ID: 1078654441

View in Genome Browser
Species Human (GRCh38)
Location 11:13225289-13225311
Sequence CTAAGGCGGGGAGCCCACTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078654434_1078654441 17 Left 1078654434 11:13225249-13225271 CCTGTGGCTATAGGCAAGACAGA No data
Right 1078654441 11:13225289-13225311 CTAAGGCGGGGAGCCCACTTAGG No data
1078654433_1078654441 18 Left 1078654433 11:13225248-13225270 CCCTGTGGCTATAGGCAAGACAG No data
Right 1078654441 11:13225289-13225311 CTAAGGCGGGGAGCCCACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078654441 Original CRISPR CTAAGGCGGGGAGCCCACTT AGG Intergenic