ID: 1078619441

View in Genome Browser
Species Human (GRCh38)
Location 11:12893664-12893686
Sequence CCCTCTGTAGAGATGGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078619436_1078619441 -2 Left 1078619436 11:12893643-12893665 CCTGTCTGAGGAAGCAGCAGCCC 0: 1
1: 0
2: 7
3: 29
4: 318
Right 1078619441 11:12893664-12893686 CCCTCTGTAGAGATGGTGCTGGG 0: 1
1: 0
2: 2
3: 12
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078619441 Original CRISPR CCCTCTGTAGAGATGGTGCT GGG Intronic
901031936 1:6312127-6312149 CCCTCGGTAGAGCTGGTGGCCGG + Intronic
901210078 1:7519693-7519715 CCCTCAGTAGAGGTGATGCTGGG + Intronic
901401582 1:9018481-9018503 CCCTCCGTGGAGATGGAGCTCGG + Intronic
901595100 1:10378654-10378676 GCCTCTGCAGAGTTGTTGCTAGG + Intronic
903637142 1:24828917-24828939 CCCTGTGGAGAGAAGTTGCTTGG - Intronic
903751420 1:25623670-25623692 CCCTGTGTAGGGAAGCTGCTTGG + Intronic
903821144 1:26103458-26103480 CCCCCTGCAGAAATGGGGCTGGG + Intergenic
903960903 1:27057153-27057175 CTCTCTGTGGATATGATGCTTGG - Intergenic
904279245 1:29407184-29407206 CCATCTGTAGAGTAGGGGCTAGG + Intergenic
905869434 1:41394707-41394729 CCCTCTGGGGAGAGGGTGGTGGG + Intergenic
905899880 1:41574465-41574487 CTCTCAGGAGAGAGGGTGCTTGG - Intronic
907692323 1:56681589-56681611 CCCTATTTAAAAATGGTGCTGGG - Intronic
908133971 1:61109308-61109330 CCATCTGTAGAGATGGAGGGGGG - Intronic
908913294 1:69097759-69097781 CCCTATTTAAAAATGGTGCTGGG - Intergenic
911876663 1:103173240-103173262 CCCTCTTGAGAGATGAAGCTGGG + Intergenic
912775937 1:112506588-112506610 CCCTGTGTAGGGATGGGGCTGGG + Intronic
915095621 1:153460251-153460273 CCCTCTGTGGAGCTGGAGCTGGG + Intronic
915583670 1:156831468-156831490 CCATGTGTCCAGATGGTGCTGGG + Intronic
916981087 1:170137794-170137816 CCCTCTCAACAAATGGTGCTGGG + Intergenic
917718712 1:177764289-177764311 CCCTATTTAAAAATGGTGCTGGG + Intergenic
919935008 1:202245535-202245557 CCCTCTCTGGCTATGGTGCTAGG + Intronic
920840304 1:209548354-209548376 GCCTCTGTATAGCTGGTGCAAGG + Intergenic
922425429 1:225488104-225488126 CCCTTTGTAGGGATGGGGTTGGG - Exonic
924873630 1:248076080-248076102 CCCTATTTAAAAATGGTGCTGGG - Intronic
1064700450 10:18013700-18013722 TCCTTTCAAGAGATGGTGCTGGG - Intronic
1065200165 10:23304840-23304862 TAGTCTGTAGAGTTGGTGCTGGG - Intronic
1066243605 10:33561313-33561335 CCCTCTGTGGGGATGGGGGTGGG + Intergenic
1067351818 10:45482899-45482921 CCCTCTCAATAAATGGTGCTGGG + Intronic
1067515743 10:46941127-46941149 CCATTTGTGGAGATAGTGCTAGG + Intronic
1067646506 10:48110686-48110708 CCATTTGTGGAGATAGTGCTAGG - Intergenic
1067768504 10:49107555-49107577 CCCTGGGTAGAGGTGGTGGTGGG - Intronic
1067851654 10:49758688-49758710 CCCACTGGGCAGATGGTGCTGGG + Intronic
1070958826 10:80484493-80484515 CTTTTTGTAGAGATGGTGTTTGG + Intronic
1073022688 10:100459349-100459371 CCCTATTTAAAAATGGTGCTAGG + Intergenic
1075804922 10:125180215-125180237 CCCTTTTTATAAATGGTGCTGGG - Intergenic
1077333057 11:1991760-1991782 TCCTCTCTAGAGATGGGGGTGGG - Intergenic
1078619441 11:12893664-12893686 CCCTCTGTAGAGATGGTGCTGGG + Intronic
1079455268 11:20630933-20630955 CCCTCTGTAAAGAAGGACCTGGG - Intronic
1080200816 11:29667549-29667571 CCCTATTTATAAATGGTGCTGGG + Intergenic
1080752392 11:35162746-35162768 CCCTCTGTAGGGCTTCTGCTTGG + Intronic
1083363528 11:62127952-62127974 CTCTTTGTAGAGATGAGGCTAGG + Intronic
1085437878 11:76525238-76525260 CTCTTTCCAGAGATGGTGCTGGG + Intronic
1089140511 11:116280393-116280415 GCCCCTGTAGATAGGGTGCTGGG + Intergenic
1089781308 11:120875061-120875083 CCCTGTGTAGAAATCTTGCTTGG + Intronic
1202816040 11_KI270721v1_random:46938-46960 TCCTCTCTAGAGATGGGGGTGGG - Intergenic
1092529760 12:9334772-9334794 CCCACTTTAGAGTTGGTCCTGGG - Intergenic
1093134670 12:15436724-15436746 GCCTCTGTAGCCATGGTGCTAGG - Intronic
1094693143 12:32789217-32789239 CCCACTGTAGAGAAGATGATAGG - Intergenic
1096519043 12:52173881-52173903 CCCTCTGGAGAGATGATGGAAGG + Intronic
1097224210 12:57467576-57467598 ACCTCTGTGGAGTGGGTGCTGGG - Intronic
1097440329 12:59599942-59599964 ACCTCTGTGGAGCTGCTGCTTGG + Intronic
1102533625 12:113565240-113565262 CCCTTTGTATAGGTGGTGATGGG - Intergenic
1102653605 12:114461536-114461558 CTTGTTGTAGAGATGGTGCTGGG - Intergenic
1104048756 12:125182782-125182804 CTCTCTGTACATATGATGCTGGG + Intergenic
1104772950 12:131375715-131375737 GACTCTGCAGAGATGGTGCCAGG - Intergenic
1105203598 13:18200682-18200704 TCCTCTCAATAGATGGTGCTGGG - Intergenic
1107349358 13:39498331-39498353 CCCTCTACAGAGTAGGTGCTTGG - Intronic
1110156479 13:72322742-72322764 CCCTCTTTAATAATGGTGCTGGG + Intergenic
1110544379 13:76739675-76739697 CCATTTGTAAAGATGGTGCCAGG - Intergenic
1112459922 13:99594876-99594898 GCCTCTGCAGAGGTGATGCTTGG - Intergenic
1113491681 13:110697206-110697228 CCCTCAGCAGAGGTGGTGTTTGG - Intronic
1117032050 14:51682948-51682970 CCCACTGGAAAGATGGTGCCAGG + Intronic
1118105164 14:62650369-62650391 TTCTCTGTGGAGATGGGGCTTGG + Intergenic
1121122208 14:91383157-91383179 CCATCTGTAGACTTGGAGCTGGG + Intronic
1122405876 14:101500770-101500792 CCCTCTTCATAGATGATGCTGGG - Intergenic
1123674432 15:22695052-22695074 CACTCTGTATAAAAGGTGCTGGG - Intergenic
1123689660 15:22827384-22827406 ATCTCTGTGGAGAAGGTGCTGGG + Exonic
1124326444 15:28768040-28768062 CACTCTGTATAAAAGGTGCTGGG - Intergenic
1124405483 15:29387877-29387899 CCCTATTTAAAAATGGTGCTGGG + Intronic
1124991130 15:34674781-34674803 CCCTCAGTAGGGCTGGTTCTGGG - Intergenic
1126040925 15:44590105-44590127 CCCTCTTTAAAGAAGTTGCTAGG - Intronic
1126084148 15:44995285-44995307 CCCTATGAATAAATGGTGCTGGG + Intergenic
1127723815 15:61728171-61728193 CCCTCTTCAGAGATGGAGCTTGG + Intergenic
1129072303 15:72961514-72961536 CCCTCTGGAGAGCTGGGGCAAGG + Intergenic
1129200365 15:73994921-73994943 ACCTCTGTAGGGCTGGGGCTGGG - Exonic
1129542156 15:76359216-76359238 CCTTATGGAGAGATGGGGCTGGG - Intronic
1131146449 15:90016778-90016800 CCCTTTGCAGAGATGGGTCTAGG - Intronic
1131409155 15:92191542-92191564 CCCTCTTTAGAGACAATGCTTGG - Intergenic
1132004574 15:98215065-98215087 GCCTCTGTGGAGATGGTTTTGGG + Intergenic
1135374642 16:21934918-21934940 CCCTCTATAGGGCTGTTGCTAGG - Intergenic
1136154826 16:28375603-28375625 CCCTCTATAGGGCTGTTGCTAGG + Intergenic
1136208266 16:28739655-28739677 CCCTCTATAGGGCTGTTGCTAGG - Intergenic
1136264351 16:29106292-29106314 CCCTCTATAGGGCTGTTGCTAGG - Intergenic
1138806113 16:60090674-60090696 CACTCTCTAGAGAGGGAGCTTGG + Intergenic
1140196556 16:72860221-72860243 CCCCCTGCAGAGCTGGTTCTGGG + Intronic
1141968221 16:87461627-87461649 CCCTCTGCAGAGCGAGTGCTGGG - Intronic
1143099023 17:4494794-4494816 CCCTGTCTAGAGATGGAGGTTGG + Intergenic
1144502018 17:15796544-15796566 CCCTATTTAAAAATGGTGCTGGG - Intergenic
1144838943 17:18173856-18173878 CCCTATGTGGAGATTGCGCTGGG + Exonic
1145164203 17:20599204-20599226 CCCTATTTAAAAATGGTGCTGGG - Intergenic
1146898008 17:36559528-36559550 TCCTATTTAGAGATGGTGGTAGG + Intronic
1147205568 17:38835003-38835025 CCCTCTGGAGAGAAGGTGAGAGG - Intergenic
1152762276 17:82115051-82115073 TCCTCTGCAGAGAAGGTACTAGG - Intronic
1153915556 18:9741543-9741565 CCCACTGGACAGATGGTGCGTGG - Intronic
1154123777 18:11672248-11672270 CCCTCTATGGAGGTGGTGTTAGG - Intergenic
1154313785 18:13287503-13287525 CCCTCTGGAGAGTGGGTGCAGGG + Intronic
1155246386 18:23914137-23914159 CCCTCTGTATGGTAGGTGCTTGG + Intronic
1156030627 18:32708262-32708284 ACCTCTGGTGGGATGGTGCTGGG - Intronic
1156809396 18:41228247-41228269 CCATCTGTAGAGATGCACCTTGG + Intergenic
1158722511 18:59938190-59938212 CCATCTGCAGAGTGGGTGCTAGG - Intergenic
1160772452 19:839099-839121 CCCTCCGTGGGGATGGTCCTGGG - Intergenic
1161505280 19:4640341-4640363 CCCTCCATAGAGAAGGTGCTGGG - Intronic
1167154048 19:47727416-47727438 CTTTCTGTACACATGGTGCTGGG + Intronic
1167247307 19:48381365-48381387 CCCTCTGTAGGGATGCTGTGAGG + Intergenic
1168346077 19:55650827-55650849 CCCTCTGTCTAGATGGAGGTGGG + Intronic
1168665212 19:58199967-58199989 ACCTCTGGAGAAATGCTGCTGGG + Intronic
927364775 2:22281751-22281773 CCCTCTACAGAGATGATTCTAGG + Intergenic
927498114 2:23564151-23564173 GCCTTTGTAGGGATGGTGTTGGG + Intronic
928245913 2:29626872-29626894 ACCTCTGCAGAGATAGTGCCTGG + Intronic
933532742 2:83531091-83531113 CCCTCTGTAGAGGGAGTGCTGGG - Intergenic
934802371 2:97177585-97177607 CCCTATTTAAAAATGGTGCTGGG + Intronic
936575408 2:113649296-113649318 TTCTCTGTAGTGATGGTGGTTGG - Intergenic
938213310 2:129486552-129486574 CCCACTGAACACATGGTGCTGGG + Intergenic
940060117 2:149556336-149556358 CCCTCCATAGAGATTTTGCTAGG - Intergenic
940945318 2:159609944-159609966 TTCTCTGTAGAAATAGTGCTGGG - Intronic
941110464 2:161414972-161414994 TCCTCTGTAGAGCCGGTGCTGGG + Intergenic
941337677 2:164265891-164265913 CCCTTTTTAGAAATGGTGCTGGG + Intergenic
945847882 2:214968795-214968817 CTCTCTGTAGATATGGAGGTTGG - Exonic
946770812 2:223086464-223086486 CACTTTGCAGAGATGGAGCTGGG - Intronic
946874147 2:224111197-224111219 CCCTCATCAGAGCTGGTGCTGGG + Intergenic
947615496 2:231554535-231554557 CCCTGTGTGCAGTTGGTGCTGGG - Intergenic
948601987 2:239112518-239112540 CTCTCTGATGAGATGGAGCTGGG + Intronic
949077704 2:242071626-242071648 CCCTCTGTAGAGATGGCTTATGG + Intergenic
1169409912 20:5359576-5359598 CCCTCTCTAGAGCTGGTGCCTGG - Intergenic
1170162458 20:13327714-13327736 CCCTATTTATAAATGGTGCTGGG + Intergenic
1173264283 20:41464675-41464697 CCCTCTGTGCACATGGAGCTAGG - Intronic
1173925866 20:46780766-46780788 CCCTCCTGAGAGATGGTGCCTGG - Intergenic
1174507548 20:51026251-51026273 CCACCTCTAGAGATGGGGCTGGG + Intergenic
1174553270 20:51376469-51376491 CCCTCTGTAAAGATGGAGCTGGG - Intergenic
1174753642 20:53137052-53137074 CCCTGTGTGGGGATGGCGCTTGG + Intronic
1175248936 20:57597359-57597381 CCGTCTGTACAGGTGGGGCTAGG - Intergenic
1176714371 21:10337395-10337417 TCCTCTCAATAGATGGTGCTGGG + Intergenic
1179288451 21:39997807-39997829 CCCTCTGAAGTGAAGGTGGTGGG - Intergenic
1184815977 22:46870285-46870307 CTCTCTTTAGAGTTAGTGCTTGG + Intronic
1185291704 22:50030724-50030746 CCCGCTGGAGAGCTGGTGATGGG + Exonic
1185424774 22:50761598-50761620 TTCTCTGTAGTGATGGTGGTTGG + Intergenic
950670627 3:14523234-14523256 CCCTCCCAAGAGATGGTGCAAGG + Intronic
952321393 3:32281067-32281089 CCCCATGCAGAGATGGGGCTTGG - Intronic
954460899 3:50626325-50626347 CCCTCTGTAAAAATGGCGGTAGG - Intronic
954629348 3:52039780-52039802 CCCTCTGTGGAAAGGGGGCTGGG - Intergenic
954695431 3:52422212-52422234 CCCACTGCAGAGATGCTGCCTGG + Exonic
957447521 3:80333552-80333574 CCCTATTTAAAAATGGTGCTGGG - Intergenic
959604045 3:108222528-108222550 GCCTCTGTGGAAATGGTGGTCGG + Exonic
959961253 3:112302003-112302025 CCCTGTGTTGAGGGGGTGCTGGG - Intergenic
961974110 3:131004767-131004789 GCCTCTGCAGAGGTGGTGGTAGG + Intronic
964082465 3:152776163-152776185 CTCTCTGAAGAAATGGAGCTGGG + Intergenic
969531364 4:7732899-7732921 CCCTCTGGAGCCATGGGGCTGGG - Intronic
970411944 4:15817454-15817476 CCCTATGCAGAGAAGGTGTTTGG + Intronic
976818737 4:89180512-89180534 TTTTCTGTAGAGATGGGGCTTGG + Intergenic
983004596 4:162468125-162468147 CCCTATTTAAAAATGGTGCTGGG + Intergenic
991445455 5:66695248-66695270 CCCTATTTAAAAATGGTGCTGGG - Intronic
992638152 5:78745522-78745544 CCCTGGGTAGATATGGTGCTGGG + Intronic
994860334 5:105184765-105184787 CCCTATGTAAAGATGGTGCTGGG - Intergenic
995954728 5:117762969-117762991 CCCTCTTTAGAGTTAGTGATGGG + Intergenic
998631291 5:143901446-143901468 GCCTCTGTAGAACTGGTGCAGGG - Intergenic
999229429 5:150052889-150052911 CCCTCTGTGGAGAGGGTCCCAGG - Intronic
1002439260 5:179255910-179255932 CCCTTTGCACAGATGCTGCTGGG + Intronic
1003393672 6:5734544-5734566 CTCTCTGTAGAGAGGGAGCAAGG + Intronic
1005231716 6:23709392-23709414 CCCTGTGTGTAGATGGTGCAGGG - Intergenic
1007412227 6:41671581-41671603 CCCACCTTGGAGATGGTGCTGGG + Intergenic
1007662644 6:43496114-43496136 CCCTCTGTAGAGAAGGGGAAAGG + Intronic
1007859646 6:44894455-44894477 CCCTATTTATAAATGGTGCTGGG - Intronic
1008333697 6:50274357-50274379 CTCTCCATAGATATGGTGCTGGG + Intergenic
1015536315 6:134270808-134270830 TCCTCTGAAGAGACGGAGCTGGG - Intronic
1020424425 7:8048038-8048060 ACCTCTGTGGAGTTGGAGCTTGG + Intronic
1020465824 7:8477675-8477697 CCTGCTGCAGGGATGGTGCTGGG + Intronic
1023703259 7:42912908-42912930 CCATCTGCAAAGAGGGTGCTTGG - Intronic
1024034758 7:45497769-45497791 CCCTTTGTACAGTTGGTGATGGG + Intergenic
1024115087 7:46185250-46185272 TCCTCTGAAGGGAAGGTGCTAGG + Intergenic
1025602841 7:63015851-63015873 GCCACTGAAGAGATAGTGCTGGG + Intergenic
1026463577 7:70634994-70635016 CCCTCTTTACAGATGGTGAAGGG - Intronic
1030983304 7:116210888-116210910 CCCTGGGTAGAGGAGGTGCTCGG + Intronic
1032079104 7:128849828-128849850 GCCTCTGGGGAGATGGAGCTGGG - Intronic
1033319999 7:140330720-140330742 TCCTCAGATGAGATGGTGCTTGG + Intronic
1035536238 8:393422-393444 CCCTCTGCAGAGATGGCTCACGG + Intergenic
1036001305 8:4608060-4608082 CCCTGGGAGGAGATGGTGCTTGG + Intronic
1038913804 8:31996900-31996922 CCCTTAGTAGAGATGGGGCATGG - Intronic
1039356320 8:36820673-36820695 CCATCTGGAGAGATTGTTCTTGG - Intronic
1039484633 8:37900826-37900848 CCCTCTGCAGAGCTGGGACTGGG + Intergenic
1039759719 8:40561617-40561639 CCCTCTCTAATGCTGGTGCTTGG - Intronic
1040569061 8:48592188-48592210 CCCTGTGGTGAGAGGGTGCTAGG + Intergenic
1040670721 8:49686940-49686962 CCCTTTCTACAAATGGTGCTGGG - Intergenic
1041073293 8:54146007-54146029 CCCTGTGTGGAGATACTGCTAGG + Intronic
1041790031 8:61685133-61685155 CCCTCTGTAGAAATAGTGGCAGG - Intronic
1043066718 8:75580986-75581008 GACTCTGTAGAGATGATACTAGG - Intergenic
1046279038 8:112000648-112000670 CCCCTTTTAGACATGGTGCTTGG + Intergenic
1052695658 9:31874038-31874060 CTCTCTGTAGACATGCTGCATGG + Intergenic
1054709403 9:68496347-68496369 GCCTCAGCAGACATGGTGCTGGG + Intronic
1057841565 9:98489728-98489750 TCCTCTGTAGAGAGGGCACTGGG - Intronic
1060563016 9:124562834-124562856 TGCTCTGAAGAGATGTTGCTAGG - Intronic
1060912617 9:127362953-127362975 GCCTCTGAAGTGATGGAGCTGGG + Intronic
1062159723 9:135073689-135073711 CTCTGTGAGGAGATGGTGCTGGG - Intergenic
1193710083 X:84869173-84869195 CCCTATGAATAAATGGTGCTGGG + Intergenic
1193931135 X:87553951-87553973 CCCTATTTAAAAATGGTGCTGGG - Intronic
1194756043 X:97741204-97741226 CCCTCTCTGGAGAAGGGGCTGGG + Intergenic
1195007540 X:100701190-100701212 ACCTGTCTAGAGATGGTTCTTGG - Intronic
1199814602 X:151386612-151386634 TTCTCTGTAGGGAGGGTGCTGGG - Intergenic
1199868168 X:151873022-151873044 CCCTGTGTAGAGCTGTTGATGGG + Intergenic
1201751847 Y:17440927-17440949 CCCTATTTAAAAATGGTGCTGGG - Intergenic