ID: 1078617701

View in Genome Browser
Species Human (GRCh38)
Location 11:12880797-12880819
Sequence GGAGGCGCTAAGGGGAGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 176}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078617694_1078617701 -1 Left 1078617694 11:12880775-12880797 CCCTTGGGGGCATTTTCAGGAAG 0: 1
1: 0
2: 2
3: 8
4: 189
Right 1078617701 11:12880797-12880819 GGAGGCGCTAAGGGGAGCTCTGG 0: 1
1: 0
2: 0
3: 14
4: 176
1078617692_1078617701 9 Left 1078617692 11:12880765-12880787 CCTGCGTCTGCCCTTGGGGGCAT 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1078617701 11:12880797-12880819 GGAGGCGCTAAGGGGAGCTCTGG 0: 1
1: 0
2: 0
3: 14
4: 176
1078617695_1078617701 -2 Left 1078617695 11:12880776-12880798 CCTTGGGGGCATTTTCAGGAAGG 0: 1
1: 0
2: 0
3: 22
4: 188
Right 1078617701 11:12880797-12880819 GGAGGCGCTAAGGGGAGCTCTGG 0: 1
1: 0
2: 0
3: 14
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078617701 Original CRISPR GGAGGCGCTAAGGGGAGCTC TGG Intronic
900208457 1:1441470-1441492 TTGGGGGCTAAGGGGAGCTCAGG - Exonic
901027774 1:6288102-6288124 GGAGCCCCTAATGGGAGCTGTGG - Intronic
902220009 1:14958769-14958791 GGAGGGGCCAAGGGCAGCCCTGG - Intronic
903072358 1:20732602-20732624 GGAGGCGCTCAGGGTGGTTCGGG + Intronic
903679631 1:25088354-25088376 GGAGCCGCTAAGGCTGGCTCTGG - Intergenic
905913418 1:41669266-41669288 GGAAGCGCTGAGGGGAGACCTGG + Intronic
906264540 1:44418166-44418188 GGAGGCGCTAGTGGGTGCACGGG + Intronic
910873407 1:91855329-91855351 GGTGCCGCTGAGGTGAGCTCTGG - Intronic
912505425 1:110152519-110152541 GAAGGAGCTAAGCAGAGCTCTGG + Intronic
912775666 1:112504931-112504953 AGATGAGCTAAGGGGAGCTGGGG - Intronic
914665971 1:149832808-149832830 GGCGGCGTTAAGCGGATCTCTGG + Intergenic
914669794 1:149860986-149861008 GGCGGCGTTAAGCGGATCTCTGG - Exonic
915916156 1:159942124-159942146 GGAGGCCCTAAGGACAGGTCTGG - Intronic
918373160 1:183881865-183881887 GGAGGCCCTGAAGGGAGCTGAGG - Intronic
920186300 1:204161440-204161462 GGAGGGGCTCAGGGGACCTTGGG + Intronic
920203587 1:204275648-204275670 GGAGGCTCTCAGGGGAGATGGGG + Intronic
923125246 1:231028816-231028838 GGAGGGGTGGAGGGGAGCTCTGG - Intronic
924478690 1:244406374-244406396 GAAGGCCCTAATGGGAGCACAGG - Intergenic
1062988045 10:1788480-1788502 GGTGCAGCTAAGGGGAGCTCGGG + Intergenic
1063583881 10:7333762-7333784 GGAGGCCCTGTGGGGAGCTGGGG - Intronic
1064418219 10:15168662-15168684 GGAGGCACTAGAGGGAGCTGCGG - Exonic
1067165415 10:43863148-43863170 CGAGGTGCTAGGGGGAGATCAGG + Intergenic
1067947821 10:50701484-50701506 GAAGGAGCTCAGGTGAGCTCTGG + Intergenic
1069913103 10:71771782-71771804 AGAGGCCCCAAGAGGAGCTCAGG - Intronic
1070883138 10:79866477-79866499 GAAGGAGCTCAGGTGAGCTCTGG + Intergenic
1071649707 10:87382792-87382814 GAAGGAGCTCAGGTGAGCTCTGG + Intergenic
1071805879 10:89120371-89120393 GGAGGCAATATGGGGAACTCTGG - Intergenic
1072696951 10:97611022-97611044 GGAGGAGCTATGGGGAGGTGAGG + Intronic
1073139051 10:101235925-101235947 GGAGGAGCTATAGGGAACTCTGG - Intergenic
1074940957 10:118235849-118235871 TGGGGCGCCAAGGGGAGCTGAGG - Intergenic
1076659209 10:132044167-132044189 GGCGGCCCTAAGGGCAGCTGAGG - Intergenic
1076781277 10:132726026-132726048 GGAGCCGCTGAGGGGAGATTTGG + Intronic
1076828255 10:132981331-132981353 GGAGGGGCTCAGGGGTGCTCAGG + Intergenic
1077259457 11:1608123-1608145 GGAGGCTCCAAGGGGGGCTGTGG - Exonic
1078617701 11:12880797-12880819 GGAGGCGCTAAGGGGAGCTCTGG + Intronic
1079388414 11:20000637-20000659 GGGGGAGCTAATGGGAGCCCTGG + Intronic
1080034858 11:27700366-27700388 CGAGGCGCTACGGGGTGCGCGGG + Intronic
1080727948 11:34916381-34916403 GGCGGCGCTGAGGGCAGCCCGGG + Exonic
1083227620 11:61294844-61294866 AGAGGCGCGGAGGGGCGCTCAGG - Intronic
1083302349 11:61745631-61745653 GGAAGCCCTATGGGGACCTCAGG - Exonic
1083426822 11:62592310-62592332 GGAGGGACTACGGGGAGCTGGGG + Intergenic
1084171067 11:67401375-67401397 CGAGGCGCTGAGGGTAGCTGGGG - Intronic
1084455586 11:69266299-69266321 GGAGGAGATAAAGGGGGCTCTGG + Intergenic
1085021580 11:73213452-73213474 GGAGGAGCTAGGGGGAGATGGGG + Intergenic
1089846997 11:121466345-121466367 GGAGGAGGAAAGGGGAGATCAGG + Intronic
1092491485 12:8949609-8949631 CGAGGCGCTAGGGGGAACGCTGG - Exonic
1092762048 12:11819175-11819197 TGAGGCGCTAATGGGAGGTGAGG - Intronic
1096385201 12:51190716-51190738 GGAGGTGGTGAGGGGAGCACTGG - Intronic
1096461457 12:51823527-51823549 GGAGGTGCTAAGGGGGTGTCAGG - Intergenic
1096621947 12:52870683-52870705 GGAGGCGGAGAGGTGAGCTCGGG + Intergenic
1096652528 12:53068896-53068918 GGAGGTGCTGAGGGGAGCCCAGG + Intronic
1101568491 12:105932055-105932077 GGAGGCGCTGGGGTGAGCTGGGG + Intergenic
1102497027 12:113326973-113326995 GGATGGGATAAGGGAAGCTCAGG - Intronic
1103096543 12:118136716-118136738 TGAGGCCCTAGGGGAAGCTCTGG - Intronic
1103560130 12:121789309-121789331 GGCGGCTCTAGGGGGAGCCCAGG - Intronic
1103907382 12:124334682-124334704 GGAGGGGCTAGACGGAGCTCGGG + Intronic
1104958406 12:132476925-132476947 GGAAGCACTGAGGGCAGCTCAGG - Intergenic
1113177987 13:107588393-107588415 AGAGGCCCTAAAGGGAGCCCTGG + Intronic
1113748053 13:112759192-112759214 GGAGGCGGCTGGGGGAGCTCTGG + Intronic
1113792975 13:113040565-113040587 GGAGGCGCTGAGGGGACGTGAGG - Intronic
1118875925 14:69784871-69784893 GCAGGCGGGAAGGGGAGCTGTGG + Intronic
1127450122 15:59108453-59108475 GTAGGCGCTTAGGGAAGATCTGG - Intronic
1128537254 15:68500630-68500652 GGAGGAGGTAAGGAGAGCTTGGG + Intergenic
1129891514 15:79074835-79074857 GGAGGCCCCAGGTGGAGCTCTGG - Intronic
1132942868 16:2516928-2516950 GGAGGCACCAAGAGGAGCACAGG - Intronic
1132973908 16:2702104-2702126 GGAAGCGCCAAGGAAAGCTCAGG + Intronic
1136246907 16:28981523-28981545 GGAGCCGCCAAGGGGAGCCGTGG + Exonic
1136712992 16:32254694-32254716 GGAGGGACCAAGGGGCGCTCTGG - Intronic
1136754924 16:32674744-32674766 GGAGGGACCAAGGGGCGCTCTGG + Intronic
1136813189 16:33195625-33195647 GGAGGGACCAAGGGGCGCTCTGG - Intronic
1136819665 16:33305705-33305727 GGAGGGACCAAGGGGCGCTCTGG - Exonic
1136826228 16:33362240-33362262 GGAGGGACCAAGGGGCGCTCTGG - Intronic
1136831294 16:33461011-33461033 GGAGGGACCAAGGGGCGCTCTGG - Exonic
1137675934 16:50303941-50303963 GGAGGAGCTGATGGGTGCTCAGG + Intronic
1137926424 16:52546415-52546437 GGAGGGGCTGAGGAGAGCGCCGG + Intronic
1138284033 16:55794302-55794324 GACGGTGCTCAGGGGAGCTCTGG + Intergenic
1138284969 16:55802685-55802707 GACGGTGCTCAGGGGAGCTCTGG - Intergenic
1140404596 16:74700442-74700464 GGAGGCGCGAAGGTGAGCATGGG - Exonic
1140404857 16:74702140-74702162 GGAGGCTCCATGGGGAGGTCTGG + Intergenic
1141907533 16:87037329-87037351 GGAGGGGCTATCGGGAGGTCTGG - Intergenic
1142239596 16:88939183-88939205 GGAAGAGCTCAGGGGGGCTCGGG + Intronic
1142427930 16:90010737-90010759 GGAGGGGCTGAGGGGATCTGTGG - Intronic
1202991765 16_KI270728v1_random:18595-18617 GGAGGGACCAAGGGGCGCTCTGG - Intergenic
1203057065 16_KI270728v1_random:935074-935096 GGAGGGACCAAGGGGCGCTCTGG + Intergenic
1143209132 17:5170563-5170585 GGAGGAGCAAAGGGAGGCTCCGG + Exonic
1143582659 17:7835771-7835793 GCAGGCGCAAGGGGGTGCTCGGG - Intergenic
1144618617 17:16800035-16800057 GGAGGAGCAAAGGGAGGCTCTGG + Intronic
1144761695 17:17710899-17710921 GGGGGCCCTCAGGAGAGCTCTGG - Intronic
1144894088 17:18515664-18515686 GGAGGAGCAAAGGGAGGCTCCGG - Intergenic
1145138144 17:20428596-20428618 GGAGGAGCAAAGGGAGGCTCCGG + Intergenic
1146273271 17:31498247-31498269 GGAGGCCCTAAGCTGAGCTCTGG + Intronic
1146604791 17:34249027-34249049 GGCAGGGCTAAGGGGAGCACTGG - Intergenic
1146911241 17:36649770-36649792 TGAGGGGCAGAGGGGAGCTCAGG + Intergenic
1146945392 17:36869932-36869954 TGAGGTGGTAAGGGGACCTCTGG - Intergenic
1147558795 17:41496604-41496626 GCAGGCGCCAAGGGGGTCTCAGG + Intergenic
1148183116 17:45620697-45620719 GGGGGCGCGGAGCGGAGCTCGGG + Intergenic
1149293372 17:55238495-55238517 GGAGGCGCCGAGGGTAGCTAAGG - Intergenic
1149871009 17:60181642-60181664 GGAGGAGCAAAGGGAGGCTCCGG - Exonic
1149891180 17:60391876-60391898 GGAGGCGCTGAGGAGAGGTGAGG - Exonic
1150791792 17:68205402-68205424 GCAGCCGCTAGGGGGAGCGCGGG - Intergenic
1151786642 17:76278448-76278470 GGAGGAGCTGAGGGCAGCCCCGG + Intronic
1151801386 17:76381918-76381940 AGAGGCCCAGAGGGGAGCTCTGG + Intronic
1152357098 17:79812736-79812758 CCGGGCGCCAAGGGGAGCTCAGG - Intergenic
1152749876 17:82057703-82057725 GGAGGCGCCTAGGGGAGGTGGGG + Intronic
1155045306 18:22097967-22097989 GGAAGGGCTGAGGGGAGGTCAGG + Intronic
1158607614 18:58909804-58909826 GGAGGCGCTATGGCCACCTCAGG + Intronic
1160906033 19:1452111-1452133 GGGGGCGTGAAGGGGGGCTCCGG + Exonic
1162218205 19:9153931-9153953 GGGGGCACTAAGGGGAGCCAGGG + Intronic
1163437552 19:17304254-17304276 GTAGGCCCTCAGGAGAGCTCAGG + Intronic
1166250156 19:41564402-41564424 GGATTAGCTAAGGCGAGCTCAGG - Intronic
1166862084 19:45816596-45816618 GGGGGCGCTGGGGGCAGCTCTGG + Intronic
1167216594 19:48169821-48169843 GGAGGGGCTGAAGGGAGCTAAGG - Intronic
1168344475 19:55643685-55643707 GGCGGCGAGAAGGGGACCTCTGG - Intronic
927390020 2:22584035-22584057 GAAGGTGCAAATGGGAGCTCAGG - Intergenic
929260993 2:39866459-39866481 GGAGGGGCTGAAGGGAGCTTGGG - Intergenic
931713215 2:65007348-65007370 GGAGGAGCTATGGGGAGATGTGG + Intronic
931844963 2:66193952-66193974 GGAGGAGCTCAGGGGACATCAGG - Intergenic
935590386 2:104842623-104842645 GGAGGCGCTACAGGATGCTCTGG - Intergenic
935707923 2:105872414-105872436 GGAGGCGCTCAGGTGAGGACAGG - Intronic
935826941 2:106961738-106961760 GGAGGCTCCACAGGGAGCTCTGG - Intergenic
938872095 2:135489565-135489587 GCAGGAGCTCAGGGGAGCTATGG + Intronic
945038144 2:205721907-205721929 GGAGGGGCAAAGGGGAGCTTGGG - Intronic
947024115 2:225717092-225717114 AGAGGCCCTGAAGGGAGCTCTGG + Intergenic
948439969 2:237980429-237980451 GGAGGAGAGAAGGGGAGCTCTGG + Intronic
948693402 2:239720819-239720841 GGAGGCTTGAAGGGGAGCTGGGG + Intergenic
1172027659 20:31960083-31960105 GAAGGTGCTCAGGGGGGCTCAGG + Intergenic
1172749156 20:37237681-37237703 GCTGGTGCTAAGGGAAGCTCTGG - Intronic
1173210468 20:41028378-41028400 GGAGGCGCTGGGGAGACCTCTGG + Intergenic
1175046510 20:56111468-56111490 GGAGGGGCTATGGTGAGCTCTGG - Intergenic
1175129525 20:56779136-56779158 GGAGGCGGTAAGGGCAGGCCCGG + Intergenic
1175847522 20:62066272-62066294 GGCGGCGCTGACGGGAGCGCCGG + Intergenic
1178755327 21:35344221-35344243 GGAGGCACTCAGGGGCGCTTTGG - Intronic
1181830714 22:25558353-25558375 GGAGGCGCTAGAGAGAGCTAGGG - Intergenic
1182132838 22:27870680-27870702 GGAGGCACTGAGGGTAGCACTGG - Intronic
1182714140 22:32341385-32341407 GGAGGGGCTGAGGGGAACTGGGG - Intergenic
1184401456 22:44276975-44276997 GGAGGGGCTGAGGGGAACTGGGG - Intronic
1185403007 22:50628095-50628117 GAAGGCGCTAGAGGGAGCCCAGG + Exonic
949505684 3:4725145-4725167 GGAGGCTCTCAGGGGAGCAGGGG - Intronic
950107708 3:10398769-10398791 GGAGGTGCTTTGGGGAGCTTGGG - Intronic
953480691 3:43249176-43249198 GGAGGCGCTGTGTGGAGCTCAGG - Intergenic
954469125 3:50676429-50676451 GGAGGTGATAAAGGGAGCTCTGG + Intronic
957048587 3:75395136-75395158 GGAGGCGCACAGGAGACCTCAGG + Intergenic
968273429 3:197422377-197422399 GGAGGCTCTGAGGGGAGTTAAGG + Intergenic
969032964 4:4228035-4228057 GGTGCCGCTAAGTGGAGGTCTGG + Intergenic
974220778 4:58968301-58968323 GGAGGGGCTTGGGGGAGCACAGG + Intergenic
976408934 4:84690828-84690850 GGAGGCGGTAGGGGTAGTTCAGG - Intronic
1001399440 5:171437805-171437827 GGAGGGGCCAATGAGAGCTCTGG - Intronic
1002807578 6:591843-591865 GGAGGCCCTGAGGGAAGCTGGGG - Intronic
1005449838 6:25961912-25961934 GGAACCAGTAAGGGGAGCTCAGG - Intergenic
1005649457 6:27873365-27873387 GGAGGCGTTAAGCGCATCTCAGG - Exonic
1006377349 6:33678845-33678867 GGCGGGGCTGAGGGGTGCTCAGG + Intronic
1006452396 6:34112675-34112697 GGAGGCGGCAGGGGAAGCTCAGG + Intronic
1007392313 6:41556724-41556746 GGAGGGAGTAAGGGGTGCTCTGG - Intronic
1010926711 6:81753282-81753304 GGAAGCGCGCCGGGGAGCTCTGG + Intergenic
1019607491 7:1917445-1917467 GGCGGCGCTGCTGGGAGCTCTGG - Intronic
1020212171 7:6165448-6165470 GGAGGCGGTCAGGGGGGCTTGGG + Intronic
1021251482 7:18332269-18332291 GAAGGCTCTTAGGGGAACTCTGG - Intronic
1022427918 7:30285442-30285464 GGAGGCGCCAATGGGACCGCGGG + Exonic
1023678080 7:42651739-42651761 GGTGGCTCTAAGGGGACTTCAGG - Intergenic
1031935421 7:127731096-127731118 GGAGGCTGGAAGGGGAGCCCTGG - Intronic
1033044307 7:137947504-137947526 GGAGAGGCTCAGGGGAGCCCCGG - Intronic
1033641130 7:143263992-143264014 GGAGGCGCTAAGTGCAGAGCAGG - Intronic
1034061915 7:148099828-148099850 GGAGGAGCAAGGAGGAGCTCAGG - Intronic
1035023805 7:155814032-155814054 AGAGGCGGGAAGGGGAGCCCGGG - Intergenic
1035388134 7:158488406-158488428 GGAGGCGCCAAGAGGAGAGCAGG - Intronic
1037774326 8:21823003-21823025 GGAGGCGATGAGGGGAGTGCAGG - Intergenic
1040515385 8:48130349-48130371 AGAGGCGATAAGCGGAGATCTGG + Intergenic
1042210477 8:66375837-66375859 GGATGCACCAAGGGGACCTCTGG + Intergenic
1043855725 8:85262713-85262735 GGAGTGGCTAAGGGGAGCTTTGG + Intronic
1047951551 8:129939679-129939701 AGCGGCGCTAGGGGGAGCCCCGG + Exonic
1049731574 8:144181086-144181108 GAGGGCACTAAGGGTAGCTCAGG - Intronic
1049775210 8:144400851-144400873 GGAGGCGGGGAGGGGAGCTCGGG + Intronic
1056558917 9:87712532-87712554 GAAGGAGCTCAGGTGAGCTCTGG + Intergenic
1056994476 9:91443465-91443487 GGAGGTGCTGACGGCAGCTCAGG - Intergenic
1060721879 9:125984889-125984911 GGTGGGGCTCAGGGTAGCTCTGG + Intergenic
1060801366 9:126547764-126547786 GGAGGGGCCAAGGGGAGGACAGG - Intergenic
1061207693 9:129174178-129174200 AGCGGCGCTAGGGGGAGCTCTGG + Intergenic
1061595892 9:131628920-131628942 GGAGGCCTTCAGGAGAGCTCAGG + Intronic
1061814482 9:133186214-133186236 GGGAGCTCTAATGGGAGCTCAGG + Intergenic
1061944585 9:133901633-133901655 GGAGCCCCTCAGGGCAGCTCCGG - Intronic
1062085606 9:134646485-134646507 GGAGCCGCCCAGGAGAGCTCTGG - Intronic
1062439455 9:136563240-136563262 GCGGGGGCTCAGGGGAGCTCAGG - Intergenic
1062501827 9:136855037-136855059 GGAGGCGCCGAGGGGAGCTGGGG + Exonic
1062730745 9:138106889-138106911 GGAGACCCCAAGGGCAGCTCTGG - Intronic
1185888276 X:3802196-3802218 GGAGGCTCTAGGGGAGGCTCTGG - Intergenic
1185888293 X:3802244-3802266 GGAGGCTCTAGGGGAGGCTCTGG - Intergenic
1185888351 X:3802412-3802434 GGAGGCTCTAGGGGAGGCTCTGG - Intergenic
1187552123 X:20316466-20316488 GTTGACCCTAAGGGGAGCTCTGG - Intergenic
1198051673 X:132957601-132957623 GGAGGGGCTCCGGGGAGCTCCGG - Intronic
1200247444 X:154533686-154533708 CGGGGAGCTAAGGCGAGCTCTGG - Intronic
1200430341 Y:3072676-3072698 GGAGGCGCAGCGGGGAGCTGGGG + Intergenic