 4:97739819-97739841 ATTCCAATCAATAAAAAAGAGGG + Intronic
977531517 4:98206219-98206241 TTGCTAATCAATAAGAAAAAAGG + Intergenic
977620663 4:99133387-99133409 AAGCACATCAAAAAGAAAGAGGG + Intronic
977669118 4:99675476-99675498 ATGCTAAGCAATAAGAACAAAGG + Intergenic
977947476 4:102930111-102930133 ATGCCAATGACTAATAAACATGG + Intronic
977968837 4:103189246-103189268 ATTCTAATCAATACAAAACAAGG + Intronic
978104359 4:104883608-104883630 AGGCAAAAAATTAAGAAACAGGG - Intergenic
978718056 4:111869621-111869643 ATGTAAATGAAAAATAAACAAGG + Intergenic
979414681 4:120421653-120421675 TTGCAAATCATTTAAAAACATGG - Intergenic
979487707 4:121287105-121287127 ATGGAAAGCAATAAAAAGCAGGG + Intergenic
980320240 4:131263053-131263075 ATGCAATACAATAAAAAACTTGG + Intergenic
980593798 4:134926837-134926859 ATGGAAAGCAATAAAAAGCAGGG - Intergenic
980723231 4:136723746-136723768 CTGCAAATCAATCAGAAAAATGG + Intergenic
980874086 4:138643202-138643224 ATGCATATTGATTAGAAACATGG + Intergenic
981851453 4:149234874-149234896 CTGAAAGTCAGTAAGAAACATGG + Intergenic
982031442 4:151305220-151305242 ATGCAAAGAAATAAGAAATATGG + Intronic
982347353 4:154374788-154374810 AAGCAGATGAAAAAGAAACAAGG + Intronic
982614004 4:157616936-157616958 AAGCAATTACATAAGAAACAAGG - Intergenic
982706382 4:158714458-158714480 ATGCAAATGAATAAAAAACCAGG + Intronic
982871834 4:160589432-160589454 ATGAAAATTACTAAGAAAAATGG - Intergenic
982928754 4:161375042-161375064 ATGGAAATGAATAAGCAGCACGG + Intergenic
982940167 4:161540553-161540575 ATAGAAATCAATAAGAAATAAGG - Intronic
982950517 4:161688925-161688947 AATAAAATCAGTAAGAAACAAGG - Intronic
983009508 4:162529197-162529219 ATGTAAATCAATACGTAATACGG + Intergenic
983290109 4:165791304-165791326 CTACAAATGAATAAGAAAAAAGG - Intergenic
983399099 4:167240622-167240644 ATGAAAACCAATATGATACAAGG - Intergenic
983748571 4:171233262-171233284 ATGGAATTCAATAACAAAGAGGG - Intergenic
983883108 4:172954977-172954999 AAGGAAATCAATAAAAGACAAGG + Intronic
984378269 4:178959075-178959097 AAGCAAATAAATGAGAAAAATGG + Intergenic
984503580 4:180589546-180589568 ATTCAGAACAATAAGAAGCAAGG + Intergenic
984825295 4:183918957-183918979 TTGCAAATGAATAAGTAACATGG - Intronic
984854569 4:184183707-184183729 ATGCATATCAATAAGTCACATGG + Intronic
985565608 5:614215-614237 ATGCAAAGCAAGCAGAAAGAAGG - Intronic
985953908 5:3246970-3246992 ATGGAAAACAGTAAGAAATACGG - Intergenic
986005775 5:3667773-3667795 ATGGAAAGCAAAAAGAAGCAAGG - Intergenic
987245967 5:16049138-16049160 ATGCAAATCATTCATAAACATGG + Intergenic
987599802 5:20053067-20053089 ATGTAAATCTCTAAGAAAAAAGG + Intronic
987748993 5:22015419-22015441 ATGTAATTCAACAAGAAAAATGG + Intronic
987836181 5:23165997-23166019 ATGTCAATCAATAAAACACAGGG - Intergenic
987851520 5:23361592-23361614 ATGCAAGTCAAAAATCAACAGGG + Intergenic
988418870 5:30980850-30980872 ATAAAAATCAATAAGACAAATGG + Intergenic
989310064 5:40005334-40005356 ATGCAGACTAATAAGAAGCAAGG - Intergenic
989321354 5:40137752-40137774 ATGCAAATCAAAAAGAGAAGAGG + Intergenic
989501582 5:42174777-42174799 AAGCAAATGTATCAGAAACATGG - Intergenic
989518002 5:42365627-42365649 TTGCAAATAAATAAGAAATTGGG - Intergenic
989786998 5:45344616-45344638 ATGCAAATCCAAAATAAGCAGGG + Intronic
990615036 5:57499081-57499103 AGGAAAATCAAGAAGAACCAGGG - Intergenic
990840495 5:60074826-60074848 ATGCAAAACAGAAAAAAACAGGG - Intronic
990870203 5:60422863-60422885 ATGGAAAGCAAAAAGAAGCAGGG + Intronic
991312853 5:65263851-65263873 ATGAATAACAATAAGGAACATGG + Intronic
991515398 5:67429344-67429366 ATGAAAATAACTAAGAAGCAAGG - Intergenic
992197170 5:74351369-74351391 ATGTAAATTAATAAGAATGATGG - Intergenic
992604205 5:78439037-78439059 ATGGAAAGCAAAAAGAAGCAGGG - Intronic
992756801 5:79914556-79914578 ATTCCAATCAATAGGAAAGAGGG + Intergenic
993872842 5:93272257-93272279 ATGCTAATGAATAATAGACAAGG - Intergenic
994265541 5:97711631-97711653 ATGAAAACCAATAAGAACCTTGG + Intergenic
994533938 5:101004088-101004110 ATGCAAATCAATAACATTAAAGG + Intergenic
994850849 5:105053364-105053386 ATGGAAAGCAAAAAGAAGCAGGG - Intergenic
995152701 5:108868073-108868095 GTGAAAATCAAGAAGAATCAAGG - Intronic
995384381 5:111572698-111572720 ATACTAGTCAATAAGAAATAAGG - Intergenic
995529382 5:113076975-113076997 ATGGAAAACAAAAAGAAGCAGGG + Intronic
996652175 5:125892245-125892267 GTGCATGTCAAGAAGAAACATGG + Intergenic
997220124 5:132155248-132155270 ATGGAAAGCAAAAAGAAGCAGGG - Intergenic
997821013 5:137065969-137065991 AAGCCCATCATTAAGAAACAAGG + Intronic
998793795 5:145795136-145795158 AGTCAACTCAGTAAGAAACATGG + Intronic
999346873 5:150830836-150830858 CTACAAATCAATAAGAGACGAGG + Intergenic
999593567 5:153176421-153176443 AAGCAAACCAATAACAAATAGGG - Intergenic
1000002005 5:157147980-157148002 ATAAAAATCAGGAAGAAACAGGG - Intronic
1001152000 5:169238596-169238618 TTGCAAAGCAATGAAAAACATGG + Intronic
1001196800 5:169680389-169680411 AAACAAATCAATACCAAACAGGG + Intronic
1202775712 5_GL000208v1_random:68751-68773 ATTCCAATCAATAAAAAAGAGGG + Intergenic
1003033483 6:2622964-2622986 ATGCAAATAAATAAGAGGAATGG + Exonic
1004421891 6:15478031-15478053 TAGCAAAGCAAGAAGAAACAGGG - Intronic
1004730853 6:18357592-18357614 ATGGAAAACAAAAAAAAACAGGG - Intergenic
1004969891 6:20898203-20898225 ATACAAACCAACAAGAGACAGGG - Intronic
1005182633 6:23123776-23123798 ATGGAAAGCAAAAAAAAACAGGG - Intergenic
1006879876 6:37330131-37330153 CTACAAATCAGTAAGAAAGAAGG - Intronic
1007216171 6:40240568-40240590 ATGCAAAACTATAAAAAACCTGG + Intergenic
1007233656 6:40373008-40373030 ATACAAACCAATAAGAAAATGGG + Intergenic
1007244350 6:40449599-40449621 ATGCAAAACAATAAGATGGAAGG + Intronic
1007266264 6:40598610-40598632 GTGCAGTTCAAGAAGAAACAGGG - Intergenic
1008973587 6:57398970-57398992 ATGGAAATCAGAAAAAAACAGGG - Intronic
1009162484 6:60300522-60300544 ATGGAAATCAGAAAAAAACAGGG - Intergenic
1009455491 6:63850993-63851015 ATGGAAAGCAAAAAGAAGCAGGG + Intronic
1010130031 6:72481036-72481058 ATGCATATCACTAATAATCAGGG + Intergenic
1010355669 6:74929970-74929992 ATGAAAAGCAATAGGAGACAGGG + Intergenic
1010374549 6:75151571-75151593 ATGGATATCAAAAATAAACACGG + Intronic
1011860440 6:91748295-91748317 ATGCAAAACAAGAAGAAATTAGG + Intergenic
1011928989 6:92686036-92686058 ATGCAGAACCACAAGAAACATGG + Intergenic
1012207157 6:96475925-96475947 ATGGAAAGCAAAAAGAAGCAGGG - Intergenic
1012230671 6:96757767-96757789 AGGCATATCATTAAGAAACATGG + Intergenic
1012295112 6:97512644-97512666 ATCCAAATGAAGAAGAAAGAGGG - Intergenic
1012561926 6:100592320-100592342 ATGCAAGTCAATAAGAATGTTGG - Intronic
1013660239 6:112288564-112288586 AAGCAAAACAGAAAGAAACATGG - Intergenic
1015012912 6:128374037-128374059 AGGAAAATAAATAACAAACAAGG - Intronic
1015050399 6:128833055-128833077 ATTCCAATCAATAAAAAAGAGGG + Intergenic
1015349943 6:132206260-132206282 ATGAAAATCCCTAAGAAACTAGG - Intergenic
1015741162 6:136455434-136455456 CAGAAAATCAATAAGAAATAGGG + Intronic
1015907835 6:138136071-138136093 AAAGAAATCAATAAGAAACTGGG - Intergenic
1016629801 6:146215104-146215126 ATACAAAACAATAACAAATATGG - Intronic
1016676814 6:146780234-146780256 ATACAAACAAATAAAAAACAAGG + Intronic
1016757677 6:147704546-147704568 ATGCAAATCAGAAAAAAAAAGGG + Intronic
1017991824 6:159495467-159495489 ATGCAAATAAATTAGAAGGAAGG - Intergenic
1020596319 7:10212239-10212261 ATGCACATCAAAATGAAACAAGG + Intergenic
1020604985 7:10326029-10326051 TTGCAAATCAAGAAGTAAAATGG + Intergenic
1022064163 7:26833540-26833562 ATGGAAAGCAATAAAAAGCAGGG + Intronic
1022832109 7:34078408-34078430 ATTCAAAAAAATTAGAAACATGG - Intronic
1023147064 7:37161832-37161854 ATGCCAATCAATGAAACACAGGG - Intronic
1023374658 7:39543954-39543976 ACGTAAATCACTAAGCAACAGGG + Intergenic
1024454656 7:49590072-49590094 ATACAGATCAATAAAAAACGTGG - Intergenic
1024998276 7:55292743-55292765 ATGGAAAGCAAAAAGAAGCAGGG - Intergenic
1025575864 7:62640627-62640649 ATTCCAATCAATAAAAAAGAGGG + Intergenic
1026262194 7:68764980-68765002 ATGCAAGTAAAAAAGAAACATGG - Intergenic
1026274093 7:68861829-68861851 ATGTAAATCAATAAAGACCATGG + Intergenic
1027946382 7:84749956-84749978 ACGTAAAGCAACAAGAAACAAGG + Intergenic
1028364925 7:90017475-90017497 ATGCATATCATTAAGGAAAAAGG - Intergenic
1029042164 7:97587544-97587566 ATTCAAAGCAACATGAAACATGG - Intergenic
1029164495 7:98577622-98577644 AAGAAAAGAAATAAGAAACAAGG + Intergenic
1030000464 7:105054351-105054373 AGGCAAATCATTAAGACACTTGG + Intronic
1030748388 7:113197977-113197999 ATACAAATCAATTACAAAAATGG + Intergenic
1031269123 7:119622600-119622622 ATGAAAAAGAATAAGAAAAATGG + Intergenic
1031387212 7:121166173-121166195 ATGTTATTCAATAAGATACATGG + Intronic
1031513665 7:122677311-122677333 TTGCAAATCAAAAGGAACCAAGG + Intronic
1031551572 7:123120321-123120343 ATGCAAAACAATAAGAACAGTGG - Intronic
1031630289 7:124035752-124035774 ATGAAAATATAAAAGAAACATGG - Intergenic
1032204314 7:129848426-129848448 CTGTAATTCAATAAGGAACAGGG + Intronic
1032470395 7:132174468-132174490 ATGCACAGAAACAAGAAACACGG - Intronic
1032623187 7:133559130-133559152 ACACAAATCAATAAGAAGTATGG - Intronic
1033580976 7:142735228-142735250 ATGCAAATGAAAAACAAAAAAGG + Intergenic
1033757771 7:144409323-144409345 ATGCAAATTTATTAGAAAAAAGG + Intronic
1034075619 7:148228436-148228458 ATGCAAATCAACAGGAAAGATGG - Intronic
1034228862 7:149503509-149503531 GTGCAAATCAACAACAATCAGGG + Intergenic
1034730438 7:153382421-153382443 ATGGTTATAAATAAGAAACACGG + Intergenic
1036105851 8:5837988-5838010 ATGAAAATCAGTAAGAGAGATGG - Intergenic
1036724245 8:11205272-11205294 ATAGAAGTCAATAAGATACAAGG - Intergenic
1036762674 8:11521152-11521174 ATTCAAATCAGTAAGAAAAATGG + Intronic
1036985817 8:13529686-13529708 AAGCAAATAGATAAGAAAAAAGG + Intergenic
1037154875 8:15687326-15687348 ATGTAACTCAATAAGAAGCGAGG - Intronic
1038799516 8:30736772-30736794 ATACAATTCAAAAATAAACAAGG - Intronic
1038811778 8:30853870-30853892 TTGCAAATACATAAAAAACATGG + Intronic
1039126050 8:34203195-34203217 TTGGAAATCAAGAAGAAACATGG + Intergenic
1039133654 8:34295862-34295884 GAGCAAGTCATTAAGAAACAAGG + Intergenic
1039275217 8:35927485-35927507 ATGCAAATCTAGAACAAAAAGGG - Intergenic
1039342810 8:36670202-36670224 ATGGAAAGCAAAAAGAAGCAGGG - Intergenic
1039723648 8:40191779-40191801 AAGCATATCAATAAAAAATATGG - Intergenic
1040067125 8:43155321-43155343 ATGCACATCACTAATAATCAGGG - Intronic
1040273333 8:45982570-45982592 ATTCCAATCAATAAAAAAGAGGG - Intergenic
1040472726 8:47748859-47748881 ATGAAAACCAATAAGAAACTAGG + Intergenic
1040478260 8:47800030-47800052 ATTCAAATAAATAGGAAGCACGG + Intronic
1040601100 8:48884561-48884583 ATGAAGATACATAAGAAACAGGG + Intergenic
1040682992 8:49836498-49836520 AAGCAACTTAATAAGAAAGAAGG + Intergenic
1040922229 8:52634147-52634169 AAACAAATCAATAAAAACCAGGG + Intronic
1041486284 8:58380791-58380813 ATACAAATAAATAAGACTCAAGG + Intergenic
1041542650 8:59003675-59003697 ATGAAAATCAATTTGAAATATGG + Intronic
1041547967 8:59067790-59067812 ATGCAAATTAATAGGTAAAATGG - Intronic
1042379645 8:68098072-68098094 ATCCAAATTAATAAAATACATGG + Intronic
1042514272 8:69643242-69643264 ATTCAATCCAATAAGATACAAGG - Intronic
1042677814 8:71342017-71342039 TTGCAAAACAAAAAGGAACATGG - Intronic
1042924196 8:73950792-73950814 ATGTAATTCAATATGAAATATGG + Intronic
1042967821 8:74374293-74374315 ATTCCAATCAATAGAAAACAAGG - Intronic
1043197889 8:77323084-77323106 AAGTAAATAAATGAGAAACAAGG + Intergenic
1043291468 8:78606800-78606822 TTGCAAAAGAATAAGAAATAAGG - Intergenic
1043442949 8:80292402-80292424 ATGAAAGTCATTAAGAAAAAAGG - Intergenic
1043510016 8:80941089-80941111 TTGGAAATTAATAAGGAACAAGG + Intergenic
1043708569 8:83383391-83383413 ATGGAAATCAATAAAGAGCAGGG + Intergenic
1044080860 8:87881570-87881592 GTGGAAATCAATAAAAATCAGGG + Intergenic
1044191117 8:89318850-89318872 ATGAGAATAGATAAGAAACAAGG + Intergenic
1044267973 8:90205473-90205495 ATGGAAAGCAATAAAAAGCAGGG + Intergenic
1044283094 8:90379026-90379048 ATTCCAATCAATAAAAAAGAGGG + Intergenic
1044484165 8:92730627-92730649 AGGCAAATCCATAAGACTCAAGG + Intergenic
1044690656 8:94874245-94874267 ATGCATATCAAAAAAAAAAACGG - Intronic
1045331128 8:101156708-101156730 ATGCAAATCAATGACACCCATGG - Intergenic
1046073361 8:109285622-109285644 ATACAAATCCTTAAGAAACTAGG + Intronic
1046157488 8:110312020-110312042 ATGCAAAATAATTAGAATCATGG + Intergenic
1046466405 8:114609567-114609589 ATGCAAATAAAATAAAAACAAGG - Intergenic
1046500922 8:115075501-115075523 ATGAAAAGAAAAAAGAAACAAGG - Intergenic
1047878185 8:129163887-129163909 TTGCAATTACATAAGAAACATGG - Intergenic
1048120256 8:131572690-131572712 ATGTAATTAAATAAAAAACAAGG - Intergenic
1048422402 8:134290431-134290453 ATGGGAATCAGTAATAAACATGG - Intergenic
1048511584 8:135067245-135067267 ATGCAAATTGATAAGAACCAGGG + Intergenic
1048796595 8:138155614-138155636 ATGGAAAACAAAAAAAAACAGGG + Intronic
1049073532 8:140375571-140375593 CTGCATATCCCTAAGAAACAGGG + Intronic
1049138958 8:140933692-140933714 AGGCAAATCTATAAGAAAGTAGG + Intronic
1050239668 9:3622153-3622175 ATGGAAAGCAAAAAGAAACAGGG - Intergenic
1051528201 9:18071012-18071034 AAGCAAAGCAAGAAAAAACAGGG + Intergenic
1051833537 9:21308885-21308907 TGGAAAATCAATAAGAAATATGG + Intergenic
1051858104 9:21592781-21592803 ATGAAAATAAATTAGAAAAAAGG - Intergenic
1051899345 9:22022473-22022495 ATGCAAATCAGAAAAAAGCAGGG - Intronic
1052015488 9:23459781-23459803 AAGCAAATCACTAAAAAACAAGG + Intergenic
1052240956 9:26272899-26272921 ATGCAGAGCAATAAACAACACGG - Intergenic
1052583999 9:30401023-30401045 ATGCAAATAAATAAGAAATATGG - Intergenic
1052619628 9:30889577-30889599 ATGCTTAACAATTAGAAACATGG - Intergenic
1054707431 9:68477268-68477290 ACTAAAATCAATAAGAAAAAGGG - Intronic
1054898945 9:70346922-70346944 ATACAAAGGAATAATAAACAGGG - Intronic
1055875046 9:80932092-80932114 AAGCAACTCAAGAAAAAACAAGG - Intergenic
1057046273 9:91888702-91888724 ATGTGCATTAATAAGAAACAAGG + Intronic
1057710601 9:97439436-97439458 ATGCAAAGCAATTAGGAAAAAGG - Intronic
1057957879 9:99425408-99425430 ATGCAAGCCAATTAGAAAAATGG - Intergenic
1058119085 9:101118884-101118906 AAGCAAAACAAAAAAAAACATGG - Intronic
1058260047 9:102816694-102816716 ATGGAAAGCAAAAAGAAGCAGGG + Intergenic
1058490311 9:105492034-105492056 ATTCCAATCAATAAAAAAGAAGG - Intronic
1059244899 9:112841578-112841600 AGTCCAATTAATAAGAAACAGGG + Intronic
1060657072 9:125379342-125379364 ATGCAAATGAGAAAGAATCAAGG - Intergenic
1060699706 9:125740114-125740136 ATTCAAAACAAAAATAAACATGG - Intergenic
1185907701 X:3951601-3951623 TTGCAAATCAATATCAAAAAAGG - Intergenic
1187001368 X:15182467-15182489 ATGCAAATTAAAATCAAACAAGG - Intergenic
1187745571 X:22405473-22405495 AACCAAATCAATATAAAACATGG - Intergenic
1187754298 X:22503571-22503593 CTGCAAATCAATGAGAACAAGGG - Intergenic
1187793566 X:22977391-22977413 GTGCATATCAAGAAGAACCATGG + Intergenic
1188212968 X:27445375-27445397 AGGCAGATTAATAAGAAAAATGG - Intergenic
1188456874 X:30376851-30376873 AAGCTAATCAATAAGAAGGAAGG + Intergenic
1188536932 X:31207495-31207517 ATGCCCATCAATGAGAAATATGG + Intronic
1189673840 X:43441339-43441361 ATGGAAATCAGTAAAAAGCAGGG - Intergenic
1190660139 X:52646361-52646383 ATGCACAAAAATAAAAAACACGG - Intronic
1191024494 X:55898689-55898711 ATGGAAAGCAAAAAGAAGCATGG + Intergenic
1191058245 X:56266346-56266368 AGGCAAATAAATAAGTAAAATGG - Intronic
1191071804 X:56408865-56408887 ATGGAAATCAAAAAGTAGCAGGG - Intergenic
1191772237 X:64773849-64773871 ATGGAAAGCAAAAAGAAGCAGGG - Intergenic
1191772537 X:64776865-64776887 ATGGAAAGCAAAAAGAAGCAGGG - Intergenic
1191821013 X:65308568-65308590 AGACAGATCAATGAGAAACAAGG + Intergenic
1192156447 X:68750326-68750348 AGGCAAAGGAAGAAGAAACAAGG + Intergenic
1192907279 X:75565097-75565119 ATGAAAAACAAAAAGAAGCAGGG - Intergenic
1192994221 X:76494960-76494982 ATGGAAAGCAAAAAGAAGCAAGG + Intergenic
1193002346 X:76576987-76577009 ATTCCAATCAATAAAAAAAAAGG - Intergenic
1193225487 X:78977788-78977810 ATGGAAAGCAAAAAGAAGCAGGG - Intergenic
1193303729 X:79924315-79924337 ATGGAAAGCAAAAAGAAGCAGGG + Intergenic
1193400333 X:81034990-81035012 ATGAAAAGCAATAAAAAGCAGGG + Intergenic
1193677763 X:84477706-84477728 TTGCAAATGATTAAGAAACTTGG - Intronic
1193835479 X:86337881-86337903 ATGGAAATCAAAAAAAATCAGGG + Intronic
1193895268 X:87107361-87107383 ATGCTAATCAATAAAATAAAGGG + Intergenic
1193908949 X:87278913-87278935 ATTCCAATCAATAGGAAACGAGG + Intergenic
1194455381 X:94096491-94096513 ATTCAAATAAATAAGCAAAATGG + Intergenic
1194732047 X:97466106-97466128 AGCCAAATCAATAAGTAACCTGG - Intronic
1195306539 X:103588374-103588396 ACACAAATCAACAAAAAACATGG - Intergenic
1195435678 X:104841210-104841232 ATGGAAAGCAAAAAGAAGCAGGG - Intronic
1195469280 X:105214289-105214311 ATGGAAAGCAAAAAGAAGCAAGG + Intronic
1195784525 X:108504610-108504632 ATGCAAATGGCCAAGAAACATGG + Intronic
1196181579 X:112697830-112697852 CAGAAGATCAATAAGAAACAAGG - Intergenic
1196181773 X:112699779-112699801 ATGGAAAGCAAAAAGAAGCAGGG + Intergenic
1196194569 X:112826042-112826064 ATGCAAATGAATAATAGACCTGG + Intronic
1196366370 X:114928708-114928730 CTGAAAATTAATAAGAAAAAAGG - Intergenic
1197198021 X:123722828-123722850 AAGCAACTCAATAACAAAAAAGG + Intronic
1197606033 X:128586572-128586594 ATGAAAATCAATGAAAAATAAGG - Intergenic
1197686772 X:129448152-129448174 CTACAAACAAATAAGAAACATGG + Intronic
1197966011 X:132062501-132062523 ATGTAAATGGATAAGAAAAAGGG - Intergenic
1198021947 X:132667605-132667627 CTGCAAAGCCAAAAGAAACAAGG + Intronic
1198065529 X:133092950-133092972 ATCCAAATCAAGAATAAACCAGG + Intronic
1198840075 X:140846995-140847017 AAGCAAAGAAATAGGAAACAAGG - Intergenic
1199489618 X:148383897-148383919 TTCCAAAGCAATAAGGAACAAGG + Intergenic
1199811392 X:151353246-151353268 ATGCAACTCAATATCAAAAAGGG - Intergenic
1199847223 X:151700227-151700249 ATGCAGACCAATCAGAAGCAAGG + Intronic
1200915859 Y:8570658-8570680 ATGAAAATAAATAAAAATCAAGG - Intergenic
1201364486 Y:13188348-13188370 ATGGAAAGCAAAAAGAAGCAGGG + Intergenic
1202071080 Y:20992087-20992109 ATACAAGTCAAAAAGAAAGATGG + Intergenic