ID: 1078637888

View in Genome Browser
Species Human (GRCh38)
Location 11:13068875-13068897
Sequence TTGGAAGTCCCCAGGCTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078637888_1078637894 22 Left 1078637888 11:13068875-13068897 CCCTCAAGCCTGGGGACTTCCAA No data
Right 1078637894 11:13068920-13068942 CACTATGAAGAAGCTATTATAGG No data
1078637888_1078637892 -1 Left 1078637888 11:13068875-13068897 CCCTCAAGCCTGGGGACTTCCAA No data
Right 1078637892 11:13068897-13068919 ATAGCCAGTTTGTGCTGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078637888 Original CRISPR TTGGAAGTCCCCAGGCTTGA GGG (reversed) Intergenic
No off target data available for this crispr