ID: 1078654892

View in Genome Browser
Species Human (GRCh38)
Location 11:13229446-13229468
Sequence CTCGGACTCCAACACTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078654889_1078654892 5 Left 1078654889 11:13229418-13229440 CCAGCCAAGTACAAGAAGTAGAG No data
Right 1078654892 11:13229446-13229468 CTCGGACTCCAACACTGTCCAGG No data
1078654883_1078654892 30 Left 1078654883 11:13229393-13229415 CCTCCCCTGCTTCCTTCTCCTCT No data
Right 1078654892 11:13229446-13229468 CTCGGACTCCAACACTGTCCAGG No data
1078654884_1078654892 27 Left 1078654884 11:13229396-13229418 CCCCTGCTTCCTTCTCCTCTTAC No data
Right 1078654892 11:13229446-13229468 CTCGGACTCCAACACTGTCCAGG No data
1078654888_1078654892 12 Left 1078654888 11:13229411-13229433 CCTCTTACCAGCCAAGTACAAGA No data
Right 1078654892 11:13229446-13229468 CTCGGACTCCAACACTGTCCAGG No data
1078654890_1078654892 1 Left 1078654890 11:13229422-13229444 CCAAGTACAAGAAGTAGAGATCA No data
Right 1078654892 11:13229446-13229468 CTCGGACTCCAACACTGTCCAGG No data
1078654885_1078654892 26 Left 1078654885 11:13229397-13229419 CCCTGCTTCCTTCTCCTCTTACC No data
Right 1078654892 11:13229446-13229468 CTCGGACTCCAACACTGTCCAGG No data
1078654887_1078654892 18 Left 1078654887 11:13229405-13229427 CCTTCTCCTCTTACCAGCCAAGT No data
Right 1078654892 11:13229446-13229468 CTCGGACTCCAACACTGTCCAGG No data
1078654886_1078654892 25 Left 1078654886 11:13229398-13229420 CCTGCTTCCTTCTCCTCTTACCA No data
Right 1078654892 11:13229446-13229468 CTCGGACTCCAACACTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078654892 Original CRISPR CTCGGACTCCAACACTGTCC AGG Intergenic
No off target data available for this crispr