ID: 1078636531

View in Genome Browser
Species Human (GRCh38)
Location 11:13055473-13055495
Sequence GTTTGGGAGGTGAAGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078636523_1078636531 -3 Left 1078636523 11:13055453-13055475 CCCAGAGGTGATGATGGTAAGTT No data
Right 1078636531 11:13055473-13055495 GTTTGGGAGGTGAAGGTGGTGGG No data
1078636524_1078636531 -4 Left 1078636524 11:13055454-13055476 CCAGAGGTGATGATGGTAAGTTT No data
Right 1078636531 11:13055473-13055495 GTTTGGGAGGTGAAGGTGGTGGG No data
1078636522_1078636531 -2 Left 1078636522 11:13055452-13055474 CCCCAGAGGTGATGATGGTAAGT No data
Right 1078636531 11:13055473-13055495 GTTTGGGAGGTGAAGGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078636531 Original CRISPR GTTTGGGAGGTGAAGGTGGT GGG Intergenic
No off target data available for this crispr