ID: 1078634015

View in Genome Browser
Species Human (GRCh38)
Location 11:13031966-13031988
Sequence ACATTGGCAAGATTGCCTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078634015_1078634018 14 Left 1078634015 11:13031966-13031988 CCATAAGGCAATCTTGCCAATGT No data
Right 1078634018 11:13032003-13032025 ATGGCAGAGAAGAAATATAGAGG No data
1078634015_1078634017 -5 Left 1078634015 11:13031966-13031988 CCATAAGGCAATCTTGCCAATGT No data
Right 1078634017 11:13031984-13032006 AATGTAAGACACACTAACAATGG No data
1078634015_1078634019 15 Left 1078634015 11:13031966-13031988 CCATAAGGCAATCTTGCCAATGT No data
Right 1078634019 11:13032004-13032026 TGGCAGAGAAGAAATATAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078634015 Original CRISPR ACATTGGCAAGATTGCCTTA TGG (reversed) Intergenic