ID: 1078615496

View in Genome Browser
Species Human (GRCh38)
Location 11:12861648-12861670
Sequence GTTTGTATGCTGTGGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 273}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078615496_1078615502 17 Left 1078615496 11:12861648-12861670 CCCACCACCCACAGCATACAAAC 0: 1
1: 0
2: 0
3: 21
4: 273
Right 1078615502 11:12861688-12861710 TTAAAAAGATAAATTTCAGCTGG 0: 1
1: 0
2: 6
3: 169
4: 1973
1078615496_1078615505 26 Left 1078615496 11:12861648-12861670 CCCACCACCCACAGCATACAAAC 0: 1
1: 0
2: 0
3: 21
4: 273
Right 1078615505 11:12861697-12861719 TAAATTTCAGCTGGGTGCGGTGG 0: 2
1: 4
2: 98
3: 997
4: 8617
1078615496_1078615503 18 Left 1078615496 11:12861648-12861670 CCCACCACCCACAGCATACAAAC 0: 1
1: 0
2: 0
3: 21
4: 273
Right 1078615503 11:12861689-12861711 TAAAAAGATAAATTTCAGCTGGG 0: 1
1: 0
2: 13
3: 380
4: 8777
1078615496_1078615504 23 Left 1078615496 11:12861648-12861670 CCCACCACCCACAGCATACAAAC 0: 1
1: 0
2: 0
3: 21
4: 273
Right 1078615504 11:12861694-12861716 AGATAAATTTCAGCTGGGTGCGG 0: 1
1: 2
2: 29
3: 250
4: 4078

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078615496 Original CRISPR GTTTGTATGCTGTGGGTGGT GGG (reversed) Intronic
901915176 1:12493840-12493862 GTTGGTAGGCTGTGGGTAGGGGG - Intronic
903929953 1:26856381-26856403 GTGTGTGTGCTGGTGGTGGTAGG + Exonic
904120199 1:28193225-28193247 GTTTGTTTGCAGTGAGTGGGTGG + Intronic
904326361 1:29729131-29729153 GTTTCTGTGCCGTGTGTGGTGGG - Intergenic
906657688 1:47560685-47560707 CATTGTATGCTCTGGGAGGTGGG - Intergenic
907850016 1:58247473-58247495 GTTGGTGTGCTGTTGGTGCTGGG - Intronic
909266470 1:73565024-73565046 CTTTTTATTGTGTGGGTGGTGGG - Intergenic
912380011 1:109242319-109242341 ATGTGTATGCTGGGGGTGGGTGG - Intergenic
912802036 1:112725808-112725830 GCTTGTTTGCTGTGTGTGGTGGG - Intronic
913195847 1:116455344-116455366 ATCTGTATGCTGAGGGTGGGCGG - Intergenic
913221575 1:116664788-116664810 GTCTGCATGCGTTGGGTGGTAGG + Intronic
915342675 1:155184989-155185011 GTTTCTGTGCTGGGTGTGGTAGG + Intronic
917484307 1:175441637-175441659 GTGTGTGTGTTGTGGGTGGGGGG + Intronic
917986646 1:180326693-180326715 GTTAGTATGCTGTGGGCCTTGGG - Intronic
919650191 1:200141142-200141164 GTTTGTATGTGTTGGGGGGTGGG + Intronic
920657097 1:207885393-207885415 GTATGTATGCTTTGGGAGGAAGG - Intronic
921534884 1:216334979-216335001 GTTTGTATTCTGTTGTTGTTGGG - Intronic
922352993 1:224750114-224750136 CTTTGTATGTGGTAGGTGGTAGG + Intergenic
922936536 1:229427121-229427143 GTTTGGATTCTGTGGGTGCTGGG - Intergenic
1064362938 10:14682068-14682090 GTATGTATGCTGTAGGATGTTGG + Intronic
1066033708 10:31457278-31457300 CTCTGTATGCTTTTGGTGGTGGG + Intronic
1066092498 10:32038428-32038450 GTTTATAAAATGTGGGTGGTAGG - Intronic
1066293265 10:34033105-34033127 GTATGTATGGTGGGGGTGGGGGG + Intergenic
1067434568 10:46267784-46267806 GTGTGCATTCAGTGGGTGGTGGG - Intergenic
1067469664 10:46527424-46527446 GTATGTGTGATGTGTGTGGTCGG - Intergenic
1069712646 10:70499832-70499854 GTTTCTTTGCTGTGGGTTCTAGG + Intronic
1070556855 10:77534833-77534855 GGTTGTAGGCTGTGGGTTGTAGG - Intronic
1072948104 10:99828766-99828788 GTGTGTGTGTTGTGGGTGGTGGG + Intronic
1072969783 10:100007352-100007374 TTGTGTATGCTGTGGGTGCTGGG - Intronic
1073550762 10:104398924-104398946 GTTCGTGTGCTGGTGGTGGTAGG + Intronic
1075028005 10:119001153-119001175 GTGTGTTTGCTTTGGGGGGTAGG + Intergenic
1075372965 10:121953471-121953493 ATTTCTGTGCTGAGGGTGGTAGG - Intergenic
1076070010 10:127481871-127481893 GTTTCCATGCTGTGGGTACTGGG - Intergenic
1076120516 10:127933244-127933266 GTGTGTATGGAGGGGGTGGTAGG - Intronic
1078615496 11:12861648-12861670 GTTTGTATGCTGTGGGTGGTGGG - Intronic
1080230483 11:30014348-30014370 GTTCCTAGTCTGTGGGTGGTAGG - Intronic
1081216669 11:40407646-40407668 GTTTGAATGATGTAGGTAGTTGG - Intronic
1081356412 11:42119893-42119915 GTGTGTATGTTTTGGGGGGTGGG + Intergenic
1081504991 11:43706712-43706734 GTGTGTGTGTTGTGGGGGGTGGG + Intronic
1081549564 11:44098749-44098771 GTTTGCATATGGTGGGTGGTGGG + Intronic
1081632705 11:44700703-44700725 GTGTGTATGCTGGGGCTGTTAGG + Intergenic
1081670924 11:44942265-44942287 GTGTGTGTGATGTGTGTGGTGGG - Intronic
1082057800 11:47834344-47834366 GCATGTAGGTTGTGGGTGGTAGG - Intronic
1082732738 11:56820078-56820100 GTCTGTATGCAGCTGGTGGTAGG - Intergenic
1082988478 11:59187373-59187395 GTTTATATGCTGTGAGCAGTTGG + Intronic
1082992813 11:59222936-59222958 GGTTGTTTGCTGTGGGAGGCTGG + Intergenic
1085008197 11:73114573-73114595 GTTAGTACGCTGTGGGTCTTGGG - Intronic
1085084230 11:73656012-73656034 GTTTGTGTCCTGTGGGTGATAGG - Intronic
1085487147 11:76874715-76874737 GTTTCTAGGGTGTGGGAGGTGGG + Intronic
1085678795 11:78551293-78551315 GTTTGTAGCCTGGGGGTAGTAGG - Intronic
1085773616 11:79346510-79346532 GTGTGTATGTGGTGGGAGGTGGG - Intronic
1086838257 11:91653021-91653043 GGTAATATGCTGTGGGTGTTAGG - Intergenic
1087634665 11:100688413-100688435 GTTTGCATTGTGTGGGTGTTGGG + Intronic
1088233684 11:107699956-107699978 GTGTTTGTGATGTGGGTGGTGGG + Intergenic
1088549754 11:111000645-111000667 GTTTGTAAGATGGGGGTGATTGG - Intergenic
1089420313 11:118327757-118327779 CTGTGTATTCTGTTGGTGGTGGG - Intergenic
1089651659 11:119918311-119918333 ATTTGTATGCTCTGGGTTGGAGG + Intergenic
1091883955 12:4002695-4002717 CTTTATTTGCTGTGTGTGGTGGG - Intergenic
1092173607 12:6388515-6388537 GGTTGGATGCAGTGGATGGTTGG + Intronic
1092335179 12:7626358-7626380 GTTTTTATGTTGTTGGTTGTTGG - Intergenic
1092351545 12:7760010-7760032 GTGTGTGTGATGTGGGGGGTGGG - Intergenic
1092573719 12:9755302-9755324 TTTTGCATGCTGTGGGTATTTGG - Intronic
1093591842 12:20911417-20911439 GTTTGTCTGCTTTGGGTATTAGG + Intronic
1094213146 12:27913496-27913518 GTTTGTGTGGTGGGGGTGGGGGG + Intergenic
1095173825 12:39067084-39067106 GTCAGTATGCTGTGGCTGGATGG + Intergenic
1096240348 12:49956496-49956518 GTGTGTATGCTGTGTGTGCCCGG + Exonic
1096588848 12:52643981-52644003 GCTTGTTTGCTGAGTGTGGTGGG + Intergenic
1099633517 12:85181086-85181108 GTATATATACTGGGGGTGGTAGG - Intronic
1101332986 12:103772041-103772063 GTGTGCTTGCTGTGGGTGGGGGG + Intronic
1101539072 12:105648065-105648087 GTGTGTGTGCTGCGGGTTGTGGG - Intergenic
1101736798 12:107469227-107469249 GTGTGTTTCCTGTGGGTGGTTGG + Intronic
1101744149 12:107525498-107525520 GTTTGTAGGCTGAGAGTGATAGG + Intronic
1104776541 12:131393032-131393054 GTTTGTGTGATATGGGGGGTGGG + Intergenic
1104808883 12:131608031-131608053 CTTTGCATGCAGTGGCTGGTCGG + Intergenic
1105515561 13:21087179-21087201 GTGTGTGTGTTGTGGGTGGGGGG - Intergenic
1106169969 13:27280414-27280436 GTTTTTGAGCTGTGGTTGGTGGG + Intergenic
1107483595 13:40805433-40805455 CTTTTTATGCAGTGGGTGGTGGG - Intronic
1107977903 13:45707224-45707246 GCTTGTGTGCAGGGGGTGGTGGG + Intronic
1109827569 13:67742469-67742491 GGTTTTATGCTGTTGGTTGTTGG + Intergenic
1109869310 13:68312021-68312043 GTTTGTTTGATTTGGTTGGTAGG - Intergenic
1112166341 13:96924244-96924266 GCTTTTATGCTGTTGGTGGGAGG + Intergenic
1113607546 13:111621228-111621250 GTATGTCTGGTGTGTGTGGTGGG + Intronic
1113607561 13:111621342-111621364 GTGTGTGTGGTGTGTGTGGTGGG + Intronic
1115501323 14:34052596-34052618 GTGTGTTGGCTGGGGGTGGTGGG - Intronic
1116753035 14:48910712-48910734 GTTTGTGTGCTGTCCGTGTTAGG - Intergenic
1117279290 14:54221854-54221876 GCTTGCATACTGTGGGTGCTTGG - Intergenic
1118456433 14:65948982-65949004 GTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1118907023 14:70030670-70030692 CTCTGCCTGCTGTGGGTGGTGGG + Exonic
1120121321 14:80682980-80683002 GTGTGTTTGGTGGGGGTGGTGGG - Intronic
1121319993 14:92986670-92986692 GTTGGTGGGCTGTGGGTGGAGGG + Intronic
1124933819 15:34150662-34150684 GTTTGCATGTTGTGGGGGTTTGG + Intronic
1125250288 15:37694177-37694199 GTGTGTGTGTTGTGGGTGGAAGG - Intergenic
1127003528 15:54538932-54538954 AATTGCATGCTGTGGGTGTTTGG - Intronic
1128204655 15:65839915-65839937 GTATGGATGCTATGGGCGGTGGG - Intronic
1129151820 15:73693886-73693908 GTGTGTATGCGGTGGGTGGGGGG + Intronic
1129675250 15:77629860-77629882 GGTTCTATGCTGTGGGTGACTGG + Intronic
1130274098 15:82467621-82467643 GTTTGTATGAGGTCGGGGGTTGG - Intergenic
1130286500 15:82559578-82559600 GTATGTATGTTGTGGGATGTGGG + Intronic
1130354358 15:83116552-83116574 GTATGTACGCTGTGGGAGTTTGG + Intronic
1130466445 15:84194995-84195017 GTTTGTATGAGGTCGGGGGTTGG - Intergenic
1130497819 15:84478541-84478563 GTTTGTATGAGGTCGGGGGTTGG + Intergenic
1130588740 15:85199588-85199610 GTTTGTATGAGGTCGGGGGTTGG - Intergenic
1131869568 15:96747956-96747978 GTTTGGAAGCTGAGGGTGTTTGG - Intergenic
1133378958 16:5313885-5313907 CTTTGGAGGCTGTGGGTGGGTGG + Intergenic
1137645319 16:50068107-50068129 CTCTGTATGCTGTGGGAGGAAGG - Intronic
1139171481 16:64635147-64635169 ATCTGCATGCTGTAGGTGGTAGG - Intergenic
1139646126 16:68332002-68332024 GTTTGGATGCTGTGGCTATTTGG + Intronic
1144421120 17:15099607-15099629 GTTTGTTTGTTGGGGGTGGGGGG - Intergenic
1147651859 17:42067422-42067444 GTTTGGATGTTGTGGCTGGGCGG + Intergenic
1149492294 17:57093858-57093880 GTTTTTCTGCTGTGGGAGATAGG + Intronic
1150513165 17:65777544-65777566 GTGTGTAGGGTGTGGGTAGTGGG - Intronic
1151214980 17:72571244-72571266 GTATGTGTGCTGTGTGTGCTGGG - Intergenic
1151312224 17:73300288-73300310 GCTTGGAGGCTGGGGGTGGTGGG - Intronic
1152634578 17:81425472-81425494 GTTGGTGTGATGTGGTTGGTGGG + Intronic
1152634592 17:81425530-81425552 GTTGGTGTGATGTGGTTGGTGGG + Intronic
1154424935 18:14264938-14264960 GGGTGGATGCTGGGGGTGGTGGG + Intergenic
1154432624 18:14320162-14320184 GGGTGGATGCTGGGGGTGGTGGG + Intergenic
1156982809 18:43311153-43311175 GGTTGCATACTGTGGGAGGTAGG + Intergenic
1157871596 18:51234652-51234674 GGGTGTGTGCTGGGGGTGGTGGG + Intergenic
1157946932 18:51991014-51991036 GTTTGTCTGGTCTGGGTGGAGGG + Intergenic
1158204128 18:54972860-54972882 GTTGGTATGATGTGGGGGTTGGG - Intergenic
1158252231 18:55501896-55501918 GTTTGTATGATTAGGGTGGGCGG - Intronic
1158805886 18:60972258-60972280 GTTTGTGTGGTGGGGGCGGTGGG - Intergenic
1159029464 18:63216105-63216127 GTTTGTTTGTTTTTGGTGGTGGG + Intronic
1159804092 18:72934301-72934323 ATTTGTATTCTGAGGGTGGATGG + Intergenic
1160145245 18:76358516-76358538 CTTTGTTTGCCGTGGTTGGTGGG - Exonic
1160187341 18:76685984-76686006 GTTTGTCTGTTGCGGGTGGTGGG - Intergenic
1160415033 18:78703809-78703831 GTGTGTGTGCTGTGTGTGTTGGG + Intergenic
1161978617 19:7619430-7619452 GATTGGCTGCTGTGGGAGGTGGG - Intergenic
1162349789 19:10141902-10141924 TTTTGTAAGAAGTGGGTGGTTGG - Intronic
1164714210 19:30379649-30379671 GTGGGTATGCGGTGGGAGGTGGG + Intronic
1165354922 19:35298446-35298468 GTGTGTGTGCAGTGTGTGGTGGG - Intronic
1166894335 19:46014802-46014824 GTGTGTGTCCTGTGCGTGGTGGG + Intronic
1168356470 19:55703284-55703306 GTGTGTGTGTTGTGTGTGGTTGG + Intronic
925817523 2:7768006-7768028 GTGTGTATGCTGTGTGTGTGTGG - Intergenic
927193718 2:20533915-20533937 GGATGTATGCAGTGGGAGGTTGG - Intergenic
927565430 2:24108284-24108306 GTTTGTTTGTTTTGGTTGGTGGG - Intronic
927663411 2:25012109-25012131 GTGTGTATGCAGTGAGTGGGTGG + Intergenic
929311841 2:40434775-40434797 GTCTGTAATCTGTGGGTGATGGG - Intronic
930058460 2:47269903-47269925 GTGTGTGTGGTGGGGGTGGTGGG - Intergenic
931976190 2:67646661-67646683 TTTGCTGTGCTGTGGGTGGTGGG - Intergenic
932108605 2:68972241-68972263 CTTTGTGTGGTGTGGGAGGTTGG - Intergenic
932291146 2:70580735-70580757 GTATGTGTGCTGTGTGTGATGGG - Intergenic
932538075 2:72620277-72620299 GTGGGGATGTTGTGGGTGGTGGG + Intronic
932778759 2:74546518-74546540 GTGTGTATGTAGTGGGTGATGGG - Intronic
933478139 2:82818786-82818808 GGTTGTATGCTAGGGGTGGATGG - Intergenic
934879881 2:97967011-97967033 GTTTGTTTGTTTTAGGTGGTGGG - Intronic
935302568 2:101705776-101705798 CTTAGTAAACTGTGGGTGGTTGG + Intronic
935843008 2:107133888-107133910 GTTTGTGTGGTGTGTGTGGGGGG + Intergenic
936719641 2:115235553-115235575 GTTTTTTTGGTGGGGGTGGTGGG + Intronic
937012525 2:118574970-118574992 GTGTGTATGGTGTGGGTAGCAGG - Intergenic
937029496 2:118726381-118726403 ATTTCTTTGCTGTGGCTGGTGGG + Intergenic
937718599 2:125063943-125063965 GTTTGTGTGGGGAGGGTGGTTGG + Intergenic
938279976 2:130056941-130056963 GTTTGGAAGGTGGGGGTGGTTGG - Intergenic
938330934 2:130447656-130447678 GTTTGGAAGGTGGGGGTGGTTGG - Intergenic
938359015 2:130673847-130673869 GTTTGGAAGGTGGGGGTGGTTGG + Intergenic
938435408 2:131280496-131280518 GTTTGGAAGGTGGGGGTGGTTGG + Intronic
938537107 2:132256345-132256367 TTTTGTGTCCTGTGGGTGGATGG - Intronic
941857019 2:170241672-170241694 GCCTGGATGCTGTGGGTAGTGGG + Intronic
942476813 2:176335304-176335326 GGTTGTATGCTATGAATGGTAGG + Intronic
944096080 2:195969155-195969177 CTTGGTTTCCTGTGGGTGGTGGG + Intronic
944312820 2:198253573-198253595 GTGTGTGTGTTGGGGGTGGTGGG + Intronic
945740930 2:213660420-213660442 GTGTGTATGATGTAGGTGTTGGG + Intronic
945867697 2:215194906-215194928 ATATGTATGCAGTGGCTGGTTGG + Intergenic
946877610 2:224145818-224145840 GTTGCAATGCTGTGGGTGCTTGG - Intergenic
948623831 2:239254202-239254224 TTTTGTGTGCTGTGGATTGTGGG - Intronic
948716390 2:239866615-239866637 GTGTGTGTGATGTGTGTGGTAGG - Intergenic
948716395 2:239866708-239866730 GTATGTGTGATGTGTGTGGTAGG - Intergenic
948716409 2:239866952-239866974 GTATGTGTGATGTGTGTGGTGGG - Intergenic
948716413 2:239867021-239867043 GTGTGTGTGATGTGTGTGGTGGG - Intergenic
948716419 2:239867118-239867140 GTATGTGTGATGTGTGTGGTGGG - Intergenic
948716429 2:239867221-239867243 GTATGTGTGATGTGTGTGGTGGG - Intergenic
948716449 2:239867506-239867528 GTATGTGTGATGTGTGTGGTGGG - Intergenic
948716456 2:239867590-239867612 GTATGTGTGATGTGTGTGGTGGG - Intergenic
949044437 2:241865904-241865926 GTTTGTGTGATGTGTGTGTTTGG + Intergenic
1169517502 20:6333376-6333398 GGCTGTTTGCTGTGGGGGGTGGG - Intergenic
1170370627 20:15644253-15644275 GTTTAGATGCTGGAGGTGGTGGG - Intronic
1172410468 20:34718143-34718165 TTTTGGATACTGTGGTTGGTGGG + Intronic
1172629174 20:36366783-36366805 GTGGGGATTCTGTGGGTGGTGGG + Intronic
1173264384 20:41465916-41465938 GTTTGTAGGCCGGGCGTGGTGGG + Intronic
1175793321 20:61756285-61756307 ATTTGTATGCTGGGGGCTGTGGG + Intronic
1176372424 21:6070306-6070328 GTGTGTATGGTGTGTGTGGGAGG + Intergenic
1177842199 21:26246875-26246897 GTGTGTATGTTGGGCGTGGTGGG - Intergenic
1179751094 21:43468233-43468255 GTGTGTATGGTGTGTGTGGGAGG - Intergenic
1181717389 22:24741533-24741555 GTTTGTTTTTTGTGGGTGGTTGG - Intronic
1181925361 22:26354395-26354417 CTCTGAATGCTGTGGGCGGTTGG - Intronic
1183095966 22:35552534-35552556 GTGTGTGTGCTGGGGGTGGGAGG - Exonic
1183311317 22:37111225-37111247 GTTTGTATGGTGTGGGGTGGGGG + Intergenic
951228306 3:20146597-20146619 GTTTGTTTGTATTGGGTGGTAGG - Intronic
952567423 3:34675722-34675744 GTTTATGTGCTGGGGGTGGGAGG - Intergenic
955227281 3:57071281-57071303 GTTTGTATGTGGTGTGAGGTAGG - Intronic
959749778 3:109819840-109819862 ATTTGTACGCTGTGTGTGATTGG + Intergenic
960346730 3:116542089-116542111 GTTTGTTTGTTTTGGTTGGTAGG - Intronic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
961683020 3:128611542-128611564 GTGTGTGTGTTGTGTGTGGTGGG - Intergenic
964488131 3:157206792-157206814 GTGTGTGTGGTGTGGGTGGGTGG + Intergenic
964828171 3:160852729-160852751 AATTGTATTCTGTGGATGGTTGG + Intronic
965675705 3:171193643-171193665 GATTGTATGCTTTGGGTGGATGG - Intronic
966366200 3:179190313-179190335 TCTTTTATGCTGGGGGTGGTGGG - Intronic
966638509 3:182162117-182162139 GTATGTATGTTGGGGGTGGTAGG + Intergenic
967843051 3:194022255-194022277 GTGTGTAGGATGTGGGTGGGGGG - Intergenic
969687964 4:8687222-8687244 GTGTGTATATTGTGTGTGGTGGG + Intergenic
970638168 4:18032965-18032987 GTTTGTTTGTTTTGGGGGGTGGG - Intergenic
970676107 4:18452153-18452175 GTTTGGCTCCTGTGGGTGGTGGG + Intergenic
971021762 4:22544192-22544214 GAGTGTTTGCTATGGGTGGTGGG + Intergenic
972091757 4:35295199-35295221 GTGTGTCTGCTGGGGGTGGGTGG + Intergenic
972115145 4:35622386-35622408 GTATGTATTTTTTGGGTGGTGGG - Intergenic
976079691 4:81341800-81341822 ATGTGTATGCTGTGGTTGTTGGG + Intergenic
977473906 4:97479007-97479029 GTTTGTATGCTGTTGTTGTAGGG - Intronic
981843637 4:149141262-149141284 CTTTGTATACTGTGGGTGTTTGG + Intergenic
982239161 4:153281208-153281230 TTTCATATGCTGTGGGTGGAAGG + Intronic
984642913 4:182189737-182189759 GTGTGTGTGTTGGGGGTGGTGGG + Intronic
990265824 5:54074155-54074177 GTTCAAATGGTGTGGGTGGTGGG + Intronic
991526847 5:67568490-67568512 GCTTGGATGCTGTTGGTGTTAGG - Intergenic
991975996 5:72184088-72184110 GTATTTATGCTGGGGGTGGTGGG + Intronic
992272669 5:75081654-75081676 GTGTGTTTGGGGTGGGTGGTGGG + Intronic
992383091 5:76257827-76257849 GTATGGATGGTGTGTGTGGTAGG + Intronic
995723407 5:115161376-115161398 GTGTTTCTGCTGTGGGTGGTAGG - Intronic
997090785 5:130854892-130854914 ATGTGAATGCTTTGGGTGGTGGG + Intergenic
997965040 5:138350088-138350110 GTTTGTAGGCTTTGGGAAGTAGG + Intergenic
998272258 5:140717568-140717590 GTTTATATGCAGTGCGTGGAAGG + Intergenic
998474964 5:142412814-142412836 GTTTTTCTGAAGTGGGTGGTAGG - Intergenic
999319682 5:150605731-150605753 GTGTGTGTGGTGGGGGTGGTTGG - Intronic
999710553 5:154314629-154314651 GTTTGTATGTTGTGGGAGGCGGG - Intronic
1000181961 5:158820255-158820277 GTTTGAAGGCGGTGGGGGGTGGG + Intronic
1000886034 5:166748582-166748604 GTTTTTATGATGTGTGTGTTTGG - Intergenic
1001666440 5:173437196-173437218 GTTTTTCTTATGTGGGTGGTGGG + Intergenic
1003282275 6:4704456-4704478 GTATGTATGATGTGGATGGGTGG - Intergenic
1005339636 6:24831229-24831251 GTTCGTTTGCTGTGAGTGATAGG + Intronic
1006888599 6:37403768-37403790 TTTTGTATGCTGTGAGAGATGGG + Intergenic
1007309851 6:40936649-40936671 GATTTTATTCTGTGGGTCGTAGG - Intergenic
1007476738 6:42124299-42124321 TTCTGTGTGCTGTGGGTGCTGGG - Intronic
1007704206 6:43781173-43781195 GTCTGGAAGCTGAGGGTGGTGGG + Intronic
1007831695 6:44643710-44643732 GTTTGTCTGCAGAGGGTGTTGGG - Intergenic
1009522456 6:64700262-64700284 TTTAGTATGATGTGGGTTGTGGG - Intronic
1009684285 6:66936413-66936435 GTTGGTATGTTGATGGTGGTGGG + Intergenic
1011344161 6:86350730-86350752 GTGTGTGTGGTGCGGGTGGTGGG - Intergenic
1012401504 6:98845525-98845547 GTTTGTATGTGTTGGGTGGCGGG + Intergenic
1012768103 6:103395652-103395674 GTTTTTCTGATGTGGGTGGAAGG - Intergenic
1014828695 6:126076095-126076117 GTTAGTAGGTTGTGGGGGGTTGG + Intergenic
1015387290 6:132638658-132638680 GTTTGTTTGTTTTGGTTGGTAGG - Intergenic
1015606510 6:134961599-134961621 ATTTTTATGTTGTGGGTGGGAGG - Exonic
1016254880 6:142092946-142092968 GTTGTTATACTGTGGCTGGTAGG - Intergenic
1018620834 6:165728053-165728075 GTGTGTATGTTGGGGGTGGGTGG - Intronic
1019129007 6:169860001-169860023 GTTTGTGAGCTGTGTGTGGAAGG + Intergenic
1019750292 7:2725005-2725027 GTTTGTGTGCGGTGAGGGGTAGG - Intronic
1019978787 7:4605836-4605858 GTTTGTCTGCTGTGTGTGTGTGG + Intergenic
1020214560 7:6179796-6179818 GTGTGTGTGGTGTGTGTGGTGGG - Intronic
1020587156 7:10083123-10083145 GTCTGTAAGCTGTGGGTGGCAGG - Intergenic
1020985494 7:15129004-15129026 GTTTGAATGCGGGTGGTGGTGGG + Intergenic
1023194616 7:37621440-37621462 GTATGTGTGCTGGGGGTGGAGGG + Intergenic
1023506093 7:40901008-40901030 GTGTGTATATTGTAGGTGGTGGG + Intergenic
1028435860 7:90803038-90803060 GTTTGGAAGCTCTGGGTGCTTGG + Intronic
1028961606 7:96755061-96755083 GGTTGTATAAAGTGGGTGGTAGG - Intergenic
1029324006 7:99790256-99790278 GATTTTATCCTGTGGGTGATAGG - Intergenic
1029811912 7:103057892-103057914 GTGTGCATGTTGGGGGTGGTCGG + Intronic
1030569603 7:111206263-111206285 GTTTGTTTCCTCTGGGTGGATGG - Intronic
1033187037 7:139237145-139237167 GTTTGCTTTCTGTGGCTGGTTGG + Intronic
1033280732 7:140004748-140004770 GTTAGTCTGCTGTGGCTGGCTGG - Intronic
1033976665 7:147110982-147111004 GCTTTTATGCTGTTGGTGGGAGG - Intronic
1036920484 8:12849606-12849628 TCTTCTATGGTGTGGGTGGTAGG + Intergenic
1037293067 8:17371659-17371681 TTTTCTAAGCTGTTGGTGGTCGG + Intronic
1038697640 8:29819995-29820017 GTTTGTGTGGTGTGGGTGTGTGG - Intergenic
1038828943 8:31035277-31035299 GTGTGTGTGTTGTGGGTGGGGGG + Intronic
1041580409 8:59452440-59452462 GTTGGAATCCTGTGGGTGGAAGG - Intergenic
1041919913 8:63169216-63169238 GTTTAAAGGCTGGGGGTGGTTGG + Intronic
1043163367 8:76873213-76873235 GTTAGTAGGATGTGGGTGGAAGG - Intergenic
1044462299 8:92459562-92459584 CATTGTATGCTTTGGGGGGTGGG + Intergenic
1044865938 8:96571341-96571363 GTGTGTATGCTTAGGGAGGTGGG + Intronic
1046851497 8:118978779-118978801 TTTTGTATACTGTTGGTGGGAGG - Intergenic
1046882420 8:119323921-119323943 GTGTGCATGTTGTGGGTGGGGGG - Intergenic
1047739573 8:127795670-127795692 GTTTGTGTGTGGTGGGTGGGCGG + Intergenic
1048955990 8:139536415-139536437 TTTTTCATGCTGTGGGTGGCAGG + Intergenic
1049504857 8:142990930-142990952 GGTTGGAGGCTGTGGGCGGTGGG - Intergenic
1049504920 8:142991139-142991161 GGGTGGAGGCTGTGGGTGGTGGG - Intergenic
1049504931 8:142991172-142991194 GGGTGGAGGCTGTGGGTGGTGGG - Intergenic
1049504938 8:142991192-142991214 GGGTGGAGGCTGTGGGTGGTGGG - Intergenic
1051797207 9:20885586-20885608 GTTTGTATTTTGTGAGTGTTTGG + Intronic
1053387243 9:37702707-37702729 GCTTTTGTTCTGTGGGTGGTGGG + Intronic
1057569182 9:96190850-96190872 GATTTTATTCTGTGTGTGGTGGG - Intergenic
1059660091 9:116391816-116391838 GTGTTCATGCTGTGGGTGGTAGG + Intronic
1059667581 9:116463338-116463360 GTTTTTATGTTATGGATGGTGGG - Intronic
1060954135 9:127625845-127625867 GTTTGTTTGTTTTGGTTGGTTGG - Intronic
1189205715 X:39237073-39237095 GTTTGGATCCTGAGGGGGGTGGG + Intergenic
1189904957 X:45748749-45748771 GTATGTATGCTCTGGTTTGTAGG - Intergenic
1191995252 X:67088739-67088761 GTTTGGGTGCTGGTGGTGGTGGG + Intergenic
1192169954 X:68848018-68848040 GTGTGTAAGGTGTGCGTGGTGGG - Intergenic
1192250888 X:69412622-69412644 GTTTGTAGGTAGTGGGTGATAGG - Intergenic
1193144165 X:78060161-78060183 GTTTATAGGCTGTGCTTGGTTGG + Intergenic
1193601025 X:83508629-83508651 GTTAGTGTGCGGTGAGTGGTGGG - Exonic
1195312272 X:103643261-103643283 GGTTGTATGCTGTGGGTCTTGGG + Intergenic
1197833603 X:130671687-130671709 GTTTTTCTGCTCTGGCTGGTAGG - Intronic
1198893026 X:141421005-141421027 GTTTGTATGTGGTGTGAGGTAGG - Intergenic
1199459168 X:148064082-148064104 GTTTGTCTGGTTTTGGTGGTAGG + Intergenic
1201229934 Y:11854327-11854349 GTTTTTGTGTTGTGGGGGGTTGG - Intergenic