ID: 1078638029

View in Genome Browser
Species Human (GRCh38)
Location 11:13069844-13069866
Sequence ATCCAGATGGACCACGTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078638029_1078638035 23 Left 1078638029 11:13069844-13069866 CCCCCAACGTGGTCCATCTGGAT No data
Right 1078638035 11:13069890-13069912 GTTCCTTTGGCGATTCTGTTTGG No data
1078638029_1078638034 10 Left 1078638029 11:13069844-13069866 CCCCCAACGTGGTCCATCTGGAT No data
Right 1078638034 11:13069877-13069899 TAAATCACACTTTGTTCCTTTGG No data
1078638029_1078638037 27 Left 1078638029 11:13069844-13069866 CCCCCAACGTGGTCCATCTGGAT No data
Right 1078638037 11:13069894-13069916 CTTTGGCGATTCTGTTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078638029 Original CRISPR ATCCAGATGGACCACGTTGG GGG (reversed) Intergenic
No off target data available for this crispr