ID: 1078650941

View in Genome Browser
Species Human (GRCh38)
Location 11:13191576-13191598
Sequence GGTCCTACCATTCTCAGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078650938_1078650941 3 Left 1078650938 11:13191550-13191572 CCATGCTAAGGTTGCAAGCTGCT No data
Right 1078650941 11:13191576-13191598 GGTCCTACCATTCTCAGATCTGG No data
1078650936_1078650941 15 Left 1078650936 11:13191538-13191560 CCTGCAATTTTTCCATGCTAAGG No data
Right 1078650941 11:13191576-13191598 GGTCCTACCATTCTCAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078650941 Original CRISPR GGTCCTACCATTCTCAGATC TGG Intergenic
No off target data available for this crispr