ID: 1078643778

View in Genome Browser
Species Human (GRCh38)
Location 11:13119545-13119567
Sequence CTGTTGTTATTGAGAAAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078643778_1078643783 10 Left 1078643778 11:13119545-13119567 CCCTATTTTCTCAATAACAACAG No data
Right 1078643783 11:13119578-13119600 GGGCGACTCTGCCTCCCATCAGG No data
1078643778_1078643782 -10 Left 1078643778 11:13119545-13119567 CCCTATTTTCTCAATAACAACAG No data
Right 1078643782 11:13119558-13119580 ATAACAACAGCATTGCTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078643778 Original CRISPR CTGTTGTTATTGAGAAAATA GGG (reversed) Intergenic
No off target data available for this crispr