ID: 1078645223

View in Genome Browser
Species Human (GRCh38)
Location 11:13135906-13135928
Sequence CTGTGTTTATGCAGGGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078645223_1078645231 30 Left 1078645223 11:13135906-13135928 CCCATTTCCCTGCATAAACACAG No data
Right 1078645231 11:13135959-13135981 CTCAGAAAGCAAAGTCTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078645223 Original CRISPR CTGTGTTTATGCAGGGAAAT GGG (reversed) Intergenic
No off target data available for this crispr