ID: 1078631542

View in Genome Browser
Species Human (GRCh38)
Location 11:13008899-13008921
Sequence CGCCGCTGCCTCGAGGGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 111}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078631534_1078631542 15 Left 1078631534 11:13008861-13008883 CCTCGGTTTCCCTGTCTGTGCAA 0: 1
1: 3
2: 23
3: 202
4: 1287
Right 1078631542 11:13008899-13008921 CGCCGCTGCCTCGAGGGACCAGG 0: 1
1: 0
2: 0
3: 7
4: 111
1078631533_1078631542 25 Left 1078631533 11:13008851-13008873 CCGCTGAGTGCCTCGGTTTCCCT 0: 1
1: 0
2: 9
3: 127
4: 993
Right 1078631542 11:13008899-13008921 CGCCGCTGCCTCGAGGGACCAGG 0: 1
1: 0
2: 0
3: 7
4: 111
1078631536_1078631542 5 Left 1078631536 11:13008871-13008893 CCTGTCTGTGCAAAGTGCACTCC 0: 1
1: 0
2: 1
3: 7
4: 125
Right 1078631542 11:13008899-13008921 CGCCGCTGCCTCGAGGGACCAGG 0: 1
1: 0
2: 0
3: 7
4: 111
1078631535_1078631542 6 Left 1078631535 11:13008870-13008892 CCCTGTCTGTGCAAAGTGCACTC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1078631542 11:13008899-13008921 CGCCGCTGCCTCGAGGGACCAGG 0: 1
1: 0
2: 0
3: 7
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078631542 Original CRISPR CGCCGCTGCCTCGAGGGACC AGG Intergenic
900310058 1:2029278-2029300 CGCCGCTGCTCCGAGGGAGCTGG + Intronic
900520957 1:3105299-3105321 CCCCGCTTCCTCCAGGCACCTGG + Intronic
900702660 1:4057941-4057963 CGCTGCAGCCTGGAGGGCCCCGG + Intergenic
900793083 1:4692238-4692260 CGCCGCTGCCTCCCGCCACCAGG + Intronic
900987722 1:6082951-6082973 CGCAGCTGCTTCGTGGGCCCTGG + Intronic
901797940 1:11691492-11691514 CGCCGCCGCCGCGAGGGCGCGGG - Exonic
904652208 1:32014108-32014130 CGCCGCTGCCTCACCGGTCCCGG + Exonic
905205286 1:36339909-36339931 GGCAGCAGCCTGGAGGGACCCGG + Exonic
905263331 1:36734287-36734309 GGCCTCTGCCTGGAGAGACCGGG - Intergenic
906202673 1:43970207-43970229 CGGCGCTGCAGCGAGAGACCGGG + Exonic
921229181 1:213051314-213051336 CGCCGCTGCGTTGGGGAACCTGG + Exonic
922119093 1:222644508-222644530 CGCCGCTACCCCGGGGGACCCGG + Intronic
922725076 1:227918857-227918879 AGGCCCTGCCTTGAGGGACCTGG - Exonic
1063386506 10:5619586-5619608 CCCCGCTGCCTCTAGGGCTCAGG - Intergenic
1063395670 10:5685065-5685087 CGCCGGTGTCGCGAGGGCCCGGG + Exonic
1063504013 10:6580170-6580192 CGCCGCCGCCGGGAGGGAGCGGG - Intronic
1064208966 10:13347770-13347792 CGCCGCCGCCGCGCGGGGCCGGG - Intronic
1066218201 10:33309508-33309530 AGCTGCTGCCTCAAGGGTCCTGG + Intronic
1067416401 10:46106396-46106418 CGCCGCGGCCCCCAGGGCCCAGG + Intergenic
1070008291 10:72447301-72447323 AGCTACTGCCTAGAGGGACCTGG + Intronic
1070257678 10:74825688-74825710 CGCCGCTGCCTCCGGCCACCCGG - Intronic
1070610226 10:77927230-77927252 CGCCTGGGCCTCGGGGGACCGGG - Intergenic
1071526759 10:86363770-86363792 CGCCGCTGCCTAGGTGGGCCGGG + Intronic
1072555918 10:96513614-96513636 TGCCGCTGCCTCGCGGCGCCGGG - Exonic
1075616005 10:123891462-123891484 CGCCGCTGCCTGCGGGGCCCGGG - Exonic
1075718937 10:124573959-124573981 CCCCACAGCCTCCAGGGACCTGG + Intronic
1076836772 10:133025124-133025146 GGCCACAGCCTCGAGGGACGCGG - Intergenic
1077228171 11:1447338-1447360 CGCCGCTGACCGGAGGGGCCAGG - Intronic
1078631542 11:13008899-13008921 CGCCGCTGCCTCGAGGGACCAGG + Intergenic
1081957697 11:47107861-47107883 CGCTGCTGCCCCAAGGGAACTGG - Intronic
1083171030 11:60924293-60924315 CGCCTCTGCCAGGAGGGACTCGG - Intergenic
1084893763 11:72250605-72250627 CGCCGCTGCCTCTTGGGCCCTGG - Intergenic
1087046871 11:93850241-93850263 CGCCGCTTCCTCGTGGGGCTGGG - Intronic
1088849113 11:113690806-113690828 CGCCCCTGCACCGAGGGCCCAGG + Intronic
1089402241 11:118171053-118171075 CGCCCCTGGCCCGAGTGACCAGG + Intronic
1089630670 11:119782273-119782295 CACCTCTGCCCCGAGGGACGGGG + Intergenic
1094199229 12:27780135-27780157 GGCCGCCGCCTCGCGGGAGCGGG + Exonic
1098255418 12:68611007-68611029 CGACGCTGGCTGCAGGGACCCGG + Exonic
1103370227 12:120413934-120413956 CGCAGGTGCCTCCAGGGAGCAGG - Intergenic
1104568087 12:129903231-129903253 CGCCGCGGCCGCCAGGGCCCGGG - Intronic
1107605108 13:42048854-42048876 CGCCGCTGCCTCGGCGGGGCCGG + Exonic
1110630187 13:77698180-77698202 CGCCGCGGCCTCAGGGGGCCTGG + Intronic
1113203529 13:107892191-107892213 AGCCTCTTCCTCCAGGGACCAGG - Intergenic
1113381794 13:109811555-109811577 CGCGGCTGCTATGAGGGACCAGG - Intergenic
1114261120 14:21037014-21037036 AGCTGCAGCCTTGAGGGACCAGG - Intronic
1117875896 14:60249629-60249651 CGCCGCCGCCTCGGCCGACCAGG + Intronic
1119325760 14:73758994-73759016 CGGCGCTGCCGCCAGGCACCAGG + Intronic
1119615881 14:76099008-76099030 CCCCGCTGCCTGGAGGAACAGGG + Intergenic
1122221327 14:100240342-100240364 CGCCGCGGCCTCGCGGGCCAGGG + Intronic
1122418449 14:101561226-101561248 AGCCGCTGCCGCTGGGGACCGGG - Intergenic
1129137124 15:73564410-73564432 CTCCGTTGCCTCGAAGGAACAGG - Intronic
1129334470 15:74843935-74843957 CTCGGCAGCCTCGAGGGACAGGG + Exonic
1129626356 15:77204524-77204546 CGCCGCAGCCTGCAGGCACCAGG + Intronic
1132763175 16:1520894-1520916 CGCCGCTGAGCCGAGGGGCCTGG - Intronic
1133169406 16:3971924-3971946 CTCCTCTGCCTGGAGGGGCCTGG - Intronic
1143597297 17:7923001-7923023 GGCCGCTGCGTGGAGGGATCCGG + Exonic
1144840681 17:18183988-18184010 CGCCCCTGCCCCGCGGGACGTGG + Intronic
1146034059 17:29390718-29390740 CGTCGCCGCCTCGGGGGAACCGG - Exonic
1150484867 17:65536828-65536850 CGCCGCGGCCGCGAGGGTCATGG - Intronic
1152641946 17:81452894-81452916 CTCCCCAGCCTCGAGGGCCCAGG - Intronic
1152744070 17:82031270-82031292 CGCCGCTGCCTTGAAGGGACGGG + Intergenic
1153565651 18:6414891-6414913 CGCCGCTGCCCCGCGGTGCCCGG + Intronic
1154379614 18:13837478-13837500 AGCCCCTGCCGCGAGGGACCTGG + Intergenic
1160875004 19:1292823-1292845 CACCGCAGCCTGGAGGGGCCCGG + Intronic
1161669169 19:5595206-5595228 GGCCCCTGCCTCGAGGACCCAGG + Intronic
1163726282 19:18924867-18924889 CACCTCTGCCTCCAGGGGCCTGG + Exonic
1164602036 19:29568647-29568669 GGCCGCTGCCTGGAGGGCGCAGG - Intergenic
1164673835 19:30088945-30088967 CCCCCCAGCCTCGAGGGAACCGG - Intergenic
1165177876 19:33943288-33943310 TCCCAGTGCCTCGAGGGACCAGG + Intergenic
1166765777 19:45251561-45251583 CGCCCCTGCCCCCCGGGACCCGG + Exonic
1168691650 19:58381019-58381041 CGCCGCGGCACTGAGGGACCCGG + Exonic
925959572 2:9003218-9003240 CGCCGCTGCCGCGAAGGGCAGGG + Intronic
926190056 2:10721632-10721654 AGCCGCTGCCTCCCGGGAGCCGG + Exonic
927714046 2:25341433-25341455 CGCCGCTGCCGCAGGGGCCCCGG - Intronic
934978549 2:98822671-98822693 GGCCTCTGCGTCGAGGGAACCGG + Exonic
935571373 2:104664368-104664390 CCCTGCTGCCAAGAGGGACCTGG - Intergenic
941929993 2:170929502-170929524 CGCCGCTCCTTCGCGGGATCGGG - Intronic
1174045273 20:47728619-47728641 GGCCGCTGCTTCCAGGGAGCTGG + Intronic
1174120363 20:48260433-48260455 CCCAGCTGCCTAGAAGGACCTGG - Intergenic
1176099008 20:63356557-63356579 CTCGGCTGCCTCCAGGGACGGGG - Intronic
1178992781 21:37368139-37368161 AGCCGCTGCCTCGGCGGCCCTGG + Intronic
1179052086 21:37896789-37896811 CTCCGCTGCCTCTGGGGCCCGGG - Intronic
1181695040 22:24588699-24588721 CACGGCTCCCTCGAGGGGCCTGG - Intronic
1182352662 22:29707520-29707542 CTGAGCTGACTCGAGGGACCAGG + Intergenic
1184465838 22:44668628-44668650 CGCCGCAGCCCCCAGGGACTCGG - Intronic
1185278624 22:49960659-49960681 CGCCGCCGCCTCGCGGGCCCCGG + Exonic
953909287 3:46883522-46883544 GGCGGCTGCCCCGAGGGACGCGG + Exonic
954625259 3:52019049-52019071 GGCTGTAGCCTCGAGGGACCAGG + Intergenic
968799452 4:2732679-2732701 AGCCGTTGCCTGGAGAGACCTGG - Intergenic
972449481 4:39182406-39182428 AGGCGGTGCCTCGAGGGGCCGGG - Exonic
977937744 4:102826696-102826718 CGCGGCTGTCTTAAGGGACCTGG - Intronic
978532558 4:109729873-109729895 CGCCGCTGCCTAGCGCGTCCTGG - Exonic
979523871 4:121697222-121697244 CGCCGCTCCCCCGAGGGCCCCGG + Intergenic
981782499 4:148444157-148444179 CGCCGCCGCCTCGCGTGCCCAGG - Intronic
982460799 4:155667226-155667248 TGCCGCTGCCGCGAGTGCCCAGG + Intronic
985499518 5:233571-233593 CGCCCCTGTCGCGAAGGACCTGG + Exonic
987192928 5:15497961-15497983 CGCCACTGCCTCTCTGGACCTGG - Intergenic
992105481 5:73447073-73447095 CGCGGCGGCCACGAGGGATCGGG + Exonic
996018147 5:118563892-118563914 TGCCTCAGCCTCGAGGTACCTGG + Intergenic
1000118966 5:158178673-158178695 CGCAGCTTCCTTGAGGGGCCAGG + Intergenic
1002009553 5:176266425-176266447 CGCCCCTGCCTCAAGAGGCCAGG + Intronic
1003645535 6:7910648-7910670 CGCCGCCGCCTCCTGGGCCCGGG + Exonic
1007665351 6:43510138-43510160 CGCCGCGACCGCGAGGGACAAGG - Exonic
1009431730 6:63572915-63572937 CCCCGCAGCCCCGAGGGGCCCGG - Intronic
1013225560 6:108117762-108117784 CGCCGCTGCCCCGCGCGGCCGGG - Intronic
1015183191 6:130382933-130382955 AGCAGGTGCCTCGAGGAACCAGG - Intronic
1018686281 6:166307296-166307318 CGCGGCTGCCGCGCGGGGCCGGG - Exonic
1025069676 7:55887590-55887612 CGCCGCCGCCGCGGTGGACCCGG - Intronic
1029896663 7:103990248-103990270 TGTCGCTGCCGCGAGGGGCCGGG - Intergenic
1030348310 7:108456636-108456658 CGCCGGCGCCTCGAGGGACTGGG + Intronic
1035818091 8:2562217-2562239 CTCACCTGCCTCCAGGGACCGGG + Intergenic
1036787999 8:11700711-11700733 CGGCCCTGCCGCGAGGGATCCGG - Intronic
1049204956 8:141359350-141359372 GGCCGCCGACTGGAGGGACCTGG - Intronic
1054810148 9:69428129-69428151 CACCACTGGGTCGAGGGACCCGG + Exonic
1057221917 9:93262034-93262056 CACCGCTGCCTGGCGGGCCCGGG + Exonic
1062501942 9:136855446-136855468 AGCCGCTGCCTCCTGGGCCCCGG + Exonic
1062562617 9:137148420-137148442 CGCGCCTGCCTCGAGGGTGCAGG - Intronic
1187046519 X:15652831-15652853 CGCCTCAGCCTCGAGAGTCCTGG - Intronic
1196965113 X:121047430-121047452 CGCCGCGGCCTCGCCGGGCCTGG - Intergenic