ID: 1078654832

View in Genome Browser
Species Human (GRCh38)
Location 11:13229029-13229051
Sequence CAGAGCAAAGAGAAGGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078654830_1078654832 3 Left 1078654830 11:13229003-13229025 CCAGTACTGGAGGAGAACGAAAG No data
Right 1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078654832 Original CRISPR CAGAGCAAAGAGAAGGAGAC TGG Intergenic
No off target data available for this crispr