ID: 1078646225

View in Genome Browser
Species Human (GRCh38)
Location 11:13143248-13143270
Sequence GTGATGAAGCAGAATGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078646223_1078646225 7 Left 1078646223 11:13143218-13143240 CCAGGGTTAAGTTTCCTTTTAAG No data
Right 1078646225 11:13143248-13143270 GTGATGAAGCAGAATGATGAAGG No data
1078646224_1078646225 -7 Left 1078646224 11:13143232-13143254 CCTTTTAAGAAGTGTTGTGATGA No data
Right 1078646225 11:13143248-13143270 GTGATGAAGCAGAATGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078646225 Original CRISPR GTGATGAAGCAGAATGATGA AGG Intergenic
No off target data available for this crispr