ID: 1078641758

View in Genome Browser
Species Human (GRCh38)
Location 11:13103448-13103470
Sequence ACTTCACTGGGGAAAGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078641758_1078641767 9 Left 1078641758 11:13103448-13103470 CCACCCCCTTTCCCCAGTGAAGT No data
Right 1078641767 11:13103480-13103502 AACCTTTATTCCTCACTGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078641758 Original CRISPR ACTTCACTGGGGAAAGGGGG TGG (reversed) Intergenic
No off target data available for this crispr