ID: 1078638751

View in Genome Browser
Species Human (GRCh38)
Location 11:13076443-13076465
Sequence TACCTAAGGCAGACCAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078638747_1078638751 14 Left 1078638747 11:13076406-13076428 CCAGCTGCTGATCTCTGAGGACA No data
Right 1078638751 11:13076443-13076465 TACCTAAGGCAGACCAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078638751 Original CRISPR TACCTAAGGCAGACCAGGCC AGG Intergenic
No off target data available for this crispr