ID: 1078613380

View in Genome Browser
Species Human (GRCh38)
Location 11:12841628-12841650
Sequence GGGTGCAAACTGAAGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 304}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078613380_1078613385 7 Left 1078613380 11:12841628-12841650 CCATCTTCCTTCAGTTTGCACCC 0: 1
1: 0
2: 3
3: 16
4: 304
Right 1078613385 11:12841658-12841680 TTAGCTCCTTCAGTGTTTAGAGG 0: 1
1: 0
2: 1
3: 13
4: 183
1078613380_1078613388 14 Left 1078613380 11:12841628-12841650 CCATCTTCCTTCAGTTTGCACCC 0: 1
1: 0
2: 3
3: 16
4: 304
Right 1078613388 11:12841665-12841687 CTTCAGTGTTTAGAGGGAAATGG 0: 1
1: 0
2: 3
3: 38
4: 327
1078613380_1078613389 15 Left 1078613380 11:12841628-12841650 CCATCTTCCTTCAGTTTGCACCC 0: 1
1: 0
2: 3
3: 16
4: 304
Right 1078613389 11:12841666-12841688 TTCAGTGTTTAGAGGGAAATGGG 0: 1
1: 0
2: 1
3: 29
4: 262
1078613380_1078613386 8 Left 1078613380 11:12841628-12841650 CCATCTTCCTTCAGTTTGCACCC 0: 1
1: 0
2: 3
3: 16
4: 304
Right 1078613386 11:12841659-12841681 TAGCTCCTTCAGTGTTTAGAGGG 0: 1
1: 0
2: 0
3: 14
4: 189
1078613380_1078613390 21 Left 1078613380 11:12841628-12841650 CCATCTTCCTTCAGTTTGCACCC 0: 1
1: 0
2: 3
3: 16
4: 304
Right 1078613390 11:12841672-12841694 GTTTAGAGGGAAATGGGAGATGG 0: 1
1: 0
2: 4
3: 33
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078613380 Original CRISPR GGGTGCAAACTGAAGGAAGA TGG (reversed) Intronic
900002682 1:23471-23493 GGCTGCAAAGTGAAGGAGCAGGG + Intergenic
900022402 1:193996-194018 GGCTGCAAAGTGAAGGAGCAGGG + Intergenic
900732575 1:4271894-4271916 GGGTGGACCCTGAAGGAGGATGG + Intergenic
901720814 1:11195837-11195859 GGTTGAAAACTGAAGGTAGATGG + Exonic
902943916 1:19820203-19820225 GGGCACAAACTGCAGGAAGTTGG + Intergenic
903294363 1:22334187-22334209 GGGTGAAAACTGTAGGTACAAGG - Intergenic
903382274 1:22905601-22905623 GGGTGCAACGTAAACGAAGAAGG - Intronic
903999963 1:27333336-27333358 GGGTCCAGTATGAAGGAAGAGGG - Intronic
905634224 1:39538639-39538661 GGGTGGCATCTGAAGGAAGTGGG + Intergenic
905824109 1:41016295-41016317 GGGGCCAAACTGAGGGAGGAAGG + Intronic
907021391 1:51069605-51069627 GGATGCAAACTCCATGAAGAAGG + Intergenic
908134432 1:61115658-61115680 GGGTGCTTGCTGAAGGAACAAGG - Intronic
909883856 1:80915269-80915291 GTGAGCAAAATGGAGGAAGAAGG - Intergenic
910108335 1:83655376-83655398 GGGTGCAAAATTGTGGAAGAAGG - Intergenic
910320405 1:85937170-85937192 AGGTGCAAACTGAAGATGGATGG + Intronic
911188964 1:94928645-94928667 GGATGGAACCTGAAGGAAGCGGG + Intergenic
913386112 1:118259939-118259961 GGGTGCAAACTGAAGGTAAATGG + Intergenic
915393132 1:155562341-155562363 GGGGGCAAACTGAGGGGAGGCGG + Exonic
917641857 1:176990521-176990543 GGGGGCAAAAGGAAGTAAGAGGG + Intronic
922219099 1:223544175-223544197 GGGTGAAACCTGAGGGCAGAGGG + Exonic
922322865 1:224503408-224503430 GGGTCAAAACAGGAGGAAGAAGG - Intronic
922718114 1:227887358-227887380 GGGGGCAGAATGGAGGAAGAGGG - Intergenic
923123020 1:231011819-231011841 TGGTGCAAACTGAGTGAGGATGG + Intergenic
924017137 1:239739510-239739532 GAGTCCACACTGAATGAAGATGG + Intronic
1063289984 10:4735195-4735217 AGCTGCAAACTGAAAGAGGAAGG - Intergenic
1063428327 10:5966593-5966615 GGGTGGGAAATGAAGGGAGAGGG - Intronic
1064869493 10:19921642-19921664 AGCTGCAACCTTAAGGAAGAGGG - Intronic
1065306629 10:24375152-24375174 GGTGGCCAACTGGAGGAAGAAGG + Intronic
1065478839 10:26171789-26171811 GGCTGCAAATCGAAGAAAGATGG + Intronic
1065781201 10:29169613-29169635 GATTGGAAACTGGAGGAAGAGGG - Intergenic
1066051205 10:31637478-31637500 AGGTGCTTACTGAAGGCAGAGGG - Intergenic
1066292398 10:34026395-34026417 GGGTGGAAAGAGAAAGAAGAGGG - Intergenic
1067512270 10:46905931-46905953 GGGTGCAAAATGCTGGAAGTCGG + Intergenic
1067649974 10:48145891-48145913 GGGTGCAAAATGCTGGAAGTCGG - Intergenic
1068258893 10:54552514-54552536 GGTTTCAAACTCAAGGAAGCTGG - Intronic
1070370317 10:75776328-75776350 GGGGGCATATTGGAGGAAGAAGG + Intronic
1070714281 10:78707927-78707949 GTGTGCATACAGAAGGAGGAAGG - Intergenic
1071204858 10:83262778-83262800 GGGTGAAAACTTAAGAAGGAAGG + Intergenic
1073170518 10:101504041-101504063 TGATGCTAACTGAAGGGAGAAGG + Intronic
1075100783 10:119504700-119504722 GGGGACACACTGAGGGAAGAAGG + Intronic
1078613380 11:12841628-12841650 GGGTGCAAACTGAAGGAAGATGG - Intronic
1079265609 11:18929272-18929294 GGATGCAAACACAAGGAAGGAGG - Intergenic
1080626960 11:34039220-34039242 GTGTGCAAACTGTAGGCATATGG + Intergenic
1080656776 11:34264581-34264603 GGGAGAAAACTGAAAGAAAAAGG - Intronic
1081384022 11:42449383-42449405 GGATGAAAACTGCAGAAAGAGGG - Intergenic
1083254776 11:61489396-61489418 GGGTGCAAAGACAAGTAAGAAGG - Intronic
1084794602 11:71496697-71496719 GGGAGGAAACTGCGGGAAGAAGG - Intronic
1085865658 11:80288620-80288642 GAGTCCAAACTGAAGGAGCAAGG + Intergenic
1087229818 11:95647976-95647998 GAGTGCAAAATGAAAGAAAAAGG - Intergenic
1088574984 11:111262641-111262663 GGGTTCAAACAGACGAAAGAAGG - Intronic
1089139242 11:116273089-116273111 GGGAGCAAAGGGAAGGAGGAAGG + Intergenic
1089331983 11:117696075-117696097 CGGTGAAAGCTGAAGGAAAAGGG + Intronic
1089625687 11:119749288-119749310 GTGGGCAAACTGAAGGGGGAGGG + Intergenic
1089968799 11:122675802-122675824 CGCTGCAAACTGGAGGAAAATGG - Intronic
1089970768 11:122691400-122691422 GGGTGCAAACTAGAGGAAACTGG + Intronic
1090994638 11:131854465-131854487 AGTTGAAATCTGAAGGAAGAGGG + Intronic
1091376099 12:25534-25556 GGCTGCAAAGTGAAGGAGCAGGG + Intergenic
1091389177 12:115340-115362 GGGTTGGAACAGAAGGAAGATGG + Intronic
1091742206 12:2967641-2967663 GGCTGAAAAACGAAGGAAGAGGG + Intronic
1092322912 12:7497481-7497503 GGAGGCAAACTGAAGGATGAGGG - Intronic
1092370936 12:7916056-7916078 GGCGGCGAACTGGAGGAAGAGGG + Intergenic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1094327113 12:29252363-29252385 GAGTGCTTACTGAAGGAAAAGGG + Intronic
1094498506 12:31004073-31004095 TGGAGCCAACTGTAGGAAGAAGG + Intergenic
1095248708 12:39953792-39953814 GTGTTCAGAGTGAAGGAAGAGGG - Intronic
1097166613 12:57089469-57089491 GGGTGGAGACTGATGGAAAAGGG + Intronic
1098234935 12:68409336-68409358 AGGTGCATAGTGAAGGAATAAGG - Intergenic
1099997708 12:89796863-89796885 AAGGGCAAACTGAAGAAAGATGG - Intergenic
1101840007 12:108321227-108321249 GAGTGCAAACTTAGGGAGGAGGG + Intronic
1102329908 12:112020129-112020151 GGGTGGAATGTGAAGGAAGAGGG - Intronic
1102355177 12:112228030-112228052 TGGTGCAAGCTGACAGAAGAAGG - Intronic
1102531733 12:113551666-113551688 GGGTGGGCACAGAAGGAAGAAGG - Intergenic
1103170849 12:118818454-118818476 GGGGAAAAACTGAAGGCAGAAGG + Intergenic
1103395336 12:120602666-120602688 GGGAGGAGACTGAAGGGAGAAGG - Intergenic
1105065348 12:133192610-133192632 GGTTTCAAAAAGAAGGAAGATGG - Intronic
1105794533 13:23837713-23837735 GGAGGCAGACTAAAGGAAGATGG - Exonic
1106318730 13:28618608-28618630 GGTTGCAAATTAAAGGAGGAAGG + Intergenic
1106324851 13:28679199-28679221 GAGTGCAAACTGTATGTAGATGG - Intergenic
1106861549 13:33914399-33914421 AGGAGCAAAGTGGAGGAAGAAGG - Intronic
1107896891 13:44974353-44974375 GGGTAGGAAGTGAAGGAAGAAGG + Intronic
1109249122 13:59997153-59997175 GGGTGCAAACATATGGTAGAAGG - Intronic
1109996635 13:70135541-70135563 GAGTCCATACTCAAGGAAGAAGG - Intergenic
1110634819 13:77754584-77754606 AGGAGTAAACTGAACGAAGAAGG - Intronic
1111995497 13:95162209-95162231 ATGTGGAAACTAAAGGAAGAAGG - Intronic
1112156818 13:96826586-96826608 GGCTGGAAAGTCAAGGAAGATGG + Intronic
1112433310 13:99372381-99372403 GGGGGGAAAATGAAGGATGATGG + Intronic
1112813438 13:103246055-103246077 AAGTGCAAAGTCAAGGAAGAGGG - Intergenic
1115286003 14:31712989-31713011 GGGAGCAACCTGATGGATGAAGG + Intronic
1115928735 14:38467288-38467310 GGGAGCAAACTAAATGAATAGGG - Intergenic
1116645763 14:47526925-47526947 GGGTGAAAACTCAAAGCAGATGG - Intronic
1118319267 14:64743596-64743618 GAGTGCCAGCCGAAGGAAGAGGG + Exonic
1118612756 14:67554333-67554355 GGGTCCAGGCTGAAGGGAGAAGG + Intronic
1120044590 14:79791698-79791720 CCGTGCAAACCCAAGGAAGAAGG + Intronic
1121179676 14:91919461-91919483 GGGTCCCCACTGGAGGAAGAGGG + Intronic
1121483606 14:94296723-94296745 GGGAGGAAACTAAAGGAATAAGG - Intergenic
1125064154 15:35461679-35461701 GGGTGGAGAATGAAGGAAGGGGG + Intronic
1125197252 15:37061235-37061257 GGGGTCAAACAGACGGAAGATGG + Intronic
1126946102 15:53822226-53822248 GAGTCCCAACTGAAGGAGGAAGG + Intergenic
1127669568 15:61182505-61182527 TGGAGCCAACTGCAGGAAGATGG + Intronic
1129945283 15:79534345-79534367 GGGTGCAAAAGGAACGAAGGTGG - Intergenic
1131224305 15:90611289-90611311 GGGAGCACACAGAAGGAACATGG + Intronic
1131738857 15:95364599-95364621 AGGTGCAAATTCAAGGAACAGGG - Intergenic
1132315163 15:100884729-100884751 TGGTGAAAACTGAAGGGCGATGG + Intronic
1132450829 15:101967468-101967490 GGCTGCAAAGTGAAGGAGCAGGG - Intergenic
1133520118 16:6549103-6549125 GGGAGGAAAGAGAAGGAAGAGGG + Intronic
1134207386 16:12249287-12249309 GGATGCAATGTGAAGGAAAATGG - Intronic
1134348781 16:13416863-13416885 GGGAGGGAAATGAAGGAAGAAGG + Intergenic
1134711204 16:16327591-16327613 AGGTGCAGGCAGAAGGAAGAGGG - Intergenic
1134948370 16:18340992-18341014 AGGTGCAGGCAGAAGGAAGAGGG + Intergenic
1134955625 16:18381102-18381124 AGGTGCAGGCAGAAGGAAGAGGG + Intergenic
1135429711 16:22373303-22373325 GCGTGCAAACTGAAGAAAAGTGG + Intronic
1137865520 16:51891978-51892000 AGCTGCAAACTGAAGGTACATGG - Intergenic
1138124620 16:54428640-54428662 GGGTTCCAACTGAGGAAAGATGG - Intergenic
1138293870 16:55870380-55870402 GGATGAAAAATGAAGAAAGAAGG + Intronic
1139412665 16:66776844-66776866 GGCTGAAAAATGAAGGTAGAAGG + Intronic
1139530204 16:67538911-67538933 GGGTGCAGACAGCAGGGAGAGGG - Intronic
1142735753 17:1898200-1898222 GGCTGCAAACACTAGGAAGAAGG - Exonic
1143108748 17:4542137-4542159 GGGGGCAGGCTGGAGGAAGATGG - Intronic
1146795237 17:35775747-35775769 GGGTGGAAAAGGAAGGAAGAGGG - Intronic
1148438998 17:47702210-47702232 AGGTGGAAACAGAAGAAAGAGGG - Intronic
1148747200 17:49924986-49925008 GGATGCAAACTGAGTGATGAGGG + Intergenic
1149905891 17:60526085-60526107 GGGGGCAAACTGAGGGACGGCGG + Exonic
1153997167 18:10453522-10453544 GGGGGAAAACTGCTGGAAGAGGG + Intergenic
1155091346 18:22514782-22514804 GTGTCCAAACTGATGGAAGGAGG - Intergenic
1155625146 18:27826005-27826027 AGGTGGAAACTGAAGGTTGAAGG + Intergenic
1156277504 18:35597638-35597660 GGGTGCAAACTCAAGCAATCTGG + Intronic
1156537892 18:37881211-37881233 AGGTGCTTACTGAAGGCAGAGGG + Intergenic
1157269759 18:46263678-46263700 AGGAGCAAACTCAAGAAAGAAGG - Exonic
1158151885 18:54383006-54383028 GGGTACAAACTGAAGAAGAAAGG + Intronic
1158434853 18:57428421-57428443 GGGAGCAAAAGGAAGGAGGAGGG + Intergenic
1158973850 18:62692675-62692697 GGGGGCTGAGTGAAGGAAGAGGG + Intergenic
1159000094 18:62965920-62965942 GGGAGCCTACAGAAGGAAGACGG + Intronic
1160634433 19:65079-65101 GGCTGCAAAGTGAAGGAGCAGGG + Intergenic
1160967260 19:1752264-1752286 GGCTCAAAGCTGAAGGAAGAGGG - Intergenic
1161404384 19:4083454-4083476 GGGTGCAAACAGAAGGGATGTGG + Intergenic
1161638677 19:5405852-5405874 GGGGCCAGGCTGAAGGAAGAAGG + Intergenic
1164644181 19:29845709-29845731 GGGTGAAACGAGAAGGAAGAAGG - Intergenic
1165182946 19:33988285-33988307 GGGGGCAAGCTGAATGTAGAAGG + Intergenic
1165492613 19:36133472-36133494 AGGTGCCACATGAAGGAAGAGGG - Intergenic
1165544879 19:36527005-36527027 GGAGGCAGACTGCAGGAAGAAGG + Intronic
1166212740 19:41317746-41317768 GGATGAAAACAGAAGGAAGATGG + Intronic
1166288025 19:41844463-41844485 GGGTGCAATCTGAGGAAGGAGGG + Exonic
1166929907 19:46296427-46296449 GGGTGCAGACTGGAGGAATGGGG + Intergenic
1166991214 19:46693900-46693922 GGGTGCGTCCTGAAGGATGACGG + Exonic
927392591 2:22611967-22611989 GGGAACAACCTGCAGGAAGAAGG + Intergenic
927593063 2:24373428-24373450 GAGTGCAATCTGAAGGAAGCAGG + Intergenic
927827823 2:26321638-26321660 GCATGAACACTGAAGGAAGAAGG + Intronic
928855006 2:35792644-35792666 GTGTGGAAACTGGAGGAACATGG + Intergenic
930110551 2:47675333-47675355 TGGTGCAGAGTGAAGGGAGATGG - Intergenic
930296300 2:49558672-49558694 CAGTTCAAACTGAAGGAAAAAGG - Intergenic
931176944 2:59863667-59863689 GGGTGGATACTGAAAGAACAAGG - Intergenic
931667247 2:64618208-64618230 GGGGGCATACTGCAGGAGGATGG + Intergenic
932979147 2:76642375-76642397 GGCTGGCAACTGAGGGAAGAAGG - Intergenic
934041442 2:88130480-88130502 GGGTGGAAATTAAAGAAAGATGG - Intergenic
935500316 2:103830965-103830987 GGGTGCTTCCTGAAGGAATATGG + Intergenic
936073878 2:109389291-109389313 CTGTGCAAACAGGAGGAAGAGGG + Intronic
936428254 2:112437008-112437030 GGCTGGAAACTGGAGGCAGATGG - Intergenic
936616351 2:114051636-114051658 TGGTGCAAAGTGTAGCAAGAGGG + Intergenic
938144546 2:128822577-128822599 GGGTGCATCCTCAGGGAAGAGGG - Intergenic
939312215 2:140495711-140495733 GGATTCCAACTGAAGGATGACGG - Exonic
944275927 2:197837577-197837599 GGATGGGAACTGAAGGATGAAGG + Intronic
944427558 2:199599147-199599169 GGGTGCAGAGAGAAGGAAGAGGG + Intergenic
945356427 2:208844413-208844435 TGGTGGAAGCTGAAGGAAGCAGG - Intronic
945561749 2:211348222-211348244 AGGTGCAAACTGTGGAAAGAAGG - Intergenic
946345231 2:219104242-219104264 AGGTACAGACTGAAGGAAAAAGG + Intronic
946876842 2:224138004-224138026 GAGGGCAAAGAGAAGGAAGAGGG - Intergenic
947708529 2:232295408-232295430 GGCTGCAAGAGGAAGGAAGATGG - Intronic
947971268 2:234327402-234327424 GGGTGCAGAGTGCAGGAATAAGG + Intergenic
948768683 2:240236365-240236387 AGGTGCAAACAGGAGGACGATGG - Intergenic
948899680 2:240949964-240949986 TGGTGCAGTCTGAAGGATGAGGG + Intronic
1169355633 20:4902666-4902688 GGCTCAAAACTGCAGGAAGATGG - Intronic
1170487404 20:16832767-16832789 AGATGCAAGCTGAAGGAGGAGGG - Intergenic
1174861244 20:54093496-54093518 GGGTGCACACTGAAATGAGATGG - Intergenic
1175476739 20:59280862-59280884 GGGTGCAAATTTGAGCAAGATGG - Intergenic
1175665121 20:60852099-60852121 GGTTGCAGACAGAAGAAAGAAGG + Intergenic
1176062014 20:63176596-63176618 GGGTGGAAAAGGAAGGAAGCAGG + Intergenic
1176373998 21:6078203-6078225 GGCTGGAAACTGGAGGCAGATGG + Intergenic
1177927542 21:27236924-27236946 AGGTCCAAACTGTAGTAAGAAGG - Intergenic
1179749479 21:43460040-43460062 GGCTGGAAACTGGAGGCAGATGG - Intergenic
1182440608 22:30361848-30361870 GGTTCCAGACTGAAGGAAGGAGG - Intronic
1184036585 22:41920900-41920922 GGGTGGGAACTGAAGGGAAAAGG - Intergenic
1184792998 22:46712641-46712663 GTGTGCAGACAGCAGGAAGAAGG + Intronic
1184997343 22:48217993-48218015 GAGTGCAAACAGCAGGAAGGAGG - Intergenic
949130330 3:492394-492416 AGGGGCAAACTGAAGGAAAATGG + Intergenic
950010197 3:9717632-9717654 GGGTGGAAAATGAAGAAAAATGG + Intronic
950625802 3:14245987-14246009 GGGGGAAGACTGAGGGAAGACGG + Intergenic
952270368 3:31825049-31825071 GAGTGCACACTGCAGGAAGCTGG + Intronic
953475347 3:43201331-43201353 GGGTGCCAAATGAACAAAGAGGG - Intergenic
954861623 3:53695383-53695405 GGCTGCCATATGAAGGAAGAAGG - Intronic
955043167 3:55336199-55336221 GGCTGTAATCTGAAGGCAGAAGG + Intergenic
955932658 3:64073240-64073262 GGATGCAAACTGAAGGTGAATGG + Intergenic
956070709 3:65447916-65447938 GAGTGCAAACTAAAGAAACAGGG + Intronic
956289732 3:67648815-67648837 GGGTGCACAGAGAAGGGAGAGGG - Intronic
956703626 3:71980954-71980976 GGGTGCTTGCTGAAGGAAAAGGG - Intergenic
957025186 3:75173632-75173654 GGAGGCAAGCTGAAGGAGGAAGG + Intergenic
957275068 3:78080560-78080582 GGGTGCAAAATGCTGGAAGTGGG + Intergenic
957424181 3:80016004-80016026 AAGTGCAAACTAAAGGCAGATGG + Intergenic
958484729 3:94690330-94690352 GAGTGTAAACTCAAGGAGGATGG + Intergenic
959907619 3:111728146-111728168 GGGTGCCATTTGAAGGAGGAGGG - Intronic
960596931 3:119415239-119415261 GGGTCCAAGTTGAGGGAAGAAGG - Exonic
961001686 3:123378493-123378515 GGCTGCAGAGTGAAGGGAGAGGG + Intronic
961564116 3:127751234-127751256 AGGTGCAAATGGAAGGAGGAGGG - Intronic
961662241 3:128475543-128475565 GGGTGCAAACAGAGGGAAGAAGG + Intergenic
962895442 3:139709807-139709829 TGGTGCAAGCTGTAGGGAGAAGG + Intergenic
963641256 3:147863765-147863787 GGCTTCTAACTGAAGGAAGAGGG - Intergenic
964339726 3:155695897-155695919 GGGTGCAAAGAGAAGGGAAAGGG + Intronic
964541297 3:157782543-157782565 GGTTGTGAACTGAACGAAGAAGG + Intergenic
965190284 3:165519123-165519145 GTGTGGAAAATGATGGAAGATGG - Intergenic
967210516 3:187164237-187164259 GGGATCTGACTGAAGGAAGATGG - Intronic
970159349 4:13173329-13173351 GGGAGGAAACGGAGGGAAGAAGG + Intergenic
970669459 4:18379437-18379459 AGATGTAAACTGAAAGAAGAGGG - Intergenic
971054027 4:22892447-22892469 GTGTGTAAACTGAAGGTACATGG + Intergenic
975537783 4:75470319-75470341 GGCTGCAGACTGAATGAAGCAGG + Intergenic
975923520 4:79421576-79421598 AGTTGCAAACTTAAAGAAGACGG + Intergenic
977068981 4:92359173-92359195 TGGTGAGTACTGAAGGAAGAGGG - Intronic
977582650 4:98742565-98742587 TGGTTCTAACTGAAGGAAGGTGG - Intergenic
978400496 4:108325536-108325558 GTGTGCAAACTGAAAAGAGATGG + Intergenic
980021380 4:127714350-127714372 GGGGGAAAAATGAAGGAAGCAGG - Intronic
981536984 4:145810262-145810284 GGGAGCTTACTGAAGGAAGACGG + Intronic
982932015 4:161420229-161420251 AGGTGCTTACTGAAGGAAAAGGG + Intronic
983490880 4:168387621-168387643 GGGTAAAGAATGAAGGAAGAAGG + Intronic
984825136 4:183917301-183917323 AGGAGCAAACTGAAGGAAACTGG + Intronic
984841534 4:184072717-184072739 GGGTACAATCTAAAGGAAAATGG + Intergenic
988427828 5:31084297-31084319 GCATACAAACAGAAGGAAGAAGG + Intergenic
988694325 5:33604788-33604810 GGGTGCATACAGACAGAAGATGG + Intronic
990791712 5:59488082-59488104 GGGTGAAAACTGAGGGAACTAGG - Intronic
992376186 5:76190044-76190066 TGGTGGAAGCAGAAGGAAGATGG + Intronic
992378644 5:76215687-76215709 GGGTGCAAACTCAATGCACAGGG - Intronic
992948781 5:81836252-81836274 GCGTGAAAACTGAAGGAACATGG - Intergenic
995000369 5:107120616-107120638 TGGTGCAAACACAATGAAGACGG - Intergenic
995174106 5:109154247-109154269 GTATGAAAACTGAAGGAACAGGG + Intronic
996618147 5:125466866-125466888 GGATACACACTGAAGTAAGAAGG + Intergenic
997530297 5:134577682-134577704 GGGTGTGAAATGAAGGAACAGGG - Intronic
999519661 5:152338208-152338230 AGGTGCAAGTTGGAGGAAGAAGG + Intergenic
999684364 5:154089030-154089052 GGGTGTGAACTGGAGGAAGGGGG + Intronic
1002002555 5:176206272-176206294 TGGTGAAAGCAGAAGGAAGAGGG + Intergenic
1002184676 5:177448596-177448618 TGGAGGAAAGTGAAGGAAGAAGG - Intronic
1002224045 5:177705340-177705362 TGGTGAAACCAGAAGGAAGAGGG - Intergenic
1002282086 5:178137000-178137022 GGGTGCAAAGTGAGAGTAGAGGG + Intronic
1003123640 6:3338084-3338106 TGGGGGAAACTGATGGAAGACGG - Intronic
1003154428 6:3579067-3579089 GTAAGCAAACTGCAGGAAGAGGG + Intergenic
1004054040 6:12116487-12116509 AGATGCAAACAGAAGGACGATGG - Intronic
1004254602 6:14051388-14051410 GCATGCAAACTGAAAGAAAATGG - Intergenic
1004790332 6:19018989-19019011 GGGTGGAAAGTAAAGGAAGAAGG + Intergenic
1005851597 6:29827453-29827475 GGATGAAAAGTGAAGGGAGAGGG + Intronic
1005858977 6:29887344-29887366 GGATGAAAAGTGAAGGGAGAGGG + Intergenic
1006065937 6:31462796-31462818 GGATGAAAAGTGAAGGGAGAGGG + Intergenic
1007251480 6:40498041-40498063 GGGTGGAAACTGGAGGAAAGTGG + Intronic
1007774490 6:44217348-44217370 AGGTGTAAACTGAAGGGAGGGGG + Intergenic
1010080490 6:71856008-71856030 GGATGGAAACTGGAGGAAGGTGG - Intergenic
1011124331 6:83990543-83990565 TGCTGCATCCTGAAGGAAGATGG + Intergenic
1012352428 6:98269065-98269087 GGGTGCAAAATGTAAGGAGATGG + Intergenic
1012414841 6:99002020-99002042 GGGAGGTAACTGCAGGAAGAGGG + Intergenic
1013171095 6:107636722-107636744 GAGTGCAAACTCCAGGAGGAAGG + Intronic
1013345178 6:109253175-109253197 GAGTGCAAAGTGAGGGAAGGTGG - Intergenic
1014928428 6:127303628-127303650 AGGTGCAAACTGAAGCAGTAAGG + Intronic
1016205596 6:141464805-141464827 TGGTGCAAAATGAAGAAAGCAGG - Intergenic
1017450716 6:154552139-154552161 TTGTGCAAAATGAAAGAAGAGGG - Intergenic
1017568925 6:155721086-155721108 AGATGGAAACTCAAGGAAGAGGG + Intergenic
1017973675 6:159335772-159335794 GGGTCCAAACAGAGTGAAGAAGG + Intergenic
1018212018 6:161491260-161491282 GGGTGATGCCTGAAGGAAGAAGG + Intronic
1019474834 7:1239080-1239102 AGCTGCAAATTGAAGGAAGGAGG - Intergenic
1020257095 7:6508459-6508481 AGGTGCAAAGTGAAGGATCATGG + Intronic
1020269846 7:6588382-6588404 GTGTTCACACTGAAGGAAAAGGG - Intronic
1020756577 7:12211148-12211170 GGGCTCAAACAGGAGGAAGAAGG + Intergenic
1021653495 7:22853766-22853788 GGGTGCAAACTCATCGAAGAGGG - Intergenic
1024541564 7:50479376-50479398 GGGGGCAAAGTAAATGAAGAAGG - Intronic
1024684128 7:51726471-51726493 GGGTGGCAGCTCAAGGAAGAGGG - Intergenic
1024887710 7:54163321-54163343 GGGTGGAAATTGGAGGAAAAAGG - Intergenic
1027266436 7:76497557-76497579 GGGAGCAGAGAGAAGGAAGAGGG - Intronic
1027317817 7:76995675-76995697 GGGAGCAGAGAGAAGGAAGAGGG - Intergenic
1029035865 7:97521006-97521028 TCGTTAAAACTGAAGGAAGATGG - Intergenic
1029088189 7:98027847-98027869 GGGGGCAGAAGGAAGGAAGAAGG + Intergenic
1029878165 7:103775944-103775966 GGGTGGAAACTCAAGGGATAGGG + Intronic
1030173150 7:106625197-106625219 GGGTGAGACCTGAAGGGAGATGG - Intergenic
1030282421 7:107790817-107790839 GGGTCTAGACAGAAGGAAGAAGG - Intronic
1030493597 7:110269199-110269221 GTGTGCAATCTGAAGGAAATGGG + Intergenic
1031116659 7:117676204-117676226 GGCTGTAAACTCAAGGGAGAGGG + Intronic
1033607572 7:142938612-142938634 AGGTGTAAAATGAAAGAAGAGGG + Intergenic
1034125033 7:148663597-148663619 GGGGCCAAATTGAAGGTAGACGG + Intergenic
1034759902 7:153661942-153661964 TGGTGGAAAATCAAGGAAGAAGG + Intergenic
1035348465 7:158225565-158225587 GACTGCAAACTTGAGGAAGATGG - Intronic
1036481893 8:9147385-9147407 GGGTGTGAACTGAGGGAGGAAGG + Intronic
1038008568 8:23456010-23456032 GCGTGCACAGTGAAGGCAGAAGG - Intronic
1039418305 8:37414602-37414624 GGGTGCAGACTAGAGGAGGAGGG - Intergenic
1039541954 8:38380613-38380635 GTTTGCAACCAGAAGGAAGAGGG + Intronic
1039576164 8:38625647-38625669 GGGTGAAGAATGAAGGAAGGAGG + Intergenic
1041105746 8:54442500-54442522 TGGTGGAAACAAAAGGAAGATGG + Intergenic
1041818841 8:62005458-62005480 GGGAGCATAAGGAAGGAAGAAGG + Intergenic
1046379528 8:113434160-113434182 GGATGAAAACTGTAGGCAGATGG + Intronic
1046661768 8:116955328-116955350 GGATGCAAACAGTGGGAAGATGG + Intronic
1048382278 8:133876725-133876747 GGGAGCAAACTTAACCAAGAAGG - Intergenic
1049502448 8:142974658-142974680 TGGTGGAAACTGAAGAAGGAAGG + Intergenic
1049592682 8:143469691-143469713 GGGTGCCATCTGGAGGAGGAGGG + Intronic
1049702232 8:144020544-144020566 GAGAGGATACTGAAGGAAGAGGG - Intronic
1049702394 8:144021141-144021163 GAGAGGATACTGAAGGAAGAGGG - Intronic
1049885488 9:23584-23606 GGCTGCAAAGTGAAGGAGCAGGG + Intergenic
1050559857 9:6823823-6823845 TGGTGCGTACTGAAGGAAGGAGG - Intronic
1051278354 9:15418083-15418105 GGGAGGAGACAGAAGGAAGAAGG - Intergenic
1052636894 9:31118118-31118140 GGGTGGAAAATGAAGGAAATGGG + Intergenic
1053724150 9:40979309-40979331 GTCTTCAAACTGAAAGAAGAGGG + Intergenic
1054341819 9:63872690-63872712 GTCTTCAAACTGAAAGAAGAGGG - Intergenic
1056108617 9:83372533-83372555 GGGTGCAGTATTAAGGAAGATGG - Intronic
1057801746 9:98195313-98195335 GGGTGCACTGGGAAGGAAGAGGG - Intergenic
1057814703 9:98285931-98285953 GGGTCCACTCTGAGGGAAGAAGG - Intergenic
1059836269 9:118157419-118157441 AAGTGCAATCTGAAGGAAGAAGG + Intergenic
1060145167 9:121246718-121246740 GGCTGGAAAATGAAGGAAGCTGG - Intronic
1060904637 9:127294037-127294059 GGCTGCACACTGAAGGAAGAGGG - Intronic
1061493809 9:130960518-130960540 GGGTGGAAACTGAAGGGGGTTGG + Intergenic
1062260274 9:135658870-135658892 GGATTCAAACTAAAGGAGGAAGG + Intergenic
1203466879 Un_GL000220v1:96218-96240 GGGGGCAAAAGGAGGGAAGAAGG - Intergenic
1185681144 X:1889204-1889226 GGCTGCATATTGAAGGGAGATGG - Intergenic
1186410673 X:9342466-9342488 GGGTGCAAAACGGAGGAGGAGGG - Intergenic
1187273713 X:17801187-17801209 GGGTGCAGGCCGAAGGAAGATGG + Exonic
1187365625 X:18663727-18663749 TGGTGGAAGCTAAAGGAAGATGG - Intronic
1188081399 X:25845786-25845808 GGGTGAAAACTGAATGAAAAAGG - Intergenic
1192134242 X:68582208-68582230 GTGTGCAGACTGAGGGATGAAGG - Intergenic
1192523886 X:71824867-71824889 GGGTTCCAGCTGAAGGAAGGAGG - Intergenic
1192966632 X:76183566-76183588 GTGGGCAAACTGAAGCAAGGTGG - Intergenic
1194827551 X:98581431-98581453 GGGTGACAAGTGAAGGTAGAAGG - Intergenic
1195453222 X:105038852-105038874 GGATGCAAAATGCAGAAAGAGGG - Intronic
1197127100 X:122959545-122959567 AGATGCACACAGAAGGAAGATGG + Intergenic
1199878446 X:151953892-151953914 GGGGTCAAAGAGAAGGAAGAGGG + Exonic
1200796175 Y:7343182-7343204 GGGGGCAAGCAGAAGAAAGAAGG - Intergenic