ID: 1078638986

View in Genome Browser
Species Human (GRCh38)
Location 11:13077921-13077943
Sequence TGCCATAGTCATTTTGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078638986_1078638993 -1 Left 1078638986 11:13077921-13077943 CCTTTCCCAAAATGACTATGGCA No data
Right 1078638993 11:13077943-13077965 ATATAAGGAGGCCTGGCACTGGG No data
1078638986_1078638995 6 Left 1078638986 11:13077921-13077943 CCTTTCCCAAAATGACTATGGCA No data
Right 1078638995 11:13077950-13077972 GAGGCCTGGCACTGGGCAGAGGG No data
1078638986_1078638991 -8 Left 1078638986 11:13077921-13077943 CCTTTCCCAAAATGACTATGGCA No data
Right 1078638991 11:13077936-13077958 CTATGGCATATAAGGAGGCCTGG No data
1078638986_1078638994 5 Left 1078638986 11:13077921-13077943 CCTTTCCCAAAATGACTATGGCA No data
Right 1078638994 11:13077949-13077971 GGAGGCCTGGCACTGGGCAGAGG No data
1078638986_1078638997 23 Left 1078638986 11:13077921-13077943 CCTTTCCCAAAATGACTATGGCA No data
Right 1078638997 11:13077967-13077989 AGAGGGTCCCCAGTCCAGCCAGG No data
1078638986_1078638992 -2 Left 1078638986 11:13077921-13077943 CCTTTCCCAAAATGACTATGGCA No data
Right 1078638992 11:13077942-13077964 CATATAAGGAGGCCTGGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078638986 Original CRISPR TGCCATAGTCATTTTGGGAA AGG (reversed) Intergenic
No off target data available for this crispr