ID: 1078634015 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:13031966-13031988 |
| Sequence | ACATTGGCAAGATTGCCTTA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1078634015_1078634018 | 14 | Left | 1078634015 | 11:13031966-13031988 | CCATAAGGCAATCTTGCCAATGT | No data | ||
| Right | 1078634018 | 11:13032003-13032025 | ATGGCAGAGAAGAAATATAGAGG | No data | ||||
| 1078634015_1078634017 | -5 | Left | 1078634015 | 11:13031966-13031988 | CCATAAGGCAATCTTGCCAATGT | No data | ||
| Right | 1078634017 | 11:13031984-13032006 | AATGTAAGACACACTAACAATGG | No data | ||||
| 1078634015_1078634019 | 15 | Left | 1078634015 | 11:13031966-13031988 | CCATAAGGCAATCTTGCCAATGT | No data | ||
| Right | 1078634019 | 11:13032004-13032026 | TGGCAGAGAAGAAATATAGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1078634015 | Original CRISPR | ACATTGGCAAGATTGCCTTA TGG (reversed) | Intergenic | ||